ࡱ>    !"#$%&'()*+,-./013456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdefghijklmnoqrtuvwxyz{|}~Root EntryPXyYC  Formats0[-YC PXyYC Global BYC QYC PartitionsQYC \wYC ContentsH+TransmissionData"! BasicFileInfo)PartAtom02DocumentIncrementTable. qHistory QPartitionTable MContentDocuments"sElemTablepC#LatestcLatest=3 tx-move_742162_004_3_4fe92023-10-30T16:11:25Zadsk:revitadsk:revit:groupingLighting Fixturesadsk:revit:groupingtx-move_742162_004_3_4fe9.rfaRevit20212023-10-30T16:11:25ZFamily ParametersConstraintsFaceDimensionsUse DiameterMechanicalNormalIdentity DataOtherNoNoNoNoFace1MultiLumen 1 (1 x LED Modul 835, 3050 lm, 3500)1190.00 kg220-240 V230 Vmultilumen_1http://relux.com/search/artfwd/rzb___742162_004_3_649d/742162.004.jpgMultiLumen 141 W6100 lm11611610 WsocketZN3q8ryccAATrZ4Hx/0gAAAAAAAAkAAAAAAAAAM0PZrjhTxxIFV0Af7Yb7fCEQFjjkd4QJ1hhiyLIBlgrCWUW7+Z03W9/Lrvm0hKhcWirWwvdVtoMHoW0gpCyup/KMu6Ki7N8db3ma6E0KYklQCLXrwWrX7IqkNc+HLQTIPJRxhp50u6h3v/O4fL69cpRyTXlrRoKZJRUOxByHpo+ntAWL2QTTRk3Hcw4SN6VLKOr2aKicpb4SZ4th+DVAgHmguNrmUv71obTfo6XKAzNI/QM5UX3e3hl8s1E8ChjUh3w7ZjXnSnk/ZHymFamjit0s5t1cbCJBUCSeJiQye67cc1YY2qRvzr+7C/O7C0K3CSIysaqBggJ1V0uCRnmkScNmcskoANFEpI6nc894QxOHJ5kjI1DgJbPH8fpWHJ+VoYVb6Rdgq/uwcNyJDLu3VXN5mfAeuuFpleflPKHnuFUMV4TrV+YwICFi/4FvnJ7Zie2scjeD/OysWNCKbQY721oVmEsn3WuurAbVs7on6Ryut/dINmeA9LhTHleCLsRwh9ZTDwTr7nquyWFMaiEr7+EheO8d74giRnxmis7DwdLsJkomLNUvSjLe65KNmmShF+TPVY6500shZYif+TcBk9qoaG2rrTqZXnxYNNBZwh2WEU/Fg/tj3AQ9xN5wfSZRu/3uiOts7RYkVx/EUcpsxkv9Ayj4w3rTEZwijjBV1VtQt/VKP2CcFKEtyHrHkhLPSDPxdnxbcU1j2BZlYAoo2v0kCSgQ2MEA6niKxbOowmwBidSPOJP2exGhk0j8QmPq6izks7ejOW69RL9TuE+NvlYQEE+vHEYt7Rod118ngUtIVCE9ubiUq0z5g13bOL3SmdrBsGDzzan03SSXU/vc7oqJt0dmVLdliv4hQZ5xCORgkVPUuDEw+NsF3lYyQ/hVqIPrgrrL4P+JDI6ZJ8AsBlJU1/LvhD7kUM2w5lzrL0C/79NikyH6X3msStRpz8KB6lM2koeeRx4TyggGTKA4uORL45pUi+RwHYMRLldj98gy+oz/NKpu4aS55fXEyKEO8qQ5C762qTbEmO+5EYHhdnYEsyhSA6u4VrOUFxsG4G2rPZLQR375UjOcCLfWUfi0m7Yh8zxBNJwTTKhrgvxjJHK2mhVcWUaGRGHaemhOYDNft9aKAYZ3oh4mLd84/5ij3YIgPS56rdSgZ8To6uQNE31qKsiDlHAbGb99h54+Mf1eKocoXYMxaOXM4M7p+B6EHngy2uqSDj51bNridhYqynTGXurj0b9PkHxWcsXoRmPGYcrINeN4ZLZmq7ieNqi9qM/rI69xU8UjdTc+zSH/bLQfIqEUjVdm8ybxjLasYRCIRe3M99812ZdJknE1hiltguklEt4nat6cc5LYKzRslCiel7mLoFujNTl7nMopWYNmCx5xJKFnDAC77o6l1QHUxOBauLfXPOgmBeZAmFIZGtsE9FRcCiEEcU+An1DrYQwPoG7WW6AKscPtrnDrFWDXw6zvuxU3WXBWKmxjynl/AcGHbJpb90BcvB4B2oRh261hnHhq41llr8f7tofFD3+Nrzjlli7WLOE1HA+ByxlpcQdArbxQsY+NgPsDgwgarXs6qv1odkwzS4HNkYbEAkAK2HTCK53dZPdJhCJQGfBifeXrTxx7tJWX6vk9pI3ipHRCu1KBl8mXxCHfq0JXYneJ1oOGj10bk92u0PWyTLjgpe+lDVShvoJBJnFaazBlnaUanIQiinFj79FmODfIN6JNUEp9XK5lYrxCxRbse99tvJQM49YtPFYe4q2qkoQYu7c/Rcxh12pLcdWExwf5G9Uj84CIooFHEtTNJR4zEq1jyjkVtFgL7yaLnwKK02bht/f6O5qFaRCOFQj8hrAX2+hI5fE3dy95GVD0+ljAXn7MCSWnPVIHlH4rU5ScCW66VaVuy7nEWD6/uXAtUaMEhSP+T5oXl4LRhVsoaWu/gFB2p29pwhDr9E2lNUVB38SiLGvG/U+5KumpPICJjrNY8aF2ZLBh5Kedj1I6TiW4b8du3EX88kwL6ZDzo81zoc6xF+5m6+tHgep7IvCP2XGeuMEB3xhaOMxU1hrqZO7/urDlP+qfK4QC5IfCLpGCnut0FV/iHT2tX3UNPOyWzljvDCStJ0796KoQnOyy5lRyCfVYEE5qQh1XN5u2BvZk5JF1+I99YqFKI6mOvH1ERHLYmnkX+3SHVnJyQm3b5T165AQ208O7eMjRTcs5D/uRLWGjkn7b8x6x13oPbOE9IHtccpm1QM9s65MxMUtGndCnWQl3u2ZtbyFX7DrzmD3bQshSMrmFCIw5rlEi58dyj1dm09JcqaK09h1JfMyWyl9eSfrpRyAcxneDPCJ3bC8hZeXszUFAZj0YuwoDA0tVJScIj7jP0MIIBgiXQdbDiBv7l0QAmc04yvNwO4W55nmxFZel0dYnZGvpYSVLh6jeXLdjrqaCEoYUlxynXBGyEB0lIew01eXpt62Ux4w/d64ihY8e8vKJzLkoHAaxAPXSHUQpgGM7gXqs5GHAgNFPmFRNbFumz+e5BGKKMqMMN9E2lwPlK9iec3uZD0dr6CD1dBGtHju+pa+Dv+ggV5OlH8+QN9F4GGldp3cl8evCgNdGVgDBD/rvFnTS/xTWFIgfErheb+iViO0aywUQ0wFoDwPEv6VfoKMs7tehZbfP0joRP2p8ul7KdRYx5lR7iKiiB++/mttMwpmGFvzyCTqiN2FTSlMLGSBpkagZHbK0tEWnXhVfQnpnEOQik+LUWlOZlhYUbZTLgu0my7AQ8cdoUNX4HGwMfl+BwIjvGO9fyXhov/+1j/1PFIf64aCkLP4QDeicNWnHNKFH9DPf024X3CR0b3r65WddCWAqVh59W5+lZcFYOinsqeGOiomhhQwbrwnHykVCE1YHWScu+S/jp9TLLfC08cX7lq8dU5U+JnpbRoYtFDZA2/GkJ2USLFGaJZPdjGTkigm7Z55Y/pXigv/oDfcetSs1NNJL1I3OR0sWiRAkF0fT/diUKTTF674Xo8kid8LNeAhSMNNaXcXEVsUXFw7wH/ZNR4rZENeusxlnGb4RlyhJxSVf9tWtFoq12Y6JZT7WM9EDV4rSSdEiRlItoYf6gV1T2ivTW5T+XFRn4lglAj4M4szRuKN471A3eK6ybKYhcoy79Izu8mKeXwIUkAQuF6CuzWwijSUvgNhlHlXsIM85EEsC1lZGrg/O9hmbZ5XP2H70goqWLCBU5eiesKaPagQo7eRNXdpXgpN23lzhOdjLRbMYCwYYUw9MzCI3pWKMgRvQOnUgE7eIkhFqwlWipTGFzrmN1enTZTMiuVWQwsnR4x0FXrQ/LBF+VTPGR3ePzPPpx6Vn/I5+hjOnamMxgduGO+gfx11oQ88pbbFw7OJTIzO1vgKh7XHRHzGok/lNVFbYeD9vD1D3DH6EJ1n99kk6jDB1FkBz68BSpOfAQy+Pb9Jfm5ZKmKgrNtS/XX9swFJMfR3PGqX910+ou5Ca3p6EvZgj15WrgLUUhe1Ub6LDAyrojz81TkCikjfPcbsEe6UKFACYnKpSQJL11A7WzhRU+NLcXJrvLw7mFVJNqJHfifAQ9p69G/zXIWNzs8/+0nZDujadDaei3RSmU0Z/dRTbMU2sVkIeciHcdNMWmk6a4g9hnrgkaHuwItrXSX+4AeDZvOIzI9izqjok2k1ykBh7dPpimv4xKHfTLXSzHE1VRbCC8mEaWpy4GVnjyE9kaTQETmLG9fx5ewmfzAIxaWox6t0fmgXS7zjyN+RbbB+Aiio+CSsFqiHYSt/M5LkOcgkgJYid8DWbtK91ojz7l7PmOVm8PMm4hSQkV1u7Y4QU7JwnBSoBvHI9BYhMBgQKX3wSYEulB8WPpw38VIUje3I4ozxLfPmZn7iY/j9oykDlU2AGIA5AC+6VQFQ416zsApI+31XlULVnDEKFK/mjdsxixF7W7pjFZ38nVGr3ETqTLjIDX4OGfqkfO7vPH4yjf6gWD5apCsxn9lNqka4klDMjUk6UoGbQ3jyEYtIYjp0KcxqMvrkKM/VeqTiEXl+zZcrYoraqi11ZQOspnsDOVneZZ9WIyY+hPBJR550gq9P18Ui8AyQ58tJ116sPc2Z3VVU9NthCXF+JTx50nzNFtHZBue2riGXAtzgvqA7f6t//1UxSvZDQXnkuA9yBEBDJG45PpvdcnxhySC2zmJrAgQbsRmN5tQkSOr1bTvSlrtt/qRkpnPgBHxumzQXkDLvWcB9hjzXKQtoNiEQCbvXDS6kxFo0Zjw2nO7TK4KldxP1xXgtS46jZG9je6pY0OkFk1XJlmcduYEWXPVsAFTC+X8b6Xrbxmrc0r2/NTIL4a1OvUvq/ovDyNDFxQ+VPLM/b0mCxDckzWrD9s2SaAozVSYhj2bwD1duDQ1Bz122P7wbxhhl7tQW9qWTCgPkL4OLTxHbJorjYkQ7TwnZum0GM4RE+2gRQerw9HrE1WaNQYoOa8QG8klRhvIkWDypJPZzH2cYry43DDhK+mTrJH9Z8NTCGSauxxCjYsPqzyr+kS+dUEedqJ66ruEchxzXKQnOBCDGR3M/1q6Sl4n1CX6FOTdWQtDr/kj7UFGXUr5XW8zKlQ1CKaiM1eHDwW/6lMYs8uH2l21vdizr8dIfhZt+gXFe/7HaMm6yY1zvjT15tPme4Gi4bEfymlWyvDtL+yNmy8NyqYVUwtiDVpRYpgyoLrOAUalo0b1i2tLQV+20F6I2RX+qndFK1Jkl/hlBGEj9NSAvaunNYr944NU2cSPbFH4mZGPwR+wZiOzzYWekBsrcV2SEahmUcnR5/WfRsC+tF96lblRMkq9NluceEp8PJcjZj3Zrtdxxr1nJLEV7TfsEhk5VL2L4BJt1qm4Mvo5YqPXFDpR13OXyJHXrOYxeE2Cto/kRuS9qHcB1ApjkxDs+2yuQatCMkCE6kvB0zn03cBW5SapNznfWNvzbqFLKLpG1kGNvW7PTg3Zls3ryr240VvyegxtuXZLq3lJnNSMFCOCkOAIBYptuKST9Pid2/4Ng+jLsQaexNDaA3U6V1b5e9lqrm3Cyar4s1DjpNoItQ3D/g0cNSxhDxOVRenbHndhkY5fRaptSfbEuKvqxp/6AOjEfRkx+i5bAfVKW8tJLri2sviXzICNQ+iKA8csiNm6MM8mlqIh8scM6peKOVtZd4/9JP/WQsd/s9XACcLyUsrhyey393RMFuOGEOJjV+Q/D9NXlenRGiKJd3bo+HT7JaQPva00d7JhNORGNgC7jjfH1pcN5OElR5pe318m6FBBTRmLweXDR7pIIOGo0o8XkRZ0EWOwxenyGUKLIyVi/QENNSMlrLywtI5PHZSSBUY/1oDYWSf8U7KezndT6f5Ftn0uF3Hv8rH/b/7+uOlTLTB/seMDLRF3xVxew6kdwebRVyp0n73maSMXuVFm43t5EeNbYhYxNJx0C23wtuWpUfVFNb3Vm6KyMkB3IJI3BVQPCGg6hOzYTNZsYaHRl1TFeIY3UJTcduS8H0pRikvk+0PJOPjlW7Eb0PVTYnC4HO6PlliR1fuEinBpsOptYlJRg9u0EEef5wMEJjnIP5oLcF8zYPWCNeKvDr54OGiZfvVRX+uws/nY116LHqfmfMOnn4/0wGS0Sd02+RmxeecuBbU36ahNuTOMwUnhzKxzI/lrqTdQZdJfdnyRxPj2z3FgOOe2kFjfHwsmRmaLYyYxtLN3Lgh/+G5a8w0oj0+NnTDvl4scp3MJsJU3aoV88Y/Ex3PSIDW5DcIoWdvgFmJxRMh4I4wEBj53YSYmGSD8PFH7s1RN2mqJc32wyfvMB+iDYUH95Qr8NseerXuFHdhgzqwNAy8ORVWKqyLZ7SWBy8bEDFvGvja7ZDnJL0Nnag9pqsjWtWYR5IugKMtlzn2vbu83e3MDqAO437IeQ5kenb8zDk2prJF5uAkBVDFE7nmaeYaQhJb3Gl5RT2Y4AIs+K6YNS/JyClN3VB4CnPw6Q3zoA4XedQliHzOIOSDszCmGEbcgdxaHpUT0iwG31/259vl2oaiJPskm+NU+evTrC/6AOj5vO5PBI/gZTPfKRq7W3F3RIDpe1AAtFxHGW4H8FzStUdF8rRbKc3q9b5NwDVSnG9aeSNSovnclXUn+Itua3eMcA4KF5jlE16dpnJfonebSreRfaXPxbn7aBzIvG0Lc+TdD+lz93sOI6ENsUSI6k+tz7kjpk13gENBfclTvXnfHWalc3Iv0chkyUkCu+Rdoe44EID/2BNqtWC3UmrEllF3j6jVatEY2WHnRRUEHut/0COS6LJZ5fFXLsBi/D3JNYVSG5hE87c4ipV/rPC4a8sFF+OjIt+IrwUpomSW6WMxwnc+yxTQrV0jQj0mg6VlZm66UvbL6k45hI7sKkVOYgooNbnHS/8AkaKY401jiwjA+u9yxhkOtcbIBL17x6sJZfY7Egk7xcmSVJ6pbtd2Qgtxg/3GuzwBE9Xe+m/wdJiliQwad2l0Gcsh8r8ZrH2qegUdoBG3uJ3pLDTvNUqR/G+bx781pwomegX9TNQ86hoEKPQZRIhJx8lzj6e08fcfVIAFQxhHoCw4FeMO4HjPze64i6vdYBORILDCNhj3pwxBXnRbygKO8VFt27o9QDv7SPSaxJ+QxEWU3skH4JVmTHyi5Mfcy4XlzaR+8ZM08jzSFQ0F49FI3SJXxuT0FgamloDOxXiJ1Mv9dPEGeA0eCZKxtpx/usnVeLsxmDGXr/4flaeKtBRtsY2r/kAWbcovVQhwIbM5LCUyZeXaROCY/RYjJ7jvrSXWzXcRjhMUSDsroWnxT7LgfQHto3C7wy+zDpZoF6+yzaUfHthmUfmatOICA52/s/3qQycmNRlwMXAvcIvKUNO5oY2oAWvVl/ND0/Ckh02oFeQpgCe6i8kv2+VyCemBuk7s7kwddToqf+SEvO9zBFGtEDnULqTzG9rHXtP+yn565fEp4/uf47/SMQ/znObPoHP+HQTGZRdox/okbgIUvxnC4i3+aXwK5uro7Hq2sKzKek5KGx5+SaY0N3poLTFMwj1KPbsVLTgRkx7JAhCUGZP6VP2IUiwJzne58BZ2QgNFVUYFggBcchnhIrOaXi7MfEcj/DlEGeUYWH0KzyVHImnKd7aLGTkl10yXUu6hakPrJgw2CfNNbx6rtbpOImJDpNCl72Ry9h6jm04hZlhuQhwBeNvBaOPgRtkPU/ECL9o3WB3EartDh4QyrlyQdjunnTSN+7PpzGEGeb726Y1OQ2NyapwhSaVM4r2dcGR6QxWjiTA2YxuiPVS3RmCywYdWbfvuLoF3NhbpCi+6uMYrriGPyDEHz+l3F2RsH94OA4w7tDiwWNd8EbQLa9LZ3dKFsztNv56xqhIWVUezb/b73mGFCT2BPgLXIFE9LdvpZIrwncnVYcRRQCKB+g4cl0fm4bj5PjuYvOmsHe+t9mKIs8hiTFLHqOaAFkGExvU1bg6RKUJcT97CLIzTuVfKG9Aj8JV1tACC79zKYsHnbwWLavnqaJVs/wtKAGzc7LJcuhTGcSV3AofWXvFHWZuS5+D7ugeIGSGa58eDalycfGs35pjNqgnTUeHSd0NEiyV2pCRvN+LupRqCvzTS9kLtcoe2eYKH2VTHpp3FaYJUO5VKmS83TyHiVEu4fqNAym351Blq5YB1B1ChCKVfwGHSv67n/00moIftKuJV6Nyp/q401dMYO2PPPWd+7dJsQcgD1HOcou1q2TBsk4Ebr0q/+hmGjfP5+skCudHFl+LZHab6kqgfAiKULxqmJqK6pZqHjcqfBMNCnO4cbDqnVjckg3oVq7uLLre8pqFqOgRrv6HiWg+lRDuwvS86284TWQVLvI9cFfyfMkFp4hjF8evWMX3oZp+CgnNb9n+tnNS8KQButKM1K9+YVd9dv1RyoLeQtY6zsyHo8GIwpNsu12loPiQwPD5UtSTdEw/YHs5HHfQ9RB0Sv1PlJQfglGcGS3DayfQwBLIQphnv59BlleaEsmPIshxGTEft1vcy6j+4TezRb8Lo4AaHUdwIN9JtMazGoUf/+LRc+eCm32mrs0Q6zxYr9BsybvaQZAV6QrP1yvxVj9d2edKmc2Ccx1FjQ/6TMmq7YDkErf+hXc4DiDkNSnEkYGXXpMoqk/vCnRX1i1/PLhTKU9X7Fr6W/EMWwRZF+EkeRlGgLFuWRpQ9EezMzlWHhnKDC5kcEiZaaPJ7R/DiEdvMao0F9SGSJYv2KgLVhw9u/qs2Oq/uAvmGsJP8ge2HjCGOFOoP+B9bi/nbWtw5unBLVAtImvCoFuQW5eVBOHKkDC3p3dXD132joJV91Vpkfl6L5zxhp+owoS7XyqNNIcnVbIExM/0hZ6oGCvPKMGX54jRMI6HOdfgiNtKhU5a55PwRWlsW5iM36+kyJaaA/7k3OhoLsgqsKeHRANspR8qoe7+Q7ZYcRsLzVTY9XQJ1VoQwOsSNpMm3J50KQmBi6hcMgW62oP30egVFmfaFmg2KYBhpbW9KPN8GkPDFbcO90lTdKwLSUtwwxrF63PvGzOogZ9b4HWMb+3AfNDtl0rPpnNN7IPdZ84PehXFYlbCMnwc6jkftAt2BsdBjnGGaLezHe3fb+NmG4MJHFTjPKCijGoWtoCr/7/J4fVJ/dNEHt6SBPIOMy6vkLuhexBrO/F6yeZYFTJ5w55lPhxcfPUeKJ1MEwnT/XP5kgM6KSwH77ssu9t4giN+IJfdwdcQgy/XQg/vE4wOkRLwhSvRl4CxG3HBlguzI1neUCtwTpTDyrzA+tke6xQwz1BGmwTnclUvp+bgy8kuolcdnbZ/XO6ct2X9YMG86ylehFd5QWBlifn1MLHAo9UY8oK/Hf9IohmFEuYteax79BN+e2P4xzNqvqIRMEuNY16aIFtvmFlQ5g+zRdHzm+sjEXedEekKG6JBu34Fnja8PlBvj9VzirDY3JBxSVBBdZFDTWY8edj2vgXVZ+Lbf17AuWwYIsnEuKVhgIV3fLCbGOp9t/hXflF2s2ircKd+pcml1p87mwB/PRa99PxpYkv4JdTnx+k/kRx3jwxq6gGfVr6S5D2xXMI96yMgVm8Pp9GfXi8sFG0mKbSlcLy8dZbfcdQC736K2s0ALl9TTuee5lreLKEEObQ2kQ2k0tVdYtWTKV4sNxyz4UWeMSd/ath0Bv39yaWExXftl6YGK6lzZAKWl28VT1qrylinmHXC09i2UnkFCYnRyd6WP4s2ehzwyqWd8VwJ57IjBiSD8i3VNQ6GMdUjzSgxz5BhkV5klYDUh98aoumobTl3QqawH4mANKlVmdw3+UFlQErBjmG1gVL1w9Q4xtz5faOSXO/Ibbft59bbqO3XH1E86JROVW0pffdao8PzVo/XFkQ8RX/wU5l4QtPLKIgkpIQDroI8P0Ls1Vl7XSz/b9MBjED0hHQxRueoqX42z4YSRM5gYPcFLuR1p99IxZdrlPS8d8YeUAgql3D7NfBRHpIkL85lEwiRR6sPjzihOXqfvN12SWrZd5zQNhT5rHDl7j0VWp8gpQ/2xa5pMH9Zh3ZwnUXetaYjH6LomzrfpCzIWZv+XOAtfnkLO+fl/Yiyyu8/skf5cRQtxLMz2x1sk978K40YPfBSJZnJyRxNkYLvZ3se0/Tu6LYnJyI/rYgrBBGZzO7UlijDgtTnGHTBuBtjh+oNoH0aIaMnBit90BIIGE9a8+85lXApgD24JbTkXIYePJEEMH24D7x9I9ZbUbxq8G2fxRy5n/Xtp2hxBRnxGOsM7wUEEHYxsGLLrUOJfEmAYr3W5VtSgIlw8CCgjbDSJgB8zeaATi0CBGqTiOMRFucuXTko6pdGf30mJUKjgwbUK5xN5JlTwPHrW1CL4vKePLXXmOF0cw/UsX1RGxRZO8Cx0o7ggt9ApeooInJIsPcjzHfZnjtoZhhongdiqGZE9d5TgtuYnKDAX2Qqtrd76fWHTKZF7vYYyVeOZdt6e3PYEaPfHX3XaDJvG9TS81JnDnntqeKJ2VCvfVdpB9X49sjo47YjqwdfeLL3LkYQ5xfOVsPIkm5Q9KIT13kBsQmjWy4NqzP9oyJ1sJpIe1/PsGnNIu0I80kW4PpKaNRUsS4kskL14mpjOB1mwSPzL2Kmt2v0NeK2GykmAQUl6G7KXsPjVa6o7XvSYf6x6SzNlT3O2p1Fdcbxdje1saW2nkj59z5b/aMC4XFCWlGTrEGNVqCUKoq+hgkmwZJzTw+3L2zP9pZeuG4a7bqsOs+NDc11yrClNt/OT5xl4tLYVvaHRS7MqszVixBS9VCwc27rtHXcc6UypQonwgGU16VRi9gK8Q3x/0d0a/BG6NR/7LWmDnisNgXkZMo0F1I+uWwNqqJL76RNgrcmSVc8XbdQWilMPxpuCvZTe5PT1zkQDjm9dhBj3XLy0J/2ykB1dEwz4lCoRNDyFnaBu4DAoaplP9zNKkv2vjEJRegkee6k1Rt7EgV1r/6iG599h5cMDsJURFDEA/ldp1OjEXyPheS/prxxbYc0Ap3h2rNnHze4cArCkMh4LStcAC2e2pkCxE+uhH+dkCMQYHC17yBNBrbYAQD5WReWFvyXHtryLfzx6c/5qGrNEhfsQbcGj0GHz3MNXd4UDyXmucT/tgkL5mv0dmVtvxtKr85Gx4uQ5wSIsNrpnOF4V5UIjb/71GiFBOjpHKUw/AtuQr167WRvTnZC9Ry7TIXnPcWEUpagLNJiwATDJgsuHU+hfIGsbUtHiZYu3Yj289NuwzquiOFixOoO9anfbqUAiopUr+z4gLkwBrTU/01eL/Tph0NXvxnLLdC2aa2hi+gkpTVQS609WpBkMWLRDvkxxKS692W3w5t8Lt2/ME8POHP4osg3MyegoeJ50V8qfKJCR1xG6shfzwnYWXYgxH9BOBUc8Oz/IXCgcCKNvYdr5xPrOw2wVBrP3WDgELEQ7bSvtpPPqM+qK51OdikCG/QjQpYpeKbOGFohjmlK0riZry2gxxBAabB5j91GP84/Jw1SfaDXD+oxwkakYRD78iDXYxeu+lmOCIisnAKAyYD6pdT5TtTdCcHNAtbcEITZc2bNRdH+5WLKoA7cA7TZMEOOhmKoG5D9+4s97BNiCkmGNObZ0XLni1mAcQAf9VDGsR/uBbVTycluLtH4WI42LzRjlTUVSaS2H8k3p8IDd3GoIMEdxGum8LwKEJHlYID5Ta6ueF9j/2vX2LZ2rBMHVISxkSZ9BawYURZ/CJ5C18zt1MqhhRd+xmXksAtPGDM/DErO4OcfLwIlSBaVJTKv1mXW8kwOhuw69UBIpvXDsjw4Aog80TyLKKtzTPquAlF2qRZLdKtKKWMgdAieoEGSFRt9E56Eld6mLoePewpVeFt5spF7lQ60huSABYFwOAvgdzFlMiNO3G7XuSr65jp9Lxdfn6/agtp153UsSRyFz1ZU9GxxfvCzUqHa96NhqA9HnFQ2mmqc9UKQw4ir88yHJs8JFZ9lQQHVy194EA6cBQzUIonRIXB3pCwRWyVQi9mff3Ewq4gIwVJtErRs1MNsEI/04ZOESfxTKhrfPEhK/Mo+4rKfL7eM2x36ow/5feh6+EwgXbkls1wFA9ycOOEbzPMblVRNRQBvLuDEIIFRjDJ6cvyVHLrXJUMmWer1u6Geo0BTa24dyi5WvRw5P/W375Zq9r0G8P0K1DVLJhqQmlDZCFGIqIyZ7GBlscBVglR9qrktItWYq/1zzHNM/SuOuJ8X4sfG0osuoK+PeCdT2Z5x5ZeHfF965URSPX7gIm1YOBGuctpTvqZdG4LXoNXa1j+P5AhV/Mu45x+WwmamuTZKg1E4NI47rfvWnjCI4FQzm5edCyuaKxYxmet/AfJlGk4MyiV7/xqw7TKPcPEN4oqjtXLOPp6Unc6EjejBxCE0x17fwObf7U5smMJtQ+yyoWsSw/od03wRW+kKMAZVr/pMdr5CJoHCSP3npRyttwcvBkRYcQyX9CHF3w17lBcqfyaqtGnAhrx8AarR+yDLr/yEkGcrIBBbzPGx5s1chd2UCTP0ZBeVh+aqOc5OBB48aeEbdgvqB/uvU1q8bPKsLTytUDP757FKiPXeEzIwYzzawn/2lEU8p45TB4ek9HS1NlwbyHV+ABREBQsbayrBbg3EdmPaHUfCgzFeKaE9mASMTCTHR8g1EOMbhIlAm5QFzocwjGBlvbxetFZGLgfBsOm+Y+yvRUee96UOElwzfnPKalTc7iRKsyqQKoQ6JHzQG6UV6U0P5G/6cv9P8vPvK5nYJZbfIQcMk3IymfRhJfVPKuYIN06lOc0Z9751FWhadNOK4PYpzW3BPG3Mb1Psa0P1fGihFcyXeZs0k2EnrO1CyuZ6dBd91VuQzOsmfUXie3BNh4gS6Po7L/KC3K5E93MZ4c638TdWPwQW1xid8HVmeNDU9mezLO0vtSJ4hloyDVTORaEBU36OYd8jt31YCi9ZdImmuLn4ar7Fwx76pr4Q0fMreUbNeyKooZaceEsA1eKX+r/BM7Q/wns9Zvx5A3/qu8GdBU+epl3RK/h8yLaCsjLeYm6zv5DpXP9PwMJgsOZ+R31/byTqNeTRddVc6rRqPPxDQDPoYKfX0ypXIaCrHFoyJpitQyMyUqN5UO22slzt1pZ8CLfLloxzfRToO3bPSu1jZSNa33632Fou+HD+/i1bQEHT7M5pqXAETztsPi5rX/xhDQZWklRilERXItLNDeFkXXPhJw+5Dy9QCPuIJnE/UOyQ0Xp2rZopMwVg0HbfjwhvfBA/jH33SW+B0tha7BJN//8I4TsTL1vUlSiYcR/Iuyy3I9cYKx+WtnHJ5iF6sSdDMhCrKJMPRZzfEeRvz45YUy+RUG5LxGGMOnUw6q4IUoMNJyuEP3ZRRkaUgXXpjTKP6LnAqcoLHWIrIuQXQp9ag9r1jX90MyHwfikUO3z+LM7renc6NBugl9kZ5MiCxklhGtRIXy1dfHuTaWwbS5XA+NCobORD8GCzRCy8ENNLTHOTEBUTXB/69VkvTq1vivXoBKrAmR95jspvvIkuU1GAyndg1ZrWXGinOsQD8R19HZfP+fWRzjlX/4VcaoKaTi3kf2T2AY/Fy7eAbfpqaAOfdnGUmBhehwEM/CCNXQhtLbgIRzBHOO16TSgIgrbzyqzP1lbgG/lLM+n9BCnV9RhihsYJL2Q+GgghPMsxLLpDqVpeeuywBs2x9rgAlbyfzo2kyK7Dr4AoqRpRUwLcKac7+lawuSUq1j0drd+OfoqPnK33zHb2N6llzNniG2MhoMmVNdYDbFbihdAr+uQMsZLLwBeKc+2luS2cVH1Ju9NvQFPK03au7NG0e1ZQ3iB9zYdVDW0Rjjz0YNI75xV3H8TV6li8xYmM8iuMr8VgkkH5F99VtPjWb+q77C1970U9/cjzoMgAD0WsmKeooEiziwBZ46Wm+HNGzBnTkpdOx2jIzq4opaux2rSWz4imHGvLdelheqD8635fSXoORCX0zD5AWWx6oHoSIqk03LhhMypv+uPeODzo8VSEmAJB5fAlG1/p2KYT02UbMTxjdlP62Smg2ausZnZWhETKlH6dcuHdk45eX5pz7VSprL1AEJuLvIlwaEE6No1IlGqnS6YdjM2X62B+Uye/cPbBzsLN773rjScTDfKlKpxSC+ABX1xTPlm2cel8KHdVo2izEaUfXdE/9m45rYflk4Ux8Us/OJCSalDwCBLf4wcw0oh80nzNx+MIzqWJGOoBYW6Ip6D7D1EAJorepgaH/gJVA8e1v1B7x7wvkgvgmYPdJNm6i2IeKdRwMM0/kS+yickwL/Xdn7VJZ7kbKGKFvW3EzU2/tyenQdr4yqW26QIOJ0s47MB3p6AKQWZQi5snu5g8FUdeRG/UlkJ/Rlrcks3yzmJ12UDSsCl1E3nLYmcxjyoxG8IncvZkVxVsYKsdYkG/7SwC8A/npODCmEWkkAOJf98hf5CmHgAkv/tXakOHEh8rXaG0EphEHCy5KG71bwUU+hMqWT8N6Lp0eoHOtFfZDTMOTVkzEEkUiux/Chj0RyydgO9KlQ0a6CucPCscYE8NEdIaX/nzdxcqTXaVMM3SarwnlX5OwZtUCzmAvO8dPwfKFreI0glAEsq23cV4L4BXk6I/zRqHajDtmARCKdqml/bFw30eSyE6JowSLrne2kcwZEJ/Wec5/ZuUnjMXyQjyhwW2XrJwFdsmIeC8/9BsRP/Hgj+YO5F+r5qZKrX1qCNXMuVZVmLqQAfwMdHaeSS3OCBX3wTRG+r2ntK6kftTPjPR2Iu2+p0ZwUIwxBU+7YQQVzylpffaeFIl22iEigEHMsP/0k6AVPzArgPoVibg9uSAi2eQnX9xCv8FidbOuHEwl0n/jyJxz37hsIvCHXhGIy27U+K1jC8H+ExPJpPv3UIigSr3MSPOHHkxWYiS5LVCEIhgkwGLhpDhHh4hzy0VeEivyZIzTyeAdApetMNTYHtxxoLGgRS/i29ltsr1u1z+IbFoomPiSBlxY2P3tKsKdb0U9Qf2/qBHscUwqkR4deTDfCojsOw0U97Q2xbobVyKsPxxyMYZmC6Lap18RB4Cym6AwczcflPSeTgx38xbUwVHf0QAvzdW6zZ77Scu9dKsgUIXU8YiIEhJdgFf5qZzq+IRV2WTQo+4DWAk+n/YPxDGBv1Xl+M2AWbxU0EI9JucDCPR1GOtuIQFSdvpeQcf94rYSLiPxNfj6wGJmAit7JnH865AWXZbVrcTiOydm0AhdSe9KfcZ+fKUl/9b9FJazimAIThhKngDWXsSUICk7+rJcxo8xX4+rLlnL80udkAsO9GIlzjphQ5+Caw6/8VMBQO8QRY5JSpihp+uh2Fv2mcdupSfVh5D4V2X2LwMHiL6rp0yAQLd+j0X1SfzkCDIbRSFC5GwzRzMpyUdK1WedQVIzqbUSmFc3aV/EpA8hJv+NMnHH2k8Xrspa9GdCLlYujYdTBzuaJIW91WuuwFz6hTp4ZsUiKJ4yGLIpu/BwkGgb3ayzcX4I3LCZmH5RGI1n/xozF3SE3fP1cpV/VFbpy+UGBbw4Q08OY2srjOQom4kJk2XbKPDbPdL3UeOJG2FoSrCB1GQzcGvDZrCIAW4RJXpaYYVvZw/HIzYU5B8XsAbZl+UKcQdVSunmRVVjzRCa19Xy6Mii40YNZMQOT5TBBMRMjjouM6Bu19U8cK5K05dbZI/KxsV8Wn4ZEgO819LQsiGMA0qlUxMYp0EdcDXpMnNJXdFK8Qx/+OHQPdt2Jkj2PIsfYOjIFQit3BrRCuG3puuJ7FFtfVc/Lon5r5AurfFjVlkjgDkAkPbNgPAWAqxtXP9epjpq+33xsptnOVCo8JkFH9IdL54g169fYepR6ElCOsF0GK4UpzYCF9Hyv1NtmyFc4Vig16JhlrwWlFLC+q/B6L0UZeQs4CmoA+xnEOBhSXOXXAVFimMzs6hI+5wPyWQ4A4wujxB1mP0Yy9ZGVyFPDedHLqQ2fvI591CpDtprruypsMgieIfWaNRIsQDk9SrxEJMewcogR0AwDDns8Ua0e9INIczhMxiZ9DmBo4+E4TGJQOsTopMm/wtennNL6XLeF+RPvfyNPzKQSrhJ517HWYdO2r3t1PGvsdm/r608IB/NmYGYtuiFsSVaCBfAQp6lTFaYTrC6io6VhpjqtKUZzi/9mZlJ+SZz+hTlEgWG0qNYix3CjkJPyLDWtI8Bt6P/CT67/GsEBf2gosBpDQTUf/fPenIwuDTUTjO5/po6QSSn+1VPGgCHtG59gaQwTynf4CWW4TNQpPBa1wig/ve9Ag9OgoFJWTiEcQ8XoyDdSPTbJ2/HxnnDWTA4b9x1u9+4/xcT6TzWkoc2zY12MDPsEAUOj8Y3pkongg+pwSPqV5ISPRSG3/CnBucRpm3/m5sgEyKUiddiyBwEDAWbJlf4eNatcg46qIGpCiPhLTpFiNvZCBpCwbGpamZKBa8+3ZwMJtJ+oh60mtSZ3QGr8OfoDTsQfYsCilacvDvOsahped5nnyaKr3k2/gNZ6LfgyAFKAGsiHNT768WMeLr3fDdYnn36/E8YnPKxJclN4NdI3GCxxBB+kghNJc3iJqTao3aMw9QHpBbPwUct43P8gJD22vn2dO/If6HnvMJwIV2STAvB7mX/0aJjxtrFlQTKMLnP3RJsCeWaJnbByEk3y3Nybl641asWOdEqtY2YNnm+qQt6mnv9BjtgUe5y9kYhKA+XMBElRiM9dsw68MkLlysDIs2qcYW3eT3RnChQoa7YxPa1N55vNW60gQdIvHe8vjLKginJiwurA6hRjTi1syEwhD+ZG9DeVg6EaldCR2VKa3FWOS5cK5IQUvVZ8gWbtZ2zo+fFKGnsJZWxNJCSr8CTPpaNgrZk9Q9yP5fwvOgEGlRYMe7YYS/ZmudKelHWMIDGHxBvAp+EiJr3C0zVGQDs7tmsmELbct6Jf36P7rJasFOkAAk87/ff3wY0V/l+iCzi01XNdG98DH/eR/J+Pv80xw2uA4Fp3IZAeP7ud2lILOvTXSCUmjipxgM3Std5zX09fwSZtWiuxYaZXCbHT9bFoXcDGVZNe1E7jR2X086ymBpd8ym6nfMdX/xzPkKDmjx47CR5ux3QU7oBNqa+mCdXJpM0DERa+ORLzowaQlNNCGMkKBL1FXGWTVlCKIqg8siaExS+pgHvROBzDHV5CGFgGXuB8aX1AWnvGlLERehxV4B4lLedJqqJVgcwl9y1CVOXGQ+p77D8eh8JBTiQkMsS4HcnkeodCFVrs2VKzgvjxN7AB1f/AlgXmfYkpSP2WF4P05yFcCruIYYuyf4PfBTXqyfychNprd6ecEqqhvTx7wxNpZPP8UYR9avXL5tgRuOYMFOQJXJJ50NNLeK86gnqc/8iKKAgHmYQashbEZyAN8CvPJUDL9a/AA8u+h/FcLdQIwjrfZm5EcAXDrDzIXqTt7Ay4dPNtdoDILXp/gKOeXViZ7ch5omFSUI8rnMOKzOHx50F9NTnufiS7y/kgMJ1EjSp0VJtimwxa9bizK71TXPnpy5ZpWYYnM95ItNaNVKs0pN4NJQWkh9p2l1L6fWyfCaaTepyVSNobztSwpVIgKxLPBWO3We0hitos9zGh7+4gkSO31CPf3HRdPuXpDg1HP6F5BIfmQvytK96kae613IuYv/GZzb2LzzgutIk5ashcfJTe4iSsphzHF02iBosLBbLU5omb/O6uIWcT8fcLWIK2hK5Q2DexudzUImqPExqTeMCFUxYotYEz1EFnzU+r3eE3fQQj85fllMH/l26Mu8VmkHvSGWROuD9Kbhw9CcHJ+IW+I9iPdutZ9bb8GO2jQyvxAqxVXKsVYw96Kxa22FlYagu4+Kesf5cQ3wFlwXl0yeYmsou0VDTQN077G4QBnX7XdEFyPEuOT7mjY0+X4uIliWGirRmyXw+s0Mf4wMySqARJMHoCAPmy+J+Z28680y+LC+tordk7b20Ogx2HA3royEIlIkIfa9opQiQo7rF3w6z4RHct16fkGPi3stWyeu+GG4ng9PkvadsYPdQq8K1JtHneqJRKkoSoRZWIsAhj5lhrth3faDBRqiaWlryIj/wqDbbJFb1AHDOOrr3qbDtTHyQ/Ro7X7sXPZDXsa+6nIbWRgTTfftXcIbKQptHo5lviuCLAan+H1hewa7R4sVxFOwg8k+dm+dcWkEkxRxIFvG6Z7g2nPl+7vbvvhwfTosmzWF/Be/fgvaLhzkzupNd2F12S9zT6gQ7eGdJT95eas3AVkp2raXGEuvpbYsKuKX86townub6w42xBEYcdJqqBe/lGA8x2rF2BjjAvzgdyMV1oAlMwwcRQpGpJdI357/tlHdE/NIjO6QtlMadbcFl8mjU3M8jqgHt8GmwPDxmmoVOF8BxVlzdW+AT8rTJyPeOKdqfV7f6FDseewhrBlH5R0JLFibSvgv0HtfOtvwxwYY7Ot692Jfr6p6MXZJ5/HZtFsMyouGPyhghtPDwrK84tkaZGfS4rZmB/XTOTFf6k6vm9ujg4ZYidQ7hma7yFPKOBVHmNm7l2t0tqVJol/MhdtxiMMp64YxkVKWO37ZPEUWp+U2wM4kysX3aIjsTZTWg9mDU2qp/burKSPUbEerjqwCz+qLBOCCzdXXfLVAQnPZaX29HdDf2ZvBIG5RXNoBK2LoyfmgLbv/pzIda+CxZrgEkNxSSTL3ietikCFaZo4MhT9T1OER0907Itpo6ml6LTzvqUP400io5pms43CyWdeWyCJwncqT1PSoEYx4LwETRYNTpBE/GGYet6k7RERQdHAS5LbOzhfK8T6mit015ZcnVQOrcS5M9HNXW6SEiRkSbARG2C2dCL5pOCbxwHb4OV9wd61P3k2hIGeXLuYRuWwzeVgQEmIcHQY2Q+7snjpoAW9tKGl3aNBfMtP1kjJJvCm5CKSKwbC4WeKACV+TV/DpszkRtMvpzCfAxZAEha1mKJObgq+p9tz0akInUAQedKOofuuSWAprRL/yFYjRM82qwOFGruvz7JmP4mGX0G7Zldial2IKFmHrzy91qY4/gZ+flfKaO+7k3Wh4hDMyC78FQCFcma93wgFIHIcpQcEU0NOuxOpeRLejN9KCacYA3d6bHE1hjhLNr7DFIaFgPxV12CJkZ0ariZ/OdFaf5Tymz453YwYyC+MKMP4hhn5c7z1oHSvuOHg3+c2+mc9btGVKIBq1Kxie50TygltRPzV4M6NUcoE1dVGZxQ5jxRN99RBJoFtTmDaOD+igA1ZvskfIQ7zRWQoStI/XfvAS8Tn/6rEcL/Xb+eSl3XgJdQ3YsVFw77tY25CM/jUc14QRUhHAQ8bdUbDhp00tUQ2Coo/ykeFkn9lQJ35qQ07Ks+a1fTN09waexWxXJoyBqIaXtyK8SKUfbn4YdszE4xhF5CjphG76vS2HLGVgudvvWdvz9iAcfCnsN2wrL3pWF3o5zBw0CjKjuGfOswF4xHP52/wVjiu0K96UsndnLBpc4rTvjn0OOOhhZ0IebpFUcC0HxOl8PDy60hszSIRbZz63kS4jXfkj6/erQ/7EQMYfzDzOoWYTmxmr09BgMvvox8SEvnhXFkXtbALHdPXvq/0Must9ZqOPTr98iBt04ywPic8b4nQsSUwcjSu7E05ObxBYFg82LL6cyU+JnrWC4J2KNaDe/CfBVrOnQIoVL8g9Xh/W3xKSwg0x17gWHUI22UiEui3Xa+JJVKSqY/2tNj88xph0ZpMWo/Z1iR/jz3aS9r+AV2l7pkGmCWlpNEcyNjW6Yg3RIR8+9QZu0RIAbVjvtO3jH7rXIP33HeLyamt044rZWsuwfGJjCfIR6VdrO4DmLV/iVsGf/bwp6OavsaeHSCMYlPBlFYuZTidIdPTfVqVGOX96k64Mr3nxQiS9RzSwcnzIAS9Zwt5H7uuEyf9S4u70+eRfpcaYrPakboO2nl3E1phczr4a+67ELKGwtJC6n7SeVkvWuob8CPz0ni8TCJ1OCIt1b80GdYs9pyTT2vbek4XDec9ZwNn0iZYW2R0YFPHvScBrHVoRbKaGfYZUyjXaUbfyu3HZOM1fmgbqRRf82EgxqdysOddgA60STPd1tF3wnQ/G98xfq9vgS0KBbLJMuaEQjwkOOB2m5pD7G/DJOEgPmcalWgnZAXdBjAUDdARViXRcBAAHaBwBDAWO5clDDSSyhU2Qypee7qBtjFtXATLlmQGR/6Siwp5+/1uzl7H6cz0pDEMNnnb7eBcbwf4djoqacSKzR/LG+OTMrdBOZWU2o/p/MUaOziYz6aOTSvbqeteyTsAAIMqQJ49V4xeDf34/dg3sTsCa9KuiWH1K5HeltgiUS6T6fof8CKtWpBSIWb7cbvBgUIIsRwberZtd9TS+v3/ns61A4n1+hEUEjoH0Ool63UvHsaerMoGnhQJOwE0MHDsp+PEJvbKuRheKernODMg6jm37GHUg9cgJ+37bFY4EHeVbhoD9UlltdIwzclpzw4ZkS7CdSato7S/juEWWplWcwWcua8e0wosh8C7Gh8EUx119lmje/kreariLhTJtdtabp5VrFpWjSseN7cP61kypt8c9Pd+u9P9whjyvj0hmNyQ87ch4XtvE/P8cF63MFrxu/teeWyC15syMap1py673CJPFDJ3RwF1xtU7QQMd/1WbizwT6y3a9BxBIL6y4hlgGpu0d5nelfI1OC1QIq2y1SJQmrZBDj0CMpLamx1qQVFOmWAZCWuA9O0dHPNt7dUR7cZ74yyXACJsd+EXuFMGFRIUvRhl8AulmLA1/62I8aDjtUgs0BaXRcl7lo77ZDzfL3XIZDscxiDtyGTaT7X3JBxGl0WCvKmn5kbcb5A2i53gjoskjocueojzihSL+wVirgpCrEdIapRtHbmWqteX0GYcEHUWGlSjD3yborXicRQT9BgbomsAQCSCSeOr5inE1Pw3JbV2xUdz/0tTVMpC04wdEsow+Ddem9/VjZgh393lMn831mVPh2e2XX74YzShsLQ/9owy9RzShIKvsWfJRElREFq/UVQgFk8haWXakmlJ0xY6GkfGo8Jp179msUm8i6RGinM0KaOwXDVWePoBWinDsYDKloBgOAjXa+UjUewF0DXKdHJ+tS4Ke9XJ9gUAYkAyCg8MQUo0OSo6/lWqY628nf5To8Ye6DtTBNcXZwX5GRBi+Dt70rL7iwmF6ZjpynRghrMNj0IYMRn4yeG4TopjLBbDLplW1cVa+E/rygvUHSiTP2QikUOr5+tB7iGUvwavACb3kF/23iQLDuGlHXfyMvoL8qzexjBTtLE9rt0vzyoRNeoOP4UHsYsbTyFWG/FWwj58IDAuQA0LWIjgPg8ohCX0NWDw5kmHi5CLbc0dLdl4uOfn9FRmU6g855ABvL7mass+OkkmrmQc6FRht442NW855dLN6C5WdrSYn8q4WUZInLoT/d3IZQTt5pp+fQGGz0MxnCXJhEkqLWFfKruvehiGSR2/XnIAy0wUj8OMnzqHJlb9eDqJBMBl9ThCk+c3/lV4c6MTVrlIUL+67rl24ff82jDJIPN90L2VYtSSqplgVru9yFw2SWQg9C/VHyb+v5wMK81IfzPdHnMCp9KRIBWBKV8Q7axs2QaoDZGkQcWZXZFqvDMLnIvSg8KzogG9diIOsF0YrqQMB5/OQaKJd2qI/uKzwLX0lc73sv6fFLJk9izS4QF241nI53ZULLQZETsYh2nZnyiAiuuAYjQ3sXACVCMFcSfXLWoHbJxX+cweDXMTLVnCfGZLjzU5wqc6i4L2kYiOMcoyJ+cMqmGznJQSMejRAiPyXNn89E+vjsSwHE71bCiq22x9Vyh+7Hl0ScjH0bER9k9vEiGVCMktqDoWJlNsShDLQEdCl+KUf3Nv69GVW65S362fG938tIA2MpthueHptvJnR3enmtXZ+i6wUtb9TpOMf2Ggjaxuq1iOP19k2U0H/DY7pdOR48FrNElNDmiawFTfGyoKu11el3hGvpMkc2OYbQC76xmS6kI5YbbJwZve/e9SyCsA9uB2T8lZyU6NU/Tx+oraNGW2Y6BnjhTLNs9r/+tsUwgPLzbqK6PhH/iU0Nbz68CHoRnhL+h1PClPV+R7Jk/LDBI/B4bl4/xE5FvssUYcVyG9MNFmy/opha7i8XG5Qsn7y7I02HN6NfmCM0Sq1FWJZCkEDorbw8rKyRF1RkWCPyYXU/70CdlOeHAGPR5vrbz7S2Mf+M7rTF48r+xXqXrXsWYC/qJbgEWww5l4pxk4PEvoJ/EzCAAVf3LIciuyBakLBChXCgjMuhbjQEMuQ8CpWmUGPDkEUdEzl168hyauAlCaYGphu3XbpUTa4yOcGHLF2NzgRAArcCvsfdkebgcDX3h7eV4R9hFGBoAF/0xMkZ3TCtuCZ0OsevzO1Jdsz8XSrXqO+HKhzxm8zC3Jp/yGmIoEpUbGRl+lHizXXiWTwcqoCPyFMuP5H8X6oG+MbuMFGaFC2eRpCDlmrx9IFtQGfCevFumaI3vVWDdXyr0TQUGICQmimIiZ1j/NjZEjqgXHXfVDO2NPd+XfPHTwrOnDZfnOwj0dRnD3S2Auky7vXtXXFGo+Rd09rrdvZ8Pq8P7hzRIeyVnAukq0lyZXWau91nuDnPPaTOdZX7Fs/ZaGtek0KC7CNnvaGRGr/M+2m73dh149gVrw6S4bLAJZ1T6vHmkSrEOSnv2LFEYHq0wRCIEvlrL0XhFcFu8amnH0zq8gVxEtaAMljGP55fdZIGKQQZdHmspn0iECR82egOP2wdqvoQrpx/0hZkfM61ByShathMbwqO0Z2WMqXLxkDxj2BbRwPmbSmtSvkoUT1RsNKsQr/or4j1uMx/D8L5LBjg9/dCAIUNJXQhXLQULyEPzJHkFiN7vGcZ4XKLtWaFwGj+g7TXycN35BbEssnTyF+S7+zsTdmZMpbZJ6bGJP0vyPNnYsJer4Fp+1LvJ56Dewyj9g2slUjy40PrJLQNgzMGsbPtkcMwTvNv4R8vs0vHcJl7XzcwV29aXYgRcCqMlhEdEwYlR+b53takmliij7xgHG8zuH0BWB44aUcpTWCjLdjfCt6N+evSRgazQGLQ6mRkdCVdShs/60Isd8hLFQ65NYNrHsZJ8eZBXbUShP1INLDGf0tzr2vCrtKprH6siXq9nOItLAh6HEARug5MlLsGTkz592LFAGz99bkorl1ppJY9aTOa/dH+63boP/71FUUVxZwdfZB4z1nKfYJqg8TNH8ZAHq4+uMINOsLYa+6mFlsntFLjgnTVtPLw3mPYE817fLzw2Sos/4vBM58AbTwc8t2po/4s1uCvbdh4DTBHxKZKHzbgm+uUAaEA217KifVMntdgvwJ2mdPSnzCuGBoC7LcH/cs8MJj2hzewzSd9yccTgKTHjoFXHhzJkQmo3Cls6q8HsiWf+NkMjopyopME7+CGVhwqheLU5BHKYjVcThZgfzkHCMDRn7fb4+fNgNTOf44gUFnA3j26+FuG9Q17RT9G5BsYSH1VvGGs/6Lx16v/uF8mYaKpX/14Fg7YHq04JBRXPiJjDcq7tkKZXwgqdqJnltaeJ7sKixdx2WAuI6gYVpKwtYCN+9layaAh7Djoi2Aj+vscFqQ2dlJbd7GnaN3A0sGrn3XmA0QaNGUtG7AJMYGNmP41brXtq8D1QMuuF0mSIWo3G8k+lG4xCoDPgLgrwjf4tVrjQgXFc8N1Z3VhB//XK3jYcAbnCk+PJBUWUBU3vax2uUFzK+TCDVE4AksON2HmgL2iwUVMc8QxTZh7uWFCBvbLslRLouR3Rqi8th1+wI/usFQKotDJ63Vfhk3ZJwAaubApySvk7xWGXQH7m0zdGAmRy5aGYHHEZHf7ksKLO1woP32jsyBabMlBdlznBjt6/2Ki+DSBAOQriNf3K7LdpmmdIWyqYBlt2foAt20DTK30SiCni2u1zS9DMfNR48YHKadbKPsmy5oadDZSbRGX5UBw5YjYAMoZnESirM7Bw0jkP127J1u7dtgwpl8cKRLLO5HX/w51bBgdrxK0T3u87cRQymeswImqm2hjn//aQhzuTugjIPn1DBg8wFQ0n2GWC0IS9xdI/IzdEANVpFuxWh9/13cVLtTq0+ocvasE6YaeYrdAhQl6LhQqv+PAQ3+H4GycTio5EACWvtXb0lPHlnHzr60GuG6rERi0+tw/7d82mTFgyJ811Pw5bN2Ebv0/siuo4OVpbnOmEzHeTicezuD0FtE0t4gZIp7C12me7LPjuEeGV7v/XAZYr0OV1Aw74sLH1BQD+nt+ONgjupgzVl/HDMYiwacQvyhf9ocICEDPitjSWhUib26GQmccaUmHKJ1XtaWatoEga0JBcistbozpRLkKEqypL98HfpWDA7PPa2Q4R2DvhEjWGfC9HpJI8WpHMbpyn0iyfrpMUDGPeFi3Kn2itrMkF/L8hDyTlGw4LHJA+SqEH53ZWJUPjF8vsbXnYmhzVmH8Vy5MAdyb6K1GJ0rMuTTByvopOkW/mKXoXN/5AJAGVmiLgl99jHjGxPK8j0h+RHP/A/RyT/z0xynF86uAMaxho+nI6ATtJ/4JGTay6+OHO4P5McAc+La4ZpkUYAK22CxTNP7uA1q+ND1F7YjgCMW2sN6bGVODxKOnwNdLXvoczL5Xzh0D3eTErRSaODQrhOjwlxTJN5lUNhxsKCb9JLEUX+MY+Wxs0Q/aoSpd9NoVEkghD+VSxjy4JhTe8Xoc8fXIYpTw3CRu/JN0xDZuxSZv+yTiycwufMwC0cw01TUMVFDqqOkeDM8eqdu9u5Cf+iXa6h2B+DiRCoeJ3tYNObtaeK3H9bhXSL/p8OdZOaxS2SsKH0jFawKrS5YxN/9cBmufHOHtn0/D+sXatz0cVAuVxYFpPhanhfoAEuWMnZ4+02ovRRglfWoKyfND8ZNiEb15zrttKlObMygPyB1OmO5BnChatqrDHpLDCzKMS7Us7u9AJqOD1nHHThBB6ql3YFWm5uhb7n+asgJj4as+JZ7++G5BZYiC02uxoNvUUn1gINCofrzG16YpytI3rRE3ZN4fy5xEvkaihxkl9Zzdp8ZON+VX1psiLPS+Vm6UPK668Aku7iYvL2p23ZAYrWwL6S8WKChWcgaQ1Y8/M4BebMcQFVjL/xw/Bu3djumoeNp3gAAAAAgTMHrg/X7Zbryj10PyUkW2kvt8knc8azgcY27szkN7QbVFJ+i446TtmLA2lm+FL5Im03ndVKo7R9kJ7HLNuRLag1gkmxQWs7Kc02u/IT40FnLLNdluwaMINVH1fUiNWDPh4VPeRDu6Z2dIEhSE3rk7XQ1qXEjo0rdbf17mErMY02E449LtsgH7YFN0Efl1DHiQyk6y8TzjhRT/NvKvCkDM2y9b7gkwug4/+0nfCHFvGo8AFUvOE2GrCMlA9sxv/1S/W0gsavh1nCqyBHbESIQtKp1zG/VbqZaLyZxSBNQX4XBsAdSAEJgOIABwsBAAEjAwEBBV0AEAAADIGeCgF88MK7AAA=53dea4da0fdc375ff1378c8bdb2c612e1IP 20Protection class I301Track mounted projectorsTX-MOVE1Yes1Rail mountedCeiling742162.004.3NoRZB149 lm/W50000 h56913050 lm1 x LED Modul 83575{"ConfigId":"0001","GldfConfigInfo":{"Emerg":{"ControlGearId":"","Emerg":"","EquipId":"","LightSourceId":"","PhotoId":""},"EmitObjId":"","Emitter":{"ControlGearId":"","Emerg":"","EquipId":"","LightSourceId":"","PhotoId":""},"GeoId":"","VariantId":""},"LampId":"13-10835-_-_-_-50000-3500-wledmodul835","VariantId":"multilumen_1"}Series: TX-MOVE Multifunctional surface-mounted spotlight for area lighting. Very flat design. Housing: sheet steel, powder-coated. Rotation range: 356°. Swivel range: 90°. Consistent alignment possible with visible tilt scale. High-efficiency LED units with optimum light control thanks to clear plastic (PC) lens optics. Spezielle Mikrostrukturen reduzieren Gelbsaum. Symmetrical light distribution. With multi adaptor for 3-circuit tracks 230&#160;V. Suitable for Track on ceiling. MultiLumen: Luminous flux adjustable in 3 steps. Factory setting is the highest luminous flux. Environmentally friendly and resource-saving due to replaceable components. Colour: silver Length L: 569 mm Width B: 119 mm Height H: 75 mm Lamp: LED Socket: without socket Colour temperature: 3500K Colour rendering index (CRI):80 System power 1: 41 W Rated luminous flux 1: 6100 lm Luminous efficiency: 149 lm/W System power 2: 57 W Rated luminous flux 2: 8300 lm Luminous efficiency 2: 146 lm/W System power 3: 73 W Rated luminous flux 3: 10200 lm Luminous efficiency 3: 140 lm/W Control gear: Regulated power supply Protection class: I Type of protection: IP 2018002023.1.6.010/30/2023 4:11:19 PM35008077 96 99 100 100CFG_a6ae4c68ad8ed2ed5cdbe5c93ff8edcb : multilumen_1_000141 VA132579589   "#$%&'()*+,-./0123456789:;<=>?@ABCDEFGIJKLNOPRSTUVWXYZ[\]^_`abcdefghijklmnoprs202120200220_1100(x64)4F:\data\export\rzb\rfa\tx-move_742162_004_3_4fe9.rfa$00000000-0000-0000-0000-000000000000ENU$213ea7d1-3ce6-40f1-9e2d-6757645cf9a6$213ea7d1-3ce6-40f1-9e2d-6757645cf9a61$00000000-0000-0000-0000-000000000000Autodesk RevitRevitApplication Worksharing: Not enabled Username: Central Model Path: Format: 2021 Build: 20200220_1100(x64) Last Save Path: F:\data\export\rzb\rfa\tx-move_742162_004_3_4fe9.rfa Open Workset Default: 3 Project Spark File: 0 Central Model Identity: 00000000-0000-0000-0000-000000000000 Locale when saved: ENU All Local Changes Saved To Central: 0 Central model's version number corresponding to the last reload latest: 1 Central model's episode GUID corresponding to the last reload latest: 213ea7d1-3ce6-40f1-9e2d-6757645cf9a6 Unique Document GUID: 213ea7d1-3ce6-40f1-9e2d-6757645cf9a6 Unique Document Increments: 1 Model Identity: 00000000-0000-0000-0000-000000000000 IsSingleUserCloudModel: False Author: Autodesk Revit ClientAppName: RevitApplication <?xml version="1.0"?> <TransmissionData isTransmitted="false" userData="" version="5"><ExternalFileReference><ElementId>1849</ElementId><ExternalFileReferenceType>Keynote Table</ExternalFileReferenceType><LastSavedPath></LastSavedPath><LastSavedAbsolutePath></LastSavedAbsolutePath><LastSavedPathType>Absolute</LastSavedPathType><LastSavedLoadState>Not Found</LastSavedLoadState><DesiredPath></DesiredPath><DesiredPathType>Absolute</DesiredPathType><DesiredLoadState>Loaded</DesiredLoadState></ExternalFileReference><ExternalFileReference><ElementId>2537</ElementId><ExternalFileReferenceType>Assembly Code Table</ExternalFileReferenceType><LastSavedPath>UniformatClassifications.txt</LastSavedPath><LastSavedAbsolutePath>C:\ProgramData\Autodesk\ApplicationPlugins\ReluxCADforRevit.bundle\Contents\Windows\APP_2021\RlxRevitAddin\TemplateFamilies\UniformatClassifications.txt</LastSavedAbsolutePath><LastSavedPathType>Relative to Library Locations</LastSavedPathType><LastSavedLoadState>Not Found</LastSavedLoadState><DesiredPath>UniformatClassifications.txt</DesiredPath><DesiredPathType>Relative to Library Locations</DesiredPathType><DesiredLoadState>Loaded</DesiredLoadState></ExternalFileReference></TransmissionData> b"C  !b" `ad``bD2Lg|< ?؀؝H@fk.5r} mkRB@l` D3!P`` d ` DbKBP- pD^aZ0b 5t O|{Uo=R>#0`y^wF ZKͦ"8iCZ1g ` C"C.C&CC%Z;C*Cœ|_| ?ϝ! SL, $)P۔5IJF~?D[z, # PTT8 y=B9P%=brG%ZP (!oD T JqQ2@ V9rF\Qy_' eٺZpQ|rȾ-̏?h֨EeQt@iǵ}8/N]zeRn 榾1,Nj8ntFWV|Z'-zٞ`w1NdV4JCGN|z]J߼o] Ã*iG$=x1{QGMf:pWQd0P .v4ITS)TG)[ 3p9Rr'u}qÐ!-돑 T" *^'o:wm4)sqka"VJ-$.Ac8&[Tf2xSڈteI75oWY }U%G^/j+~SG%Ehp݄(Vh_1pb޻C+}9+D&lA]#DM䓝b~wny=xw ;n>: geLz 6@URտPiN/`]MH ޫ-) uf`s"aZVa^+%'[7]ƱaċiES9QTs!\"`MLZʒPȗ=b3|[,_m?;>Ʀ գ/GGDO!;1cG/X?}!-pl- WywB!?C#/3Y[>V #DX}bC?o8mY R%&bH<Zuy7>ݷ`,cfbu7L_%s5LY,~uـaZ"֭enZ^Y\^$`<^=J*}[۠xѓmD۸ ucW/'ĦG3vN M)F{6#4Q+Vѫ hQChר^֞Z6$D(6cT,0cǭ2@ JFAjw:jrQA&SÂʍ

lZ/0i.0|*bK4WBIG V*w~0i+q= }* (>%¤%|$4}L/齅 jcad``@CeHd( L !H3@60@ }@  9I .j0e#=ȝ,`Bছ+4+8:&CHm PU> J J H>K:D Q$>}}3gx[Y{9xxx@CGgw 򹡹)/M8#+ScgߡP_@C M~{)oL-M \l fMV<sC{,&<'gii{CKǧlP禶H~6K[ggUmAxxo$ARg]$F85.bѣ$Zi8d =v$Wv0R/ぃQѻ di06[|5wd e==t&n{orx" }&˖<6Q`Jky"`qka74qG kප$SAdĪ0z^xew*F m,tĪNrq #Wtυ!AO:i8cC|OPam{('68iMof7WD d\ 9]+t_9BOY&O^z*.4Փh]XIl|p,)+\y,5S6vEím wmpzH{^>f(?9YxrZGbzcJ4@,a|, >s` ROtߤ(nBάpdO6 F5v=n;UM\rqNt+2{ȤahI?ŕnF $7']E*xj=!`;\QėnH)nxLƊ|%sBOYT#k^EBԟ\"amxu̦/ McYiZR7ZA%dُRPwVi$MBiDY*֓IZR6.˄ٿdה;| NՓ7淞ɰ再<0.=h4NPDA(8Nb &.40U`V?WYlth[@lx_ ,hȥ Ox ʟ\neEȱ}T~>_a\1NIy!n}Zku\./f*L 70ٹ߷o-bgP\I8rX:AjE~qWӫzȻ ^atV1eYdd lzH]Ԡ7ʠ:iILlW"x5l=xABVQ DŽx%:r0(w3b-rX2em^&|A9#@ FXjI֖yjfe|4>w[Lx4{G{9 @XEc p Y$-v-xmRg((̦9#;5tz"@48tyle><5 7$yV[ Kѡ\\%~h;FMz 岗"|.;5Y7i;-C8rǩGͨҬcɐѺh:} y 1;9 .!X| |rMkX@v:S cыVQLшabP)jX2*_'`:yVO'z]CWlC^y1D'KhFػ@T1ЙhY{{V4FώxXcycPw2xM:q>ٕB2 .{}`>Uk,Ȗy40^pr2ĵ8T08u]:+s[:oON! ֝#Ո!>&zZ+sBW 97\kߙ1=CD7dxw ~Zyuz pUGw,t{`}n M7t0ڭtZh_+e"꿍١%SPv{&+AZAZP1(cPZ'R=a_"12wŔA#8"?}X1\_ȁg7:(B*I1_Ƥw`hAd@pm{1A:=˷:o5cmn6O+MY"(\߽8G@f߹J=/$RMH_b!ov ]4`CуutO>)PWű+fR,*C4  G^H xNsX`uC%%.ߕuFW,;CH3;woCs,THX(wnC b-$f ӯaE%4ɑT'L3w)/&SJ>NWa,4gv@с\|рi>>ػ:+DnMw!1G,l}ƪ;gjtn+UNzImbd?%ڶ GN] ób_դmV|ѻ\7ېȲO)>p/ݮ qUn6x?\huHBo։Ԗ9(ǵ n9NoYU>HRLgwlٯ3 븽60y.\EP܉h#~i¦;JHU#`QiF$<6*HVyc>γZxHlamYbE0I6vԉ>OoJԒL"(xc !-~ISӷ fo}#p@)p B7 ^b,fU[@NcX8 ne1$ ={Mgx2e}%O?-7{zkIS[i$̔LG'Ymd ڟ֊#[y65u_Lzoo)Od"*'~*mg1[@R UyT=ⷷ+>(wkhw01Ly}J'+!Rě;&( l9 mq,`?N4dhA "픪 IgJE@LwdcNKw^a*Wڼ?JtӃ؟xEGC)V7zb̑ou}j=ssplleBo>_V_%ӡo* ɱ];G?-'.QAmi&V-I 4~~o<5_ҥ#Z=g !+xL *!#7+xQI^}]7VE# ^L`HqRJ֐5?ztx$n[Q;xV/*[.dfjR{٬ٷMV|ј4u^(tg:1Z}cT3v0ѹ@-CDrRܑ%^u`n\F EIHөG^;Z4يnbW2e9Fǐ-gGu~:l1LS{n~95*JQ;~E#=+1|~yΘH\rjF&m9I{D* l>ݔƣa i] pCW+_ڢjۗU\-{?}9y"Ҵ Գ S,L:ePY_ wudw'Q7Ui,ַ>jR=WdJ&})ƸUk Zds88vVhN2aD@>8hx5 PPȞ dD`c/aex%(yJ>'ܻR:bM yGflcZ<FHs"CMl Jk<+֙E^ہ,|h821f^K>$Ziy豚0GLlsr;In!l<2'B/t~>>M9QJ// 1}41{ DBtFSDs~d]['}ɁA`{|I"Uz.7&Az TSF\4SZK1y@Z:8|}[@e0:mտg,/ p0 >R=S&+ThPNJz'F p/עl*{!`0JhkY,&V.VGzX'9FjY"_ "_`Cdӎ'^b-;9oЉ}_#{GugbCyd`w")iKc=LG(w1#&C epRf\Tد}p$_mDZӭ9W3nAbcs==ɫ0ny^lw$c!b߻+b9hsL,yჃD.k䤈<$i#o >ݳ׮qv؝dbX?&(nxΖ/uϳApSjvup#2'uTL:)(h}I+NowѧӟU#v,Ơƨ+NJK/e)r |SN]z!82pc~Ӓ:b(*iE +\߀W[#gA*0ԣ) C&2S2;YxH1 ?$9TyKw=ț+ZF+1/lDPƯj/(Aa|{;5 g>*vn=şoa%ށfYm -ЄU B̔cmlƢLK3Vg:q]QiUlu*;l1{5]HZʏ-Ll6 2_ޟ:4x=ZoWzrפ * 1s$!zψD}BOAX_XJs_v|8{KCDiDシ |Za 0^G7"/3x:{.ߘ^St[CYZpnqciחćV5L-o3)EKQ(⩱;å%.M33,u`E>{ 7VHRϠfA=$(Lz>' 2 la<z X]g譂"CxiTV'{07׶#n }h@I>Ab㧣"*#A-]Tkmwl4 ,oQb/g=`e7zē!t& 4(g3GqʫрGzTAҘn Q[ͬ ,DRRvkR50vQjzӠZ#1*QUtUj@da/ntM燽,Ѫ GRN1a'e\IXLՐ]~q}FhQq؆Q,n"C؃~R~zp:"[{YUd,2ŴLX_=OR{g:D^:lԚ⌜P6;X1gVFtKށUL=^<>{aܾ/հbONߊ>P ;s:s0Ćeq榞 [5 L4%k75zEk4@9<,\8 <ܿ! gr~+ nx?aT_WۏF0K\Oδ+"mute%y VW2|쩝-詭V_F_hMǜxMaD5 L@9""(?D6s Ӿ]Pp"9]!x5L~+ۯ^`D4qլi}FP[gRg,Ml1A@݃} &N/_o$kf M=P1 M󻓝UXtC\q/{^ ^:(^Mf45R<{"}i7}|#,6GxHgv#N} ȿ J}ru:>'ܞO`h ŕuXx9cG7YnUGܛ󇕏-kYPs+gtke+Ҷ9C&aDwH}8Z]\;'qk7څMR@{ل?#' LL ]T9(A'Br;8)g]e#e̊ H ~߯,y VN?SҖ-6?PŲ"}8U.Zީl2& @BoIRW~O1p }^-|Q<{TI(BVuƚmY_& Xxl!޿EKt-="Lq<Ȉ+nS7^1v^aC0nΝTIA 90 46rףxZCoܩHq^Am;*bon;(ON_}ۊ];$iw9'>ٞ%qD+D}ܩhpGFH=)~HIv'.xm'H.j!$) L~?Vr nK{ܘG+ iN] JV@vCw_ 3]Ed+7({z>;Jqjl\4mlxPM3n| ((h= }e&nC6aaeT?Zn?ǓZ뎕2󖊗b&[r!@& )BV겱&E~yG`-"Wsq7~`CZ@ iYeK4ƴ.'oD yCE_)GRR"q0{f2?.6،tHv:Ҡk4i7{M:)DLt^SJS^(P|,#iugGg*`n3锾zpCo-HdAz,G;Z}0VDmL*w-c;[_"':[viUF)M.b !3Eد7ӽr( ycB>yKҜh" 1u|xR4)- !HK>2,!茋f^Y6@rd`- # U#C,!$LO3v E -: ڃ"?|s^M<3„/? dZׯ涿G\4ܝ.>n~5\8{LG8Ȕ|^flXl.< [FT4d\al\ZsJO;cS|5 G4bAQ&Z*%LU3` e} Wg,Ĕ7U(4 k{fXNr6g?8z\ TXs׎ԕ'ӏq1fjM7Gwo;B*d]op>Nqj)vx.$ӓ4H`iDLKK@U޻̒j2N7aVmRɧ\˯1j\u! ?ZoʠJ6v÷$2 (-%Zl4*-h6~0 UHlK6^Mb9Ѩgi|&=Or)H<H+ r\LF][ WͩqP%adI՛!~y-8e8C|i_ VaAFLt9颏l3]$z!%acw4|35~}ZBU!&DLv9{2Q,a=P\l1\<)bֹC^ _v8 3w"p7zp3O|=.G`='CzEo6@';ўM#>0ɁT* ,Ǩ&"Yd{z))IlTVi"6MZt@c=WǍ;O_ilLnϕlˌpd3Pj/J 苁bjt@Q/=֡OWpjG#?>)`euj@n\ghF!K$((^DDЇ5# rutEV ش9"Xpk3o Cr/K 1ejL(օLOLfM z|ѐ{p@PΌϊDK/ mZ⭈{ADuLz_wIt>>hX][b20r[g'x<~C9!]!_uŬ9 BZoV‹o3cM>.o}`Z|$A'@H=mZmef3\YX%ulԏ 7| r0ž;yJm9<ڕ vQ@ukuX㭾D|TKG?":T(;*-hưb-`[_fEBo:F3ƀ/wޅG]Ҥ;<,T1,YFZRV,}).^O |^'N&NDzu@r@X} j !0X|?~h*q04rměIqi82P@VDkꚯ}]º~\5q"xfgY @=(g1egVs6Kh-zmw `ksjK3k4PA3#Y]]B>\DCAgl#'´cAl0| +Mk ? L|JV/0 I%#}%|j gLZ5rKYNm#Nvz6xrv]`Q۪ VaP~jd!6$}wc">O<-IB|kY"sE0qz|aYӢ^0Pf ޖlWt]{|ғ //N$COxz&{*ׯFl] }_!<ȞBrOB!/xKuțS>pWdgBڦoawX7w~enn~ӕ0w^ O'eu^ZZ5x#fjŸ9`mC/B\՝.|v]]ͩ}d[ 9`24Gz~$Cf޹Mօ}xrSS".b~Jju>ЦڍZP2`m@/ye=*zaכG΋b ^VC- R6 ]8o˅T4䙥#7?`)zhݲ(OgZi(fp $d>]j#cPö( |jtD+J|o鎢5MD)2joYp:E#G[NoRгM [rڒyty0'8)㌿L9z9WDd]ς3Em=MOS# L!ol(4>_蘍Kd҇I{'p#G#Ѫsy7˗rDvA_:屑d’CwQ<|1!](^TUQ\MCڄʗ*\e i1$ȼԽú/n'}E?OeyAl׈x擄B_p79A: -ǸB' va9lX1 AfynobR -mȋ}i^0C$3N1v^(D3wϤhHZ3ked璡!G0G B$I3B'x+25$h c$}$ _^)L!i<>ߑDzFrш|4Ó!.q;f@S0RLqBPANed[&ٛGUl"y~%6:(U=m+xѩ0A]f`nu@ Y`&Tci琯bX. |qs _$pS@o-xDwri[־/egf~eEղTLB.sWp] _p J1hJk ҽL\s^q̔SkE[Dڈ֣wʞ- qT:!~<;$5}#?؝@̐˺H$Iժ[",ȜҐydsD՝(s $w=0w32(aQՋ3V !UvTfGnz)Jک],֢'I3ߝs ;YkbݹmAykM2M c <`#т{9!|D|/_X4au3n1Qhm J/"ydL.ߌ Թ5k\|aqW`!S>mzaOVv-n 7sҾ. $نqx؆LM9&!פ6 şTe/`S9 Bb ͉›['WwIޯn<7KK/=lk;_tW'o C|##n|blș_Yj]v+^qײ\vחu9K?ق͓oOɽxoްovY陼y 5UnK:]8/=:V v͞YwI|5SX p\?>ryԘvhǷ~XW^5…ylJfsseވu:#呫 xo{(07Wv :]歾s[򥗂[~2 w~7=z1iWnew{XYb]\FOz붢U_kw?R_wW;ENÒGbӍ/l[w7-o9Wo5|2`6㹗Lif4_}{TrM%/^7A?+q+_ߺtⰟ|lemozdgpoxnu`; l\ aצ_9mZi|? /?+Ɨ=puhbkn۳u=I{x̾?'Ywzm'f_9cPU\0`Uhԇ"]qoWӠU}km ;0W=WX.EotKEۧ,ZpseYٗy_*=umu_o[yOLyq邲Un_ɛq-iʝ,ۣ\cwPn^Sz⒅o̭nlcɕ%mz=~Dϖ >vha)w<8br4njѾC}e:7-}Ķk_{"wݳos k}Mr|<.ssocfm89[z!o[t}5{6?^O<.ge]cS;d?.oyܓUq5ȏ.cxWsAg^ãʋޭE_wI{pŠ͛ew<:2{^j%!o}dmwϊƋ.*ܭ.h3ᡃC^@ɢ؆ 6VܸDu/'*5tI}}7t?3>wlx WK Z? \Tnorޱv#'ٜ3ڡMGz~ > 4:p}[ߝ(輩|XK֜ǁu~[y/wU9qlQίqvWG+Yڕ.k;ͭ[}O/|D O[}͇nZy4ڇ'aR"x#w8>@1sO%;$ i$P8: wNͣE^gaKxDWj[OUXDDH-% ʓjB"HҤY5Fj Oi@< 2ME23ANn&%szUvN@)z-P'M6 hj%ՈUj‚"rFbTF2Heh, ƳTaU4E?V- 6LQjURvz|ge2AY)r̵JJxBWjW9p.:U[aSS,)bYu\ZiixEմѤfj$v)fZ(p$c&)I*a*McT-Ѫ%}B2NB,2mp8MHz.g9 J4gC+${Z6=`5N: M#Zk4=d@rOAhW{HQD*an?RKۍw(@0wr(i6d#>ҁefT%Bl\A4۝TBBQ;3t:?c֙;]-S^nμWa<Kۃх. Nۼۼy˴vDpըj L *֭րb*p1seF< {FBM8< 'RkUSHn^GK;QҏYh¯.2Xw_x9b ]N00oR#.aN6M|3]W/RU )ShKyS8B#~}~UjX\7$8!4_C4D@F)Vd0张7ˡbbvMuc@#S~DYm}~rNV1+C'?#90%)m $ fL 7V@ʏ?xRH::R_K] &=ߡ'IįɈ`bH@T:/ȉdcx@T4,!k&N W+\bGrB,@U1D} VITkFv7zzvn:y.g9ld/$(:Yu1XK:bN0'E5Mb?vfWoWخo`|_8odĀ?Ҫ%A۹9y~"s۔+iz:kPpύuqS_t+^?n}lg]{Ϗ=AoB!s8%n)Z,OrL۠a02bLd :'#iUTI 5JT!+46F(b, YBm馑6ϲR>`6p"XCcQ\ RO\P\7e04 XiLCt \OH p;@.KD 1&b;`0f*:RQH5EzOѸhi1"w%MHucM'/Cj)确 O1q"&р_g;с/$<7U"E [v`2SD r7qxL)xrՋjFMY @K4Ձ $Lsl3Vlq%ގBZW`]3 ޭީ0 JJxP;SÂD-gpb\kT]mZ&l(ϽVFx]DxPM*/ԙaًN Zɰ41gz}^ .-|<iIHFgXlSlȱ\"!chqkjTU4$FXpAV]$ҏֱg\^E$#mBLSW`̌ΧנL@]cT 4!41IδeP ͷEQ4$!q*Prbu!0U X xMiykQs|)isW;fjt#j=nM?t*kP/Bh&9{>pyhLZX-棌G`14I:RoBbbi*yP2 u7Q>FOB|Zb7D*Ewؽ0(0|3h4U!SkiFy.4ɮd&RTC a/Tj 5j37(!T0.]n+nRK/cQ,@܍=!iޙ.٬И)U@LI(*25|/4׮R+b*q`X /F. SR-^ \ޝY˭)!ps@MTz&fhћQG%lCZBؗWHj @sXfoûbw]ɚC@];lH<VEN"Sw QNNb5YJUf'X6:- ʿۂXܕ4 !ƈ@#{DD8`ƴr幷`Ȩp@BDA9ƨk@Z1i\0FڐL*sبePL1,I#G2hFgVѩF\*z ?6KUT*0bRTgKχjJL=]&+ꙪJ`'Ӭ3e,P2-vh He[dKU0CH7PB u*l)7Pf'G#yA5؏ʱt{0#Qo{YDL2cz,_/PSn<@ Rkp B.>Y9yb a:zRCqw#4 {:*?Cg6 "(ヌ(oӝx~g#A`0aA>|vz 0;h+|?1K]~4Buc7Tt>"+r"Ku<:аYo*zd8<,ʽV2DO3^z!}D!#MDHW,|TNqzsnp #"KJ[Yg:،ҭwm!tca*Ao8Ș@>xr( g<%"@{10Ѹ0KxX-%C^u\cd8rDp0b!-[P]ԝ;ןwXG{XHqT"]m } cv:LIϩHD9*!;בNOH0Knπk9 onuu32h6F]UGSF)A\1.u`ռQ4+Y%d|в .հl3Z63[tc0501h̠.YA CsH4V(,Y!^׫)#8TyF#Vvʠj*II+$_G1 ?}5$Eq>rRUjw8pZlfUQDtDej;yx\hΕ^OɃ5Ki%8rH@Eԁҁ#0hΔU@hBmf$bw"JKgn-SxFRSvyx3qw:8ErJFc;BuSқF~#..n g"[&yȾEGppxwq_qdAh"n4 S$ɭ'+Zz_3ObQH"y j_8,n3j{d[I3F|oˆ>iGx!Kgԉ!ycZWoX"hS-yEX9p4ʫ2U8[z9&(f8W ݸ&h#]5q$!Ձx nz!j";g@"H@KlN hEXxr Ә R =\ߤ3\Bz[%u"a/: `>T֢w&-2V'kimiN?N7:`w09I#:y@k}Axpg@/ #4BA,4)\P8Iv aP^c$ m8$̒[j b본MVo"t}X awZg]m_V!=wAGDe"-% P)5"zMeO݇- Dj84N)DO1j+@)jRf$s=*BAB{jFTSMv|""0upMAz"Lo/9JX݊  nƑfE #Fm„vj;j#)̰R5ZD܁8-6ō0|>}=OF GdR_ sa1!ec05":ty%A?'O}doChgeI#jPAPahKZ-7>6*v4tpKE xC4H?i9yǖHB #D֑ ]]xvwt}+cǧ7NI]Ħ р6%pFCLTD6-܉ڔɟahȝ fqcF^GG{'`yiGT#I9lQD  \tIm-lWO 7 R}4%+It,/}$i)8d8A%w V2QqŘeLM"B^`v $F]v|MR!wֹᨌ-k6Ry%&Д6VU=Bóe;ł8VV ;ܟ߫*pspкݿ~ZLb9\_)YЮ$8PPI!1X% qK^p,ab i \b;z b{(Sĺ.^L\yENݐ(( eЀ(FZ}r!0g ƙś3Qǽb3nɗ?ᒥ:()H%RD ĦA nd>jrY BPŨ]/NPI H! $k!"srWWz<NrE *e ,qdQ~؎^'2iRďæj#?6`4vVQlJrut](CoOJ٠ېҢXc򘪢 啜sntny|hąp((7 \E"J}ƪ'uu9.} N9:<R~ d=W<Ȓ[cBz$89֐~怃(M_dw2eMVGJR"#)/kOʸ MfJ1\HFefcddhD|wzfr[$Hؽ(ʫ!4Lgܪ&i+LZ>4A:uedIt3(1LآDun|Ł9jpxA溳0e^#F‹܀DD-09)'35;\W!EѨuJf eܭ<ס7\Tq"im> Qku7k}ɉ?9b !Cv` [>owͅg?0ăYhz9驥܇ף hĝά7>ƒcXx B3 ]IJd*/v7DWYRKnN&g˒9J)EGcJ!1n8ƑҀC<| lϵ4~r)ES=2M)t*G^Y?ϥ{T!4bX[ 8RznSۣ/SO!ۑ'tE HriH j͉8eWTCkfY5EHx㉗64гRK1.u*6ˬyl(GM:y@ut X^x 6X5ԠDh97簀\' )j?EM¿g6AMp#QabN=AE^Cr"򠣫I'41EjhQ+E=},#-<(Br1@w+:ɕ LaD5I F͎](I*5"&'cX'%"av 5Qj+/7"m"MMiD-߼LlN3Ȍұviz8~Uץ ߰+}F9E_t=hE,R.4beDb"[fHL*m(R2xvJv{B߆6dVSnB>էWI2T 85NJݥ"lJd,F3А/RMMx^)c4Bf*@AatTK*oBU*b0.h|f]=er? .t5H^5+*MY ?Fe}].DkvҽLUjy\o@x*^IdR`xhπINh;ZT0_Bp|jq`i=uqoCEm{p*)²|Dꆍ_j_B fq E9$DGߙB:AM=SUw,Q;Q"}5sfeJbHóP̩3dLDtIp4U5q0+d%LXHQɨEѭSsL2qZE-8僟pHp&Ԅ'LNseVK눅 -&_G$YӠޑ!VLmb8`BqSMa]$,2Tę4@6䤄ApPv#yw߂9%/ZxBxu94 |}SR/ǐr{id VT'3_O:6sJp ,J+V?tIDB9mtG)Aob/K@ZG#D&A! h*=ByJ$ `7_J}tCcbҨF CAWa#< :KKͥ5Jtt!}3Jo TBHHTJ 0F}f@^`b!13<{_VJgf9RWFč?g.,Îb2 FOB[߾Sg]XwА6?7gRgO֬>ZFщE8\P_B_j&e˨M:Ɏ$!i? $OVŋ͂KF5 b>$߃l f!d5Y%?97> -D529*v>ͺ*:-j+aNbK%5դu !^NNڹ8xA^qqL5x@}GͰH QB4^=L%N9X3r2\0zԶ*jj\ dPՇ|Mҿ3i;)(&t@)Diǟz]2X[y5F9Okg}gMO{}w>m:G:7{`E/u *륷`(h8dKw@:9lI赻᱋Q(磮YTrBzw;Z LlvmŸUZ,b`=Ҟ ՜cTUx/2NT%v$먗IP*lJ]JՅAE#.(0~jc_@մM1 "u PM!R|P)vjrF'36?W{߄ S\\Ũz3 s$G!ic`^;YߣQ UDr1@D[[ǽ8V'X4@8j"ɉ|>p#@3q"pR?q҉68_* i 6ޅzkt!͎ O;7|? 68 ϽB[i Wkݮ7|mMF$+uwen‡7J^X #l"M C4L^Qq"4))jJ/:4pfNOH{4gzM- ,z:acMRb3i aĦ.'83y}'-=MZ !Rvt fAC +*$ذۨ9I5`G{K9,d\npYo 4eY!Ȃq}-#6H>))dm~3JA!,٧U{[n. N웊-f8xP1@- |c-t寡G <&_0l0kN6F5WIy٤4 *_/3ShڞݛY]R1-<'-3}w߹~7-DZdJ\MzldhMR#iՒHbJOgWt}e͟{g%u5dt"u8!pnobLU?&n!ˋoKmᦄ)(o[ޞVO_'f8wY&AՖ ZI1oSpi = גrǠgݤzә!_ƿ=7z{H՚6ڄ4 ɒߴǨ3 ЃI$G@Q1Or *X s`0_@OմpDk`uB#w [F@z"vA@O7"\-<(Qv=[(c:S] (Eҙy"vyA/a.ߡ@I F$*wҭE5N^wPHm,رM0iCv4E;2/`Lpi.%DF-2iRgs;xеټMԥAZ>eцdyK6F`)iNL _L/!ձyyЊ5C1YG։y^[;:K Nf6L,7]c틙b.|q4ՇJAƆ\)%Pr (H=uQ8e&u2إ%ЈZ-Ǿ:xG1WSW3Nb!Gq` J)[e1~\ʈ KQjZh1tcНM|Q9n[7WouIAq_%|&@8iaXbxZU\T(5"ٻr[V HIum w`>'( 1O1D9}\@D|^ZiVh|,S 5gf&vBMÂxJ%~̰Q<Ԃ5^L)3jk1A,NU=%Bu=Ҩ)D`!vxԲQl"x80 9CwGHX;!?]G+6rk%qiE%8R7ށۃTKg@Z8x?>rɹ_ZP 偱au3`lVy:BDqz?sPA8*YٌEuWBM E9#ȵF_N{: 2j= zCCi 2{l!y,⑆U]u>[f^w#7g;UO$~ w o}Oqs=U* cG;4"hxmhP 'nނpy2h=E{lS,{ O<WfȁZ|[I+|% 6&xDXDQ|5z{iQ8"2v6_`Lm>j@00ߋ쥡n+$:率9$G|~(2l'&r[-{\QT'k`qFDTNi$e)/0=c|5b~ A } chvU1٧v)Gcl|hyaiQZ$f(M{;sg#8_oF49 vVX43P5 oi^wF{p$xGJB{%pmh2,g/RxAͪV*C 4ʆMp*V}t$[/]NCz6M}&R3~qHx0&V L$54oI'ry4 SAyJj诀.ԤS84cP8eg%{'U9#<[E|* %kIZ\Lcuw46 ,T*{~ _LKWM5x(C= \SY'} o.[ ߁ӎU`!ݿlS5i3,Hq&3G%AG,s7.Ky[c ~<pe5rCM>. c2Gn=&=V(%>0`Hڧ>i-e.Q3XbaXEkڢSXM@=%|C WCg βsd42+،jMZvaZ%Ne icdj-WbV j?8Q__E|@7 WBɏ]p~Vz@(jn+aq֭W0uQbdJ掋pZl`t[@[Qg*7KXC#'բHd}d/=Lho]ܦ{R6Q >tsSGz[OUa4/:0;bn 5b{tw]Gc8gnS,i\jMt7-#:-½d#wIR05Xrޝ:swrBd鞑 ;G;Kr&G {1B!:YcXH 1B;M/ԸY؝^Eb;dHOV5+=wkX>U2o.C 7I6UHĖFf0?rups?CX8_:F I@߁& nCߩ<Ő!橍<uӄ\iBAn:v93>Y3'w0lg w9qdwZHrJj*ZUܪ| OPe P'/0g[<=γլN{ Gz5CRDL4`RM!YjG \KX;$~Fqz^=PxA:〠z?ml6uLd$j\qj以$Xg b/ 8*u`.Y2 +|Dkձ!?M yP#'!VGyrMMUhܲwUS|T6z6yc {,lMR^*Pɸ )֍!_r`yh CKrG# cl" L^;̡>$Eװ4 ⭢QJg y,:>Wr9Sb lFr;@_fR A+s cJRbz~Fxpއ Hci`'3ZG~.e:HTfk`5D)s'w߹oGw>aaI& J3U|lmn>4povm,?"mprZ!QWn:s&椅:ĤR$=ti'" ?XUIJEL!V4L"Dm+җWX={p| n^F]T6. cB{ _XB/P\ɻp]Blp ʼ|} is%fQ.OGgfAϒbbJa et+lI?æu|n|ѕNr*aDAu#YP'8eG{4Dfe|ޢ]+:1g(ѽydLhAڮCއy17b j$(RwoP К+_S1@J4[uB+3Ua^lȊ~|5J9Tiozg H`jEmMo"4H9-}eK;uEwrbS㾯ya]S;:/k3kQ*g!')xh9aer^|Ϯ it(q%Ue 7,7U:<bEyu-|Qnz##K*>u-{ci♧Bjl[B.Sqfxruq"̎"ʮ<Kmnp{3\jD(>,H"@yLj鮚Q,9v\ABA]\" nALS|Cqs[zy1!RAзueH $)Š[sk'bSr12 0ENaYӇ]ؚe>.!Z 7Pj^;18*kp76lm%8_56c\`WI[Nq \<5^էk薶3SMGs1C赴,$k]ULbZSd-?mmc^b3e li 1$#|]h?Zh1WY1me7Cn>4Xj (/OԷ;=/Ih}:݈7e_ЍZ(jGE9VΠ{m=(lX g2nnffx$ChukYv/&X,"""os8aas7dyhzۿ'1]0Ae7ЂhJtYӖ>_"INZt*HZ|8d@C7Vzh̔͆bxJ$3)\كW0ŤKHײҊ@D1 B= O3lDl? qqj!nͶ{1d+[Ի6x-x'>$ /feUm->MD`K8*Ro>-9dWM7C',rh;N*đ3Cصx0K%͚, 'hc|x-sjL쁄bH ;b8 hHaBM3܀br}.I<(P}b 4ZuC D> /ֺ3Z@E{d!ڧ@ A]Xsf/e,~x1RwB0? UC ^LZ6bT`Jh)2a[U!%=1)1^gMB9{#O,jhҐ8Cߴ7[A5bG2=A.ɰ(r"z5\@f. bz"ߤsae=6uE /<~}Hj\P>g|A3[/bB*pO, !)Fhϙ=Cj%쎮2KYeZc%@X XXCͪJKX.iJz ןTF>d`kIp:vLYwƐgC~źfV%tv黲 Y ejpCIzrÝ/Q" tȬNI'LͳR"VEc өXtKrM \;PIt?i7i,UaќKAJqe)GhWHvP8)B^*v4hI5*\VXH u[~)a6cu@ƈl0ҶW$ FMf$b| :rDG4%@s4'kp+K0[Mε/C0$H)l޾E'ŗJ+-E"ۏ:4p2Xsz\*B 烍^: 5b}3+^NS5 +`n!6(bx'nel8j`LGANGgv_G(oDwa*FbZb`>o'l("Q}Jw*]Ud`; .pLh[r`U(ob3Q /20n kJ NsSH3*4 `{.` 97&#Pݘ읮Gp>x'ƻ h] ?Y-?:Y.jXQgŤsCn1jj;i^I3O2FGc W}>lgIه_UCφÔx9 E֠5ܷ.B?5o~D֘}-&>}KcQX]P/I"S$+bRifu?kӱC~.C_ U !(Üg"ڑ|}?-DPN^:yF#w~oTO޿ɻTMlx"{$VFv?uװc[C++X>]}p ;bj9?b"E<,4(6R|7KհDwbf> d53dϧARr6.7mmwSK?Z;j<%;^2E?6,vT@d ƞ` >;]͟ 53kԖw9PJ:IS54?&HIcD}rYU~,F8Ql!3Zd>0?j"U#=# 8sqӠJ~\{mܓbvQ`:$<O_B9"w? }73D޺5}!k;"r< W#>kBtYsuH )$ VcŶ{BeKiZ'(wQig *7 āvd/n$#A~9_7- ;JejKV>$ȝŠ鼜Єo`L!-X2g͉DC}:vװ2;Fb柮6˽F“_g2O('5:5Nqc=N\śķҽ=+;LMKE)I!`p,W T *o|: &ilś~ORk =^KmXJw*s.7c(oXT@ k<=5Ad & DcM Ajx$ @;HC?BK/I'īi .Wʨ$ij-DH;$cx.=vigZn@fJ"h,a 7—?^'WL07B,7N,6I+vlnx+$yi[7tϞ܁x /6hy΅SLؒ~tYK䃎d_3BE6|`=$3uq:.M_{ p՘y-M $MR~YЖ1p{!4c`sڞ$L=^ȶ'Z8vD1Pݾ x8g$`,i&AyUG 0M7 vEI"f]؁#ΡiOѤjD6c1j=9mQ(oB*nDVw}baE)7AǧU#P]dP%4M]ի9) ]>zʄ,FPXL~BY{H(=Y\>c2Uz}YW4,{>k}t+tԹۅ/ތ݀F@iĂoҌjd\>C={J` ,Cb6Ҥ˖KUX՝pV,qE-B WSv Xfj+8}[@( };SX!Rh۰1[$Npa@X+`$ */x߈ ^)ҾPxTbBUGl 8|~lz;m_~ƥ?/iO{:O Ndvxuw!a:Nʊ7^v*PQNyf}0f[sU.#X%Ϲ/ 3Ʊ|ڍB& `xiK7LpA`lUuXyy^]Չy_tʆD$=Y]\;i[7ʥ8V.DydceKǕzﻪ՟ԅ.! /61AqSV3򸛔vAp N^m#eþ<|aesIUu.~QRmQJOs 6L-f}ύS!Ҟ2:}e+%S8>k: +}z9+h jcӫᮡ?g2ÙH 49h$zԏmS|!.(H2Ә% M̞vdf= m6,+=7bgi0 qk&L1 zfMbR0ٰZtp6/z3Q:fE/U/92ܬ 2٫Sw2tuUP`דҼу9a緃^5a[^OSz6=G4;u8,Bb":Wx>FvRxHtjgƚIZMΑpʎ"s*NmR;rֶ l~S" no;Z_QSⳡi[u"<~z׏UӞ#eFr"; ^ ;F! !|1O:pC^IzVOި8N'Am@~a7Xdq)r/4G{x8=@Wv%5Q:1Ȋ45wj Lk:FR pP5ՠ̙JHLcjl@8?=a@eordj PS2\ώץ^-z¶ UlF?ʠQ\fmlU'8 \+SvgĻeF-'L1ʂ)@O@{ɘ{3P`d(hW&Q1g!ƁXVX_ʁpj(=P%XzG>de Wfzδ[ {t'da>,@;aJBKޙFWﮫ}kX (~!7x9ꇱ<ܖtPP G̗Gn5:bHc"|Va}pn\*w0{]2,W.! FNRcJ;o4"6C=8W5QOjD=M &,yIzsd6Kʅ߹{hY› vǁ1~Lq޹ObxJڍE+BWi28&tO3ia˅7A5GVuE¾+pK #4FȌ ީGxj"w(C0H4IhF^uy ɇGzd*.¨>|0pS\|jT/^Y[վmOFu# f8sy,1LݕӢvVcuSodz&OEV?L6E#;2LmJ#Jb|uJ/p FCaܣT4@{!򩜔iO$V01N+h vk&z=4 }BJ 9 pՁOܢ|pPhD ϠRzњ LDžSk1~Su4<1^'.~JM"InyaLmgL, ( A1J$VSnsg${Dq :0bîj.ʲ5ҁ=]MQᄿS:MZ!tzOS ¿cCLGz$!.d nᘩTúpWCd5br/d/c!w&X&s^1r'yguM^a![>p'l|S.z;i'kzwS ZCr#Gv `vrS1l}p u&z>+d/sfm~_ת( cn }ed'1//"IכNj>|=I77D:oJQU]/^ֻ5A<> \KKuF'@K \j>59diIVfSOy5k2K r!Or&&.I70|iNgd&{ ~4bn@oB bM 5wHaZաUw{-wymHy`skAEs&|Xd{ vPuN-Oq"8<;H|IqXwGmZ qر2i9-`l,{Y Qjiڇ}?XJWz:#߁j1;5hɇ:PM7כqftR1(:x—6/w Z)3/a@앋c"ıA;`("BvWF",'D>W{Ur+fN0F"`2^NJwaAs5/fՁ?! ؈$${pOձdž hᇕsCcUmLBGhTȢ *^iA e-%3V %V`فAr z3EMMV>YɎD=tvDL&bGqa0NQ4DğφK&^-ۗڻώ)!ޮo47Me 0 LE5^ā"7FƼr1V:E܉QF1PԳyTُݬ{P JUVfV0'q;/^0(;V?<)d&6r!g"C"2Őx/İ&\o?ј\ ^o FPP!mO]}tsStKGVSG6iu wE,+ngݔר8{ 1ibm0أa^9 F}aapw}t\NE4D(sOml@%xri'䝘RSZPNahMߴDN=Hy hwVf1nsaB(0'bX,p}o1QqnO6@~]U52*T4寷<%=kuP*k%4;m7D0ƾe'^CenLx Ja\_uOG|Bj3tL>P7 @:4H+ˆWp JxY7 ԛ7HN꧂\Q?R [ӧD0qa I!L#\p\};TQt]_tÎ3[[Y#[EdZf-K}:S*bƌv/3f1xzEK! AP`"J竓"L&BR;NU]K7Hzp_y}cixՐHWJH@bk&XB4)Z,yAyV̓w Sz;P6!4ҡj;H b}k4V۪9{00 | , #Yь0@يpDyƙ}:w>d%2G>ea3J!CZGl@'k6;JuvLK„Y$:Mz6D؊9$IscmNrSSp\ h}(!%`E U`$F{4_J+iu-xȆC%;{^]alU)0AȖ@A!h*k͈[Y%nMp<>g!(/@ 0mt†l]j1UWϺ +bS2- RMCE< J vw+F%ɡ3nm]RX6p#aM2t_vI u Y=ATc>uCF f(@뚃2%:.8Mk@K;嵐n]e}q7hf5OkKy .no#RN :<ٺSJQ|.f>:o w|aD.ήZ)vQ{Ob!ĚVHSTN]7p?7Br(ٞ~&cj&8P1x4HwԔyքɾkx6T@{jlK&—\%\M_oyPz P7/dy̅2㦆1f+yҺܝ M'qO/ѳ@mU&0 TfLgWr*7zK_"h/M \M@:!inun%M3bu"`3wx. HF9&&ԅ#]M J6s!W1= )7UzDC,;BYtLC/ J:0jCS7Z⎅߹g Ѱ鍈0oS8!H ޔǏ}_Cʹg{7,`~|8GAG҂X6Pؠ59^~.>?`lqO-̦e= j[CgSG$)ݜZ9o6Nm VjAzd([jҞ)M[%fv< q!7a:ĭXDJt<ܘuArC#YNB#PcOeAOdr$>Κnˇ7З@-P(a>64jv &|/߃Zh]+(z&+(Df'Rbd;"ɀ|W;Gຳ7K:{eVale\'/] #%B>PhC4ƃXֆyűl|@a)Vç\|L5mS=K͙9@ =>bE %zB?{뚄9׍Yu/~ |w1td̃!2sUҴ~ \m#F't }wJ%ڎcJzhP%ZkAl;>ۆpۻ7k"طqidfӒ~߽%M=Oy 9PӆO Ͱ{#~j^! #s;νw+͈A=+Kr&C^_ v"|c,c썹N@; iJOeTvM/'mbGw7kaI gHzɸM6xwX `0ХϓHӑ57u}tR OpVon*be=C/(7›l!?-``*8MU^[=jڊE i$g!k}4& s&T8` D su3aç:yoA.K:%6̍$`P.N<S?~?3d~_^_K7Ne :>,G? \6rS:R6~{Mn,3wl,}a]GKmoaӿpF)Ĥkxس^5S3)Sw"? pCt{8I"YvӶIصaq3V$sL[oH<@OuU/-}%o:S7#f_Erm~!>$٠ۡ DLKw=h ep^틎QWfm!йlw1ۮ'lHޟ`Ay1F|\F:c1M:|8f rG u+lؒML[. /8fDp"!N5^]\nҖt;d-Q|rXd`ppK`OHMpCT{N 3M$B)1K#h6A cRW:`V$\$M6*_H|QpTE8Z\w-rv[a'4tN*;C6ϧݼq [FW= G'8m,905Z6tKT"ap?9u{V=atS[7W`ì~[{ kI =Gmry>oY+2;j8za*Gߞ. ,+8o;oqndzy|{ j70TsQ !H\>;ALkhY,OF?)45 EGm/0m&M)0٢ի&ֿD>HDgv,%o;{+.2L \sGh \LF~+ioa!~ K޹r]]ݟ_!<׾#Wf5 (TތU7AuzKK^qR&MPDL/ਦtNRfMomuҏv5NT+ۅwB-U‹B8Cߐ 6Ԡ]dc?t{yx;ij"g'$Xd̽B'R(|B8*eAl J|qj3,Srq\Ġ.X]=vkz S  qR3%>}Pwl=r%G?\%صN؆*rfa^y ͳL ǯ9Suc3 EHvA-B]ƴYA*`Ϫ-7 &ix{ٗ  5Bxkcc^vSc!J2~$/FhƩM\e7A!s|=a/(L/y&Fl*GԄʺr>HD"yZNc*/5f(~|N5bf9!(UE;(Q5W@{ q?.X]ضA}ڮߙ(Q+O Y5𥳐c<鷵嶭40'܀FU]m>9(UK&7% {>]^ Ȫx?+)@<t=Ui`vK~.nvWTPܴ8i;A:.?3.[:qlQ}G!bwe氧82Jo:TD s`%4wy0e$HX bOBÈI,XL.P1ϺV|{aaAPQƽTNOv֝ϊл@#tmcëAo7s3'FhƱrÕ!g[j>)" 6r$"0Ô=(ыV|Kӭ^Y 1SW?(\\ EQJA%9O*0␙;ɭ Dͺ/d@>?YoxM>@B`jnMEnew9'M@2q\ڦaJ(dxPHTfkGqkvo|Z<+7r+ɦyNE&b%EsM @ܡPl!G Yj}=O0tQAG'u2k>~|wH$ ;P|}/ yD< f.=cPdo6 1tct"3)g l @UqhZmv_Mzm#\2$9ifa98}5doK龀{;Cj-e1nMc*v߹ Xz}(V߈d#_.Sc' OV,qa 3H>oqߧ`_/؋+q)XoȻy3 #xA[zAxf=aÂ`\.͟m`%ρy%" i̺h{>U|8k??t;BQ]G=n+vlW[ . G1vH$0(f،~^ݮ=$gY8!= Q`ׅUq0 T!X"CQ+k.pO7q_I&>%l,g9zX1i[c\y̬&@H$E-rW|ǣfm1nbQYȆR53Q>;0}Jv#2Kzq?GxKաU(l($Jnv3^} =ƥ__]BF? nku" cCf[$l\Cځ55npcLTkSx}wֽxʲ<QQYTׂ+D"+R ȫ{W3;zaIĖ)hV}8Rٓ~KJ֠#Jw0*Ћtn]9;pԻ6(x7r}f/f=YKw~^2㠽|c,g@ ( U\ZAQd1%Qۓq(B)P)*q%\ѻM" 6Pq'\+qm:sUc񩲪kԺ?<vގOCdlM5dy 06Thτ9u6%)EU)AK6ڠ~*MpE]q)D>I|V8J|(-s*-sPr~^ "amI*^FF8rs ڀ⟨b}'pGk *F@`qG6]B\-t@RXЫT7[XtJ-zscV im%A"&3K `xe__F}!%~n(Rfttulex::2tCbAcל|_h$=7pvӗQ;YY`J-v08$`L"i̜48qF ԓ.;7', =% \"*H "r9;x? CoKļe bZy%lpKno3*}NHo\]AlzlufҩDl(Dxǎx 2e|T1dڞvD)&4EfRf-aTpt3N^\q3aҢ+.i |m%\q0_Cm@߇nߐغpi~Ö|}/#/>r#(5%_K˼J!N69Vg.g1&Kp|J/s؀ c;Sh>N,0)'mǀߎS IN,jd,>Kejn\A5:pNGG Uv63`$djtn'{%8x7aͿ[Ojo±QP 3j=6S|IO߆d;ATL '- 6e-+)@__w!<XUwħ^rx @DZwB_9݌G?Nk&\Ѣ _cup62x\Dʸ8H9M~os8 @l|0-=|kb'Oׁ'Qo@N;2'm,V784E @಄F|͑{Xj zn!R V=g.6oo]n^=b ca$w7Zֺv%+sm:T5~W[5h?);R]Δb{v!UWUhPfV97;ԁ_>V3aaETUnYI:\k]0b^ѳ0-TIqVk]>XXuPrmJM}9eY@k0}SSR{"1]DMmcf<~@`&Y4D?Ӗޏ=Ď` &s_QgD9<|B줽6Ւ!APQw cruҧ(~~KKNۋyp8GSC 32QK."*Iyӎgbm[y&G*x`zFCCK=ϯla@BDWJw| ?tFsx(?cG(,,0WDkTlM)MeD> I6 *3H < *=>'|4ܩ ~wdJ5bR?6nF%^'4 7Lx\>"Abs~@Dg0V|tO8!;]¸4m4>AQxI,g* /|/=Ձ}(}ß?<.r +=ူD[^Z#*Rc*J|YBY'0)8;f^}vpm~zܶ`v? EbiZ+be*2Nc ;fAA`}^7["),1 ~j?F|W1ZZ WC2fNa.NP`5lZ̕ӯYog6/\"OgRo')?TFehմ?Βu6c:s{sS>@ uށC5_ʎb74b#ZKG4%_'yzT5xeSs'(+Cb:.줸iQ-6qH?LKIh7QNZSC|nvyoPD阂q\CGsYfsOMߋܕjb c Y c̶fq u8hǥ$Y'mw ӅIy>eYv$ r;QA'Fo(w.V/ۇ90M?Uxf6&}9Y[( L͟2ݛO S!H2]Q%3 p'6j k3s%M"] dROJXKÎRL\C%d_/wi|4}7}tݻAAջa&;@$!΃-'k0jwsyé!Zf06]Ja󋬗:.yh(fXBOe//B匢C0,[(35"`_ƩAQTs#n}F53ߧ>\ۧzDnJX815Q:vA4}< Q,;S8'QJbxl\j Ũ ǀBa!vlZ$ͨ@[%&eA&@6V9/l T9-#@ Ky}.bN/^<_~ q4,L* U1 Ace6%[اR(h8Zjby`"ZfL}^Qߥ}k~3/EA|B?}RX6Ծ Bk60ppdƆ`.NU3cGYs*(By6dۢ>͔H[0h7TA?1<zţ@y`tZIob_N$"TP"iCe{֖lWv!4ǖSr8>q>06`{٫.L%ՕĢ 箖z 88}=k7&޷K~;y|/}?}_l E"#1Yf(5>Q.{0ܒ'"2xS #ˣ%PO^(@\<]-J=A2ܟ-hmqD4qE1 ؇1'Bҫ+xKwP3n"0 MJ[iA$[P?WofW{JpG}zTTFG1VSJ;n"I#BAop#ff} q3J/|Q&21<Η9 U-A@/Q~e*B#4L'{r6Jvghe@Z 8_S(8va8.>d .LEOK>`wlTy#'Nσ ŀ I 3|UdCcu=|V) >$ at\+\ HJlkG7;DNGYw[.qd#  9pwHLˈz;C +6j &Mx6rq} ~&}dU`1@P>xQBL7n==20X4𡷣 Iq.,,Z|  hKb(K:Z1 +o5@Ubo06L -+ 9J2iMle{sR1Q LYE;((oqj[ț1MJ^;kQl+Jw +D5L.d07t#׸MzULɆY8$aDhtfa+Zs_h+.@wzza>u]ߝލ`ٻ9o} `bMЁpym?aCͩy.\[$8 {ը7"b *g /< <(/vq-`8詠sLCimQO'qd+1z48)rVYfNd}*u) KAA1 _V~Zt_CwumDJ)`4nw x?̽ ]UxK[*Z mwcʭRԏ@{=s례ClKc% 1a<$$d$<Ęo0f0Hk}-UȗAg?^k-Rjܗ;yV%V[IS-T[)XҌ\ kMÆ4#WO+nõDf۲O~^&Hsy NZ6G =ĂytI[؆<+肍M͎{pzz' !y7Yik&։r:gDmmՑ3X=q)|1i5k>j#N4yϹ)W̆5a&E,೦[j&[)ܷOclo!TF^T^eti䐀J *!؍h *b ?ݣhM/e[t CAy z?Una[wK7zԯd7lBП4ES")N];ƒ,v]N i$E =͋uu[0:c=4Pie7UQ%WvcD+_}j.vi坃ԅ,?qfDp`vٞx!+!aF(o?@=YY_eg^kDZXb/d7mÅ"o3Ԛ)t9 y= ^jU.{B{mj > ځl] +/ crWA =Z.|[ၻH]uɻos-WbR[dUyo6Ε@`+{=uh{pUx07^}qax;F2HKpa#gjb9mBhڂ_4ڦSl :n!k1Tt~hUZgM5|uwLC4ݢ.M@NݲPrsf$^ 'u~?l JBeqn$O|)A2yVhhgh"h ` )jq-ؙ0GNarWY{`K~K6 'WcA\YNm @'O5:9/[ɇwU7mo~汭޻gpsՐRǚ N~$u#љY^CYͭՍt˥Ҡcgr91Tܣք7,Ye' Ba@ss;94sȄ; 7~'4y'yd!{ sWuMZ2ʲnX0X Jx2eFA#v we)a}Wg~4a's)m|d:ɆA(1dV} ͂Pģ˃Y0, ᅝ#b`fDN>Q_6SêNiZ!Ut&IW^[g@P ~yumnm'7WMC6b,W_EKטn!艖x;I;2)ח>gmWy{<ɷ;t -Ygm(8!'c|™C݁j,{3BAUn s>)"#TMf=NH E(Bs$};%Fq3L鐈]G,a7PnIB40t< I&ޯ،]!6umTKt +2آ|pNJxcaA; . "(V>&+s~B1<|b9ٞ6Z>T-}=Tb Io@"UEba`VbdBFR .V#XFwkۭexBv}͕m]"&OV=f M v=оƄ%!d#ag{qEUĬqL6&v{*anО_,upgCZawd)̵ v]8ɤ ?)ܞI~L_s . 7S"0,]`kFNQ.d?{_$#\/$8iY%#1(H`Z'. Z Pd,:8z7Dc& r0$+Aϭ4BTie.#zyOmbl٣v֎ZnD*w6e ]C ԌRwQ[@mi^˄P;AqbІc"fgQFf53m ʼnź~T(7G) ,J7TL -kXctN>"cݰnrCVčɷ\BY>f",uitw5 ?hěE㉡=ܣ9\ԥ8ȳPHGa3*FvԎ,}e\0XJ;^&8rV4z7,MDOew|LaSd_gj  /<`sDžB{kfw6AdJ>,cfҚq8Y\C0|fa"ܫ{DB\=>'n] T[hVf+VvͱBB%w^ea;uV<ffo'4oj:){=n ZPzV0\⦧V 2]џt:c -ja'd¯Ge{:6ɲk56G%oN:>{.1=&v37l}}s#XopIXV!q|^%|sB;fPqF"KWLH!;u OxY<\y4̅uyG;zTsvNI3~eg~e&EqYֳ7FcU~7+dg/~v_6ʑ[pm%y"7j dԮc]:a? :g7`8{"&BPyVRVAww6)1I67<BcǡX(g^Igَ0-|U*ZjnN NE JwdFGܷU7PF3NUsm?@2_l: ]=TH-;4N_{_DDC}2CxSFQKkXCldBGr0 #/ƮNtN0?FHOyEds48#1%=:z 4j5A Q)֗tܸiZfڍ(dN% (dewp{bE֪ ~DT`{:d, sF3~XBĐ`S ]"p(>j o A5*_yo_sLM+~I!-8I7)*i ^ PŹp!4ԙAiNk̊34xb`#b\iu>j&=«]1)2F㬹rGqJ>Y "Ֆ62~vD!k,\MSl`8Sd#Cbjh 6evY[x@x=?mh1@l}̐_眞M3ޑLf?¥qoTaq;!d'{"BEqӗV 2rf*(:cև%hg" &85/I7=iSjb ։1pa[YYf=LW2ȕ9(B\C6(A;EWͪΊ)0K{)8m)CoM6^R4H=0Ρ =Z۫ ,ĺA#8OUv wFaK0vօhKAtF* dfx]{tX Z~Gp]IyVgyq ?#'9;51V658-"`&(nnJٝЄJrZ</6˸𢪻f-J<P;q_vĈ [H)N`T`R~E?JtTo.iRg1.U3zEk ՙLQ-hN1|ٌ`S,rnsxhpu`?)x qwC:!&m>]99Yo݉ '|®Kp6(#dwk{c U]YM?}ewKM)4`a Geu~HkVyro~1RqI!{wKnKN) 'ueiJ7vzqg v| 6N+ɇ^`sТtZ@pQN^Ê;O]V*D;IKG|F'ɟMy^RXF%M%q޲};55{ 70 .ZA.x=R7޵9ʻ}BIlOoSNen;. wYKj.O|oh s@ky0i^~| hNg.S|tKIpnl, K<WϞti&#U8 i |O9wpV*N҈Q8-(Iku3d)3zAc}*dސ;H6T}kV "zwg-$t Ӓ ,)ʵf1@ӔsfKr+H|@e'\*Ԭ'\%:`7؋6bw]!W'e%8`LʤBC{ V^ *~"sE 1E[HIU[}/36?ƽ(8`4!Cvyr5I ӦߕowQ1ngpkL'γyR( 19(%sX.׎e.X\,EkQר? r쌾%qۀnV lf 10&&&[Q}B~0l!OZV -V AIbθw 04Qy 1X6 鲂ySN;U<]xfx} 8-,F)djw)J͗q@.ŴB4+ӗN]0GՎ1Ap2L۽mKBhz0F߆BCi(w?X5s:dףtޤdC-xÚQ'Ӥ~8Wo^ Z'juNis ;\a6*x?1BvQ{pNFf/M~H86,ˡ[G$˦a&@#[!vuOi)r0ְӣ*DuPjڼ(_h'hdV`pa(~ (Dž" au3k (kf<&~ `pDsFmcIT"֊ H@eO7, I$V0IOI-dqJpo`kWU5ocZ\AAP~NMv|۽(w~IЫLO|Q0l~r _R% DGIGeK<(rD׆ h@}:2[ω|@Pb6>{>?o>4Աo>_`z|cI8Vc6C(x}a rf?_g>h鯼c5`F6F N|^W>Q9a.3\l`eM y(ΩΛXlVgnWzpDRP*CY\.|7&{$slH>ЊZ@T/uX CUMg>.h3:VY_ǡ ;$Hw= ȱO4GHJn@֔(uc j=ca3D+[~+a'f]:hϯiɕ!2=k*͙^ Hk$hTǽX^x&kը}Fή`bw05m*|Hݼ  :&IVHq۝!֊45'&D$ >О$d} )2OYތwAﺡKl[ׅ >HkT'xDGx[{AS׀nRǤ6nQAaj /_[PbHiBl+ aO2t"ShcwuwVc TZ\.3!Z;kٺo > ,AC%y΅SUЩAB#^Wey?8M?Oݰ9Җ_}ȎϢ+ UԽٸ_`<3Oǰ`Fb"PN{|?}ձuv;pYPm/5OzP/4 b>XmNwFbM8:_&֝܋Kq'#GPh+=p4`n}NljBPlm˷|fFaIY/}d/Xc vFNNaZcwmmT7- Ttᡓ"q&{7Wv#`m&@}.ps玻 )N'JDBϦedMk^29^[ fEΠa٥es3wP%sɪM𖎥pi z !6ۇ~,xkc_huPG! \MnmA~j8Ӕ1ђCVҲ>vܖ^TI#Zǝ 8&t[8qpd*ί 5#,u$UK~ZfYGy9dI*)aZp\D3ddwI;@ 2Fve"r>d{YNw[k~u=r E$5*v l/*ydGQ@;I Z>e"1R>6F'~OՎ&P Oy[!zQ  &ѱn-xCb3+^{gW&bkO~4ȧ xg )d8h;`|Cm_'{..yC vEYkf<7j^pA٥ޣ>^aty*$ͤZh! qDu^m.K2n1t 4v/ppQ?/HQY]\z7xlYDi#nG@_PvwaXi2X W)vw8{Y-&=g~nDȇjL {iOQڭ"vo;)}c5X-hcZsfmi@*<0Ŵd$3tR]*6Ed4v];ZmN͓OGSnAw N6xܲxWSO=&-<}ko{Nt|lr5_z.e'*dj:U~뫚/k_^[?xɷ?u|{/ZmO*|sg^Ѩ.ss(yZ l#jO)D&_%3aEs)|\8)x~Z.W?qeE* EX~g˦=Taw-rۙC1u;$r M$9LR3&!oeLi:!.og\nNoI"Ls ` &ƒUS߇mUa\Tl׾ZþL<%Z`L㊃~JiI՛~ 0&$n?rR:6-<|>fm})|BQDR9R -`2$G(?oW Ҙi'PHX0v>1:F?s|1!.L2鍆Xg]Q{SBLD|B,e+2WAɰwA[a0^Mkz&'&lK/eh A^ Šu 7)A85̫JЌ*XV΄=*kMu:3S]$w^u   *8xc,j'n#(c^Ag׶^߈l礔YEpuWš(TA@Rvc|q~f,"2dʖ$&(BƐ1__<7_6UR4khj턁JY$br5*P|ܚ "Gf:.Zs=k}aK$!lNkCU.+νJٸkz൰ C|T$=~n >.٣1.Gr_YU> #bf_UdWLutg3`l~\Zс;*ݚPeI>tp9)P(mH0f3@؟b]ʦ ӣ1034력i9|p_tȁ^gWݓ (~BRAhl󹝸 ZN^ݸl|vCGjGNR yx ҍ0I0&L ,>`P.ѝzeo\<Uj &!!{ %$D]^9({ _ ˎy(wx1P|rUNNJyTTT'u @Peee LA"?;$Jf: SF_lޣ ֖)!B03vE؊6=iE0#CEU\ Y,nR$l_6OVt=* h:K[O%Gڕmc^ȧ`<| rnl>e,Adr1XȂ j64GX͸n'QBa5tmaմ˙N;Y\S  2o'q cʐlC=%]3oЄj.+_;__6f̿_ZDjdwϾfv%ޙ nS,{g a[ނUe{}3ʿqȐȊDžr>][?~C(2"Oy^{x6\@]CTQo4mB!+Yvb.?T_a/ao27D;)c!%-t!)0[Ɨf8Ng59X nQ㗋I2]AԔ'=Y?$T;dYPg Vͺm.߾Pn ͨ7V_7E{;$:a&c>u\˳0 J f9E$ܝS~m񜟮iͬe:˺}=a}NH^@2gSAB xYɓ^u60)nE>ʈl'Q*o0؀Y yVɠ%VP ? ^B!aZΣfD-Ϻm*)e<.H?QX>A{{1(QEvdZ~u%) ؚ\J bPWE"uƄ1NQ}j{E,(EKwFMl&:X:r5:!:l;G_deʽ+tv]msRLM YA%Wf%cQ$f@7F4B(j3h 'mioO Ԉ`F&UCP__$})pꟇ(NsG ţCeZ:{m/KSiʖF(r0RIu65nf}ɧtC 3=x-1R5@rSYqV0ԉHf?1W6+OE$;ؔl/āF89wixO)Ϳ8o>ox3*΁KuVgBpfh\4M žfRChCrhA rrK`GLrʱJ`wI@cs3C %يŊw`32c MkA%ѤA,*9,MSfJw].3K;F]F}Mi:C:z҆a]n_7"SSb+)O ŁiɰHԮ$AA,g+YDRGsa &Al_T#[e{?vԄk-KaAK#Z/c%vט@D7I$ߊ(8T^\&1WX{&[/.`aن>1iAF ߍ/AQq1`-6^S `,l%(c{8NxNcx˸Ah,xFJ::ߋ.Cx}dYl&Oӯ9Y_A\7~QNܚUX1 xk@:6|a8t#2Q+IԺ[\k 8J8@Ⓝ]rMS9S$Vr\ ,ʏ PH&>vCi߇DH$ͽM)csU 1d#Z+,b^ `E!#gNeM\hQM}mv Y`@=<(8 |VDZ0:h!3mw-C(/G.AE:$dley^~5v7M ݝI:.NHqr`} ewBĝ/ n2, A4zE8LaWQatcB<\)_.XzaaLY ~;j9*I;^z9$ǵ ~(u~WDT`ܮHztݝW4WY0,Jna܁ge)+yOA sz2/^ As{/BIqGX.уG2U<\u!O 29r07e;LeIsO6ܐEs0GF@0kG绾 a'wQbs'tOpTMl FO.+BCsy4@} 2?ra#F[7s4r4KQ U8q?.OM{ob|@S.HfT%X_>wvYvSҲ?S;OVچzpODDK}j)QۂV<@(P;P`Kש-@=BM߹&z^1o}L63>h N2)veM0HyM }Yq17??bYT''U?w@{yl=4}w6⹟8#kgo4 GO cZwJN˭^͹fm'1&<7|e*Baıp T06^݈/7pEɁ&Q{lX:A])sV6: Y&sMZsIӗwHrJPuwq !q3̅;ڐQʡ˓S.^߼G[ϐ(e;q,4[~YxcZӫ(}@BTjcT̥ע|#.0t-{N+aP61E%xNH@$CH3{ZpH0; |EГ/-v!,k =i|&3 U9V ȕx]M禣^~y ZE3~~j\m;qqMRY^n @ |ߦJSyLb'$i 3*#"X"eݝ(m͡>s- /={j݃[}55j7[@sGkK-Xx/|#.ȅj!Ae(* Kb9y64*E'Llޫ'T/F*5v۠iaXW'<,tOdXWf<,qRb_M!I*:Ķ"]^85 ݳ;?H?~`?A1eC':i&zS8XuRIJ߹֊9$S5${0;v"e^U?/(-sBT'TOg>~Zs~j0l%L#^Sf7CJB0,*.A2)йėe#QSyT4n\Lj(6h3F3}#2of"UNm>tcFi\,f ʖ i<ۯΘn,{Thk 4KFOۆ<<'(?iƝaUt9Zm [   ~^qܭˈF꣐EqDط-t]:&yҋhB~Ѡ:1xgMΧp9&E݈?kel8/Փxs;f_֞%>FV_)/6G  9%RrqqwZzyX7<@_La EEYd~Be6O!(0 X ~ʌi2DK&en_2PzC,7^X,8*^zp@^J>OM:bg>ÆCQ@Gh|m]1q1.RH̄F򴰡5b*fzf*KO'+~Jx+nh+v{dΜx[e@S4P8L= ѼhJ:f;sיaA Vz,Qad8ܨ-6如*[ Np]2q V-Ө9~~+S0,I32҈ܖ;k9p;(֔ggII-&'/f\ 8BY_R;$.::2s7 QZfD;spL AF#rtLdݎniOS?Vb.i!=^DW;&]6'Ή6T`庹!V\IqL/Hļy[ [90RS8Ր|NYp~܋PM8{[9gc#ewv gxH/2;PhnKI\7qZ6YuVfh8jNDTv_kSj5b<.G`uKY:ǁ0vi%)9]P cz}p18{ד|ҷ@ۭ13X1kI\xwE~#5Y1{d_#C %g wf)t=%Epa)#ҏp@ۘv*7.AٺPm%OV" 9Ӭ!C}g`QJStgr_3'$?vMvn 9H!H3VuO-SCH;V@Yg.& !0g1~]*Z?v k]sW) ˃uQh}@iMg;+Z ,Cl 1[WQ/eݡ.E?ÑGwbAeY\f7>z|K\I9\11JWRK֮i!V}1oVa-AsfjN^Zv hw\02r%l͵iYsՌ+_1\:?Z״ӨuTOzJ6Do;b"{LhA icvr.XZ9=.OVwtEl0P8{pKy7u\Ҙ/m@Dind2ê﹌"h 7`Z[XSg }t'(H$ُMU=QKV?]-S_ Hzgw\\hIvNNs3KAR>1%Y:I~Sz- >%5t'u B ΃p2a loYLPޙ$mѰϤ&fhcmB*3|F!="=]͈F~;ԞaD,|#U!~6"x1) 5S4UJ(4?XjZU<Ayz :dp?#熕mR cMߤYp[i@T,٠VѐOq[e]} ڹ\|tٚN83ވ+Y!>m;HB& N[FTn`fعUSmc۪"z lr7KqCRֲ]g3q sϙ.K!TgfM:5l$vlw P3Z9c ! сh8 ˬKyc iX>.F/jFhӞO䚬X Mu # t+3 FF~_/x4ta.­8^x?9rbۈyI (}w?S^Ygu!V}3"_ 6{f5ioz+ay/90,jm!`0bi5F-;ON$nIi0'y/҃8Y:2ob 5h%OE-n^vM'ޗj"TN{͙ 8mdCi'Ip7:wUղ.kASͿ~i" ~])W}-'~Ry%72%κ쇗h@j- "$u#O0 oY>= 9Q# UqW&)Wl#`gyٟxc4]vP1[Y.豀lP1NMP *vg'ӻ;3rMs3G_ʔn)$hR8gɵ~4X$/cgEՁu.<qt&MJ@=!TkzA* e@3yihG$YU@cw%eVSc>%hk:=5.,i:˦ k;<=nb)fI( @ h N2c5'KÇ3lX4S2f=)T̨ܠ_I%پr'.<(" =Rԧ3~Rc>g>tPLAsg }k9s]mT]r8Py-벴V%ћOAgI.c٬Ep2sP `{-#]۞SI!{J4'22J#D'N0}Ac}S0Ռ7a |v6C< 43Q- CtfaY#?\8s-hsQ;aI{fC \OvRbcZSiG,NxLd]ڛj:i/<""lh`jF1S!ǔ!h%ML^^jC4cK]E,x SY&Y?}}}aC.;9\bb%UB":K~] D 0oݼ큏̀u VA ƼAQ&l c&2{ϴV_?{_{~M6DYh=c 2}ZGᬽN1\QSDhΙv*[BWY72YN4i"lPiuF63MN.F5M6pH[T. {ݻ<*.nqLbf>K]CϢ8Wˏg[ՈPA?:?5X|IkA7yP_?" Y GF>ݰi>w_UJ *lyRP+!c}Uj6+NR`>^1z!yI-_2l}u.l宅mGe15pSfV܇cb&J)'ʺcmhx!-Q1ep)P4 ʳ#ϳWܷF~ N~:d.ډ!Fngz;O3MZCT~lW~jaBq䈫~޾33gf{ 3]!ømhxwNv7-2 ғ~ޔ#vIgf\/i35I7{Vc&U&h[Y^. =L7R^0q+{Vԅr3vYy\j Y8F/=!|j0>ue/}m$Q[sM%ih&# ؄pqm)(4=ȍdc,LY}eKEH"3+90uJT`C Q0G|J8#A-?ӡ`|W3C#a9aQC*^ X\jl\`6մ~A>íjdWu"ØtPWR|?G); j 1W?s >Lt,,S8y( ZN p9@'bBf8MQ)#lOM{j/jʣ2i w^gō\=Y~d=xh gۦ2 kˢԠB@T]lAS\yj.n>y:Jemj\T5*dNM1h}$g>*ms!,U˗7wz/K嵐4'[Ljk4D T7. ͔UI}L |'}]S4k )a~#tImLr} QA Ni(?CrW/e֓g,Ɲ;Ax0'=uCQN|y5bG;;<] Ԝ\F1N6(q`}!3i"Ωk'o  }ƒ9FL,a!N^e>yͨ}*g.Q/*9q8TځWЂBfbZo4c 7V{ );0yPY}a}= fc Hg4g6eݤ){2.[ U#eKC[ImoI3QE1yC,F;CUAUqof![@*{s \;|ba0Nk+T!-p]0 뷧f 0 v?Dpɕԫe Q.Uz,JAD/O^SINNvz6PaR zQ-ޙ{ pYZJ0}%F^tqGDqq,&\Mdؕnz21a0 #ozS 7M` H|v p#{wSґ1 mv{7Ͷ\l?_gN _'zFixSLI6[TkoݭG`o8qq%oV؇Ru5FB+l}VSqlu`c[E $Gn|g>9ws|kY fى ]PKM)"M5*οeFݕ^]䰑xC^u@ QG8fs`v~DDA͞j=馯9ܼ3%@q&ʛݍa(/q@A MS._; ݄˘83#[#{8n} 1ZMeaZ%/P6A?eKj3Hر%vXkL৮ƭȆ a)&qe+>'RCl[Z  g.: 8uHT:7$ľMnu78~ ]4=O.Ll25`EE_(aO\f!@'UħD0)"OziYק\' )ͨDrMvwЉ1g4o2[Qκn1{x9̆20UNSR0Zqvq,79w™|Q{'{*sD0e\Ϛ6ИApL[] 'CEC|iCv`H3oc/Ba6oF;jeC˾\p%[ J4fNi^n{Pd ̱gUi#3P@T9]j@(SyPexr}e@mA iIpc$D2w+Xh曯QWvRq Q7mt5T݈mjO.tڰth i]͚Nڛbc\9`$wsrAAY&\/ÆA "E6f1̣ޙ얃B 2'ar&a<\O she X]CiKn%^p͇+E@匠ie/4$~ߨKgC3/<'Dts@&FIS%F:X6@xyѦ'զ7}*\;Xē &?" a YXHJԿG< Uv޺ UP)!O Pv3n I.Q}`JQc\W ?x hk &#wF`55 1B3K֝ = l@|)HD>:&p #ot# I+LTws[Vk' QDfM Q@ݠܒ~.xVtd;yX}zVB60W^' jdz\/ʟC AԈ KZ*߯3DPp۞jRT`搏݅x}:) WRJ8 $b6~,O{;FkBYlh;r~Nkæw(a;pzS\3p Mt7Q[`  YÍnq kj Zp)*'\[Om~gF;n 9!*.ڳ?ɿo1[ب!C2~f\C՝E߶B9e!ǂ`@ 9}XGu?`u7\`v{zoy@Or P`I NL6W^^bVq+Oo9ISdE'/xr7,MB{(@0R%TJR-J%rQJYRfeT^\?#~fRDIYиc  f, = 4LaLwfզfww{G* ){~g@:BHy[ YPY,Jhʗ˺268 \3yíW>0lmUNvۊdpV!I%-y5F?ix͉Lq <3Ff\7 ̞iRe17ADrƅB)IMU|64 VwxyP֗Q}/ -LPBN)3U=Ľ1ćI蠿,.+pI`&Aյ;HJRët8]h)8—sfRs#>)7$rżC$~Y}|qLurN FB`*W.o| 8ra} ![4*!}\y;-+Jp(͗p4tv>qwZ.tєKo^у nex.x##YNmq]yK'=GHS{4zō]a2X@ 3KRj}rM_?^zl*n7F+oA9P\_JNKC=ix  'J~n 2V݆= Yi(bCj'-ȷ0Zy }ӾB5qHl#љI~z̊uY#YlӴcln G`H|1&+$#YSW* lPFbT:1anv Ć?3i'!*:vƭEwޒ]cAFp ~%^g,2#_Q i H,bb Ihc`<[Eu- )("ݨm8)5!]=f-<7ꭧŃ͚]7 &D\uJZr!ޡ7Ⱦ 6pػ VȱD,җtr.'HxvIͻ1+ DƋ~GNdiٖK1 jVYD&Qj):3ja`(97NP0dgp :JfU5cq tMB"5Yגv۝;9wFǯl@U}O]ބ}FH !$[[c{!6bC0h,"r$85 OG/(W χ-6-|wы+ȐD m +gd1A jrMSRtd+!WFo@q"ה{'| )G5JPxBh\E/+1[/5)R"vH]`6_?7/;+6l]!0m$v9ڌ=<r*8h;*vf^Ը 4 s,P:^Cț.O^:NtU-cuO8'Fy\Ha;.~YL3[iy/:فhS$ M+]B?l &t[}9YJJU`[7aAD IyIڥSب%0 LhMN@826~ 'RABT5C$*|GXoArdΥ6_^ Tq?wBVf8fTKSrVNgp<+ŪRm?+9a ZipaϢGc)Df0v`լuJ1 I'4Nh??p*Zҩ{+BZ 4^فM#-b:@Ď+O).U[A7M<_~?׿N,PL,?z}CK.{>cs߇͌sH>N c51Ve$(u@Codp!^9rjsד-'_:a3Fi.4BIS ww od' M25VX՜.CpZ:tigPf\asH)jHX@>̻Q2akwQ탙䵕yBJ.{|W#بPF%9;ڮwL`?Ͽav f$ri? ȹƵˋ5|܀ VlSuJ_V1j4t9GˁJ>N=`sH=vV) {b1ɱ"n?]v L2-,rqxKGHs rv"6˳Yn\xïK&//HFd^Fr;S)UJXQbw+`JL>VSrC7 yAؗYHvQQZWb6VW,_/ā % ֬.:E|^,7ԴX.h8grN"1m7Tۛl΃ gqǀPhfJv^o@(asv[0xt'AޏvwlCzc=FiTuM _Q.N5טp- G\셩L6XgW( 4zLܴsx8W5s@!Ɣ@'+:ةSt(bq.8v^c7#9׏KH˪jh)%ogEm]'혰zS c2ІTõ*w|Ck#? >lĞPfrnk%mMw@&d%ݺ_B=i<]s^ƹ#p vb/G/\  t^&0i2?H25Ӂ+NIΚj92+!^;oOFʩ!-`{GI\Gb4!Nb!ğ}ByW6fvh{tx3C݅H?>^OwV0Hck^mE+&ݬz%,һS(cxݨܐ$F Pn!KˣzS{Ozuu0(B+$71$&YSLgǃBg1V !%Kn\Wj =Î7ؒ^Hxxi\!v)VW7Ë sZ50aѳ8S`zwUKUV\8fH-M88 +FG;め/a )0£2b/lXp~Tl4u$栃yK/du$Y<]T=Y8?ôޔ@u{ )V0v.d k'Ht|>>0Xc X,I!I+Lw[9 r%Ǥ ='ے7YbDVXuD- g9Me%uC)&A r\K^a}99u׭̃ wS }"Ñ+HeS)4EfA.x:]b2#5~X"L}Xرw"/\'h-o6j'nPO|zQ44 +Ί!tC⢡S"a)ҰYOWvƒ5o]j"QF @eչ9OY8gAWzٚi:'1/kjac@8`.c~$d)Ð[fQI+#2uLE42SC3::P&:.4DB9( >a܂è_QZԤe_ɔFq߃ F cd T nu@'گ-f_Fʂ'Zߝ!M^"4x0$ RU_ɂ4c:vN|U}W)ӱ}:¯[|=#@o4E!fҲvB=;(Z3]VP-Dkz%5j]%ۇtRC -'֑_:߁_H%BK{%~ +GDʗ RFVʐܧ0]wTt\w0]J4K XQM^T0),YHM}&``q0Ka*L<s]+"mV^ϻR\NQ4_^Oj{\Lƺ& _uxHy>h5}d%m$R:v<7vj yQ5CXs2q}M˺ [j%q_PZ4TT#ް$L$0ӗDůԷ 2RZj[(q9ҕ|庲6YHoBLzzd!hLeu홰C9EEJ=tM~o7bJK`0ɢ8jrIMF yl ED-|ڂ'wHy(hcHi\]j܈>2iWO5bb_rJ:(6giňT_Ozz ln>^>k-ǰ'bg ;a &Q5u[9tl ;ǣ)qFdl6'2l(j! ٰv1K9! $ lU-8#nɋVilx,"l`#I{ĨIQ>V|@rLZ1u  ˜!=z̢F?7VgA"hU#> |D S8S "ޠ O yڣC143p~H˅Tlj[Yc?$$no鼠zk_`ecP+2}uyq9 cT:)q¾#KM*֠ÀfP"Q쳅m{_Y[T tS~P|T'a+T @%A'0_!˶JuD/&8O"Zը+7 GɇBIcZXCt-kn5) QP= G/[Icݼ0e% py ܶ֡KTAPڳSSON5NAF9Yؖc~eh>]@ NvV3 hq=L ѧr&GV&U<+kQϥe|`v v9@]ӹ: AG=s=]1%#8)k갣O~@hO#ˣ{դS~( \m t2iHcFıtc󂲬]̈́QɹQpu`kg4G\ #^qd*6[M(zRZLç}nBw[U_xf[5٧}Na>>ʹi^JdǽRlU'Ѩ❶ǧsвmCW$HC' `)wNw64@&Xa%~UR;I !~b<: .\(IĂ42sT0T/KUyoYK[~! !=K8\qu.w[OVJLf^tD\Pl$EkHNRԌbq[gZ0Hf&XauV!Á2tZr$L\rJ~DvalZ\< ==v:ŗ=(^:vԋ k1no :+;1u4p}G4Mv|~4Xu"50걡93&V8;$+VIjuk1kEiM;/kDCR-!ZBf=@&AkkoMoz#/Z) #'2l!hH:Ħ"&ڜ+HG%?1pb\D`vf̽Y^<}ňdp̖66EV a Z'zw Yd:TϾTvfJ'*m~D Q`k.Jg/oV9ʷYGx!_UƏ'܂/=Ui9mc SʉGb\q,v1P6ht>JHWF]t# yT> K?\WcOf-J˚s-gM(; {KYfRMIeܚ6hp7.A%LL*¿,Q]6#CX qku;H1/+m}1CtDjmOh@6a?o83>_:)UwO1vaZ0>v{7{"՛jg*#\SLUiCQVOI71lbhj<>CZ X[49@7 -8j/R8Cy4P@7<q0/f-΅V$oNn9v|{CQbA:?q rRS$?p\q,R1oH%Q63w#~rh+։'w1\C ly/mZMlh}0c #G]Qvt oFq'&өr@c,`r`\'Xp rI6&Kdш ~ L[1%hbm5:5F hh|t:J/%ۻ3' JPn, G}HCGѹ$殱JNl tEQT I;I/t[4pوxwx7f<^y@@^JK7qlT0޺G-.5Ɋ0=}?exFD;@0L\TQHt]:]8YsjٔgݨdֺKYpk#-t}6lTT6JgM7Uq&k pɐbjė SvJ?W.?M[NO b/#}ɼk&a4.wZdM4ґBml69~п|})Sh4ĐoZ(5TN€>%>@TQ-+cf+@'PW׈rXr}\#>>G*Р桧A=> \Q bs +p "?Ѱe "WCia T^,[UA>/C5`{nG4FMNIdAC1s-Q[=t^>'PV3F uЋ$`d#k]ϫ5̪rkW磖L9Ɗ29<r>q+m-ӹZ`rߩ?5?ݾ Wm1C- Ց!Q+KW6RpS \~x<`3xر}!*,f.ZպjV;Bt5߶&Ċ&tq=]%S(F onBOc_$-Ek *W4Et<[XKk67;P0ݫhBS3s@-z K'6|VKίGa{Tx.=^ iYM+AƤϺаcTNBQ້.YQ< B"o uEK&C"F[ / /B8é @tG&-q c5u,x}΋R mC{(DP^|RD&(|bRlA[ GɿY>d9`ى L#|Blۧki\-y2jCJ)n☮ϋ}֣0"VŨ\]tG-kȌLulKa0A jb3vzwxLey}U2þ~kQ窟<g-C}.,7'P-^bEBWIp u 62q9pJHiYF\Ѽ񒞍Gېaş{*w4>:WMPBt>yRdEQ y@D 8={8."S Z4BDHuС@Lx#=ш4"1*HXૠ A;>-gBōO^CUa-˦UPqb4n8/xp0neb!2"=~b;ub zC0vR_vچS];d+}:z;ޥ-5 ؄hSrmi\OEVrEONNhHҨZ1sU$ ;1٫rgɃxŭA9  VRT)k5Хlu=}Oܝ៷D|Ā72u?nt(rF#~#JzSW,Q|\ Z Hh%Z_)2[قpCBIҬ p?@4Ď%'+fN~=VmUkX ,y[uiY냆!{Dvzg [o=9m|w"]Aȭ'_,2G@&lL<`7W\6_Ji z8B g+B ӅhOq_jlMi |9=1)llo6 ayX(zT(i;lo䃴O^쾐_(iv-k un_zp`(GfI5x܏c5]"PKSWNOa>@I݌p[tv6=Q6!GB Ct7˪nt5|cmsan89E!M ɂ!=v o9ȪHQ5YB-u8`8lVԪגּʂ*{Ȉ:sC $ U[ꐭ~w=T]' A'!^NI'FUaT@ҫ+yJI`n>PalKEi]^ld 垽&L 6}V?|x >G/}oz=>z+?/>'ϛ*,iF*_!tٙvW* a~ƹ?Ck(ү@C~Ok8*y~O]-O& q{ @Ǵ]M|ĩP+j>="\Bu{\ec&j9nxoT? A<6 BT9!*T;q M~tIæ?% YX(-2 _:Weo 4_7Uɔ[z5t(C"sP>MjIXPh-;BDv$e"t1Ox,;vw!Dr6c p v˩FuЖMpcWNk^?(^ ?>`=q^{1 \cBԢmUnIv2b2`V{RH%Bj&|(>X~oFJ}DRKigYJ> g4Q}׀ӫ-^dRuu4.Z}>pde }"Lp;≗ dۀn NWrqv@2K5D4,ψS߼KȡO_:Ew/Zlj`uA+I:=. V׀[$j2=L7=<*U0@(v a-0-gVGu] 513<9­CjeQ5,l;M64BP[1s)$tYC(h&I Ct}$ w;!9/EuE "8j٠iyaqeO2Q ᑉioַ$G~CVLrR$'^ֵi:蔐kq1eC4HĒXG0tpiQ[]{Yc#﬎Vu3Ern F |K1/;sB!:zk :l_"6 aG1 ݡ4)&S.!-3,C9|% ްű0%;2ĥpm`/,}wxcW/۞D0YG = Qκ#8&W_YX[)i Boynk')ni "wtԈPN%[7c}wY|0RB*79j:n/F5T® `x Ff"6\ƜdjZ !ޒ HAӄ$]#*&84s7,vi&&乀a=t=inƿߋxBeb,%}%}d5)8ظ) Jޛ)J >Y5E8GД~!~KF߲m~ є|)(=̮.| ' 3MBQ}7cOX&fxM)X`S`;ºhq>9qVs*.cu, Asr5lx4;zԝ# O,N}Ч)~a?+DJѨm d^|q*].ۿY^=r»zye~G w7(Ow*z4֎PyHQs"Y?kˑ8lznE~BV*w+5=#_`ǏN H5 +Պ!?/ɇ>{g{#AN/ Th>2G0c/֎>ՒАzuOs-yZMt:IJ[ rLB-)=g  w8r>u/UƷ?1I18c̫߁v##1$G(-nS;s7#VR@/1]zncB`py`E69!A PEe}PADa/+ pQ&#V_jg/4z}T{IJwkKr.sǩ-RԖY?Γÿ/;#)-tT$5[ 8(uD8aRpWRG>oyy3-{=3k+y/oYZKb?!&XA7i QcɌ;aM^q0Am -ZsL(tZQ zxG1>{z{ _u,8JAAwP9 Ag:tޏtPQ?<jh5԰냑I{?*D3YF t]7TjOARƿrM_;=qtx eExϵ$ l'äM# d${qӾu7>& ̷;~PJ eӞ%zHb-ylPn>@-!]Mټ܀IS"*+._R.F`rPBEKiBPYI]# b$졶Ykׁ#R&3gP1pXRL$$V0( '(Sё_jшѶ]qá&9j`9%ȩ>gOafD=r;؁0vOzH)@lp>ܴVW\ o_8(GO,N@%7v*cG8'F%; J`# $wq+e-.*TLߥX4c=Or\svYWԅ^*cxR@60˾M9_ohcf3/իd). &?@t7|vr@{/$Tv$)vǭ3Z@?v0u?(`t(jV9S-~ĢRS #IM%><%Gwj*Q٪?)R+(9 Bmg | KƱj!v|cѹJ|f.`њJtI8u7o;=S7*zUķP@,[tFgA;^HAX1uݸK[:뻈I'xFԉ\1RAҌ,L: e4[ +[SHXUG2K8Y уvI??34mqI˄[eq@,i9B pA:]d̻wɁ44/"rbV%瞉.؂@φ%)~E5V?LG97jJy/ʙ n=]jf !j"n4Jw=gXgS^ȺSf0POM_ZK[BCB%~(G!IY]|@^Z{<,E?R(h(b!5V+ߤ_y㮚7)+5_7kf083i|㰊7+u6,y㖵o:ŝF;@\*&iBEB`}<-Ay3p .,7G=mذE+I$0'PtH*Hj*8ل~^uzs]Rce>Gï( @9B!CkJ,VvK tͨ R"1O!cg: 7;UF Ԇ_@"=pNLY ,$ [Z?b[>d7zl!=V+$LtrgT]kK oFw;8ΕMAs][o/oyx/gk @5:31+XzJK ƃGlzQZ}h̡ ~Ka:W1Vys|d~6gSno"׊ u,(/zdwhL ٴY@r;#*&'7o S9TyoS հ4CA@^0ҸTT /["5 ӣ=@1pRt} Z%zkMwP:HvAښڌKo҇~HՋw_xRWj2w:!ߤxCJph^Ƽ|SW~GzxޛSL| @߰nOC?)ޮFXxhHzxd\^u($Е埌1!?(3D,&p*PK rZ4߭ )L\K%!Dmڎ /j^p:pk<Lq9jhߞV s] {1:&{xKM)ߪ:$lQVf+%0,3aGHn X8Ş !A&[tyĄRE!3WB! =llU(R{B"&0자M+> W[FCÓW8oHԆvOMBu$BƲ׌%6L|k{GaX@ilh8;-ɸ) n&9jDv"ybuvXsnChvHbqPPL`5(n_{(xݕak<3{_5Խ!F#;}ܾ _J@3Jӵ?oJs#O:^PFbiw_%ѾK'6>Zݲϐl59(oSV]pw e=,J)9hFUM,E *݈ݴ8B+s󞚞 ̱h+6="7%dQ$G=Xex +;hSbBKfcE9u&`o2]L@/|F}}#s9xL'1JS#?cvpnvώ~!J3'ODdypq?zÀ.}{ )L9"l$D a҆Z[ױX|P S[7cx7v[ p,NC6,@8=NL#Bקuḓ*Mz4=ܝ4*V0p :?Fy)+f6@}Xq$;M >&2m嫎U`H - Ƚ=JUvz?q6](/uG?A`=bQޯmb p>x Q 2bV~ ڷA. τTnsB~hp<ĤMr`;Dza$\9UQ~!f AU=(z3~uȎsǤ;d0/ Uo f89n@1N $re2Q$EIsJ~JڊCO޴hq@Z R9`nX譴p ?\=6c[?\B|\ ƌn#ሩ Xp1z㐎ϛ#o i |9m\/7/t(0pA @|d>-aD dw"@d [ujGInIB5@Tq= ~т55 &CNȝ%RoUݨM'Sa;y:iO(=孬gAR4hseZ~ u!YXD@{*@2, f}*??ѫҤbV2/z,(-gҼFԚ}r0F*Jq b;pdF 1Ѹ^90vjdIN.hsO5DjNֵS;^mjO]li-U96+aj|MĹ&^e@ mb~[_r"q0|D_#&]-qO~H -6^H%?M dMPv.]4.TrI:f(d[_Lq1PE͖կײCkg64CTA*؅rL!!m=(@w^Y򁤎hph&8QHmO;BϹm 2bxg{&h ӘP␖d[-v~C1(Z@#?/y8.u [C%$G}5=`+hYNU9r}D؂j.Z͠4f̣ؕކ|/V[ZLP%,iȦ]!t(w Uyka6A;[o4ڶbrix.:QO4N4mRmī\8OQڨUC ǴHመwjG-cQ, A q=CULuV tW=潾n[Vw *p<kٺ )l;cNbdaB`>Zz访/=*-={M `T[ޭ iQ|~ZVQ'+{>/~گR ^Ti֗ jM6Pa!hutߘ caMSІ~+PC4I&f*w΀bGUlo#7]&=w!| PݖO݇oBP\[`#S3[u'#K \CԬZrxR nx+O=; VUuT!͛; r̂ԞڅIx-`m-T/OWc xS[k{TIfp蜵 j%`>䩎xL m}^~1a=PH %86>m/=b ᘭkYK0?VEY1 vf.Ŵ۫9ZEqF!<Wj N"2n1Y2,k=1BvR2>On?] e"J?/SDJMz?0Euo r{c;1wE2qPbP5kkbԒ±IjC(/?;?˓W?_ʛ ~?mo^巼3_gҠ[6\A it9r;kY5e Wm&|~Ə1 s2΃5 9ERd-pw4b3N@33spd)t74^NMh6ɶF}$fv%hRѣtP]*YwϴGȺ!4[P.@`U/,2^BEP pe`o",VݘTXA[4SrP2&ch?౗+Q ){ Ý\qUm蠸V DoHɥNBTU5fOTGWo'MGK>Vwĭ蹆!KVW/Žz@dBo}WA{JyTU#!:T<<6ا0'S[G| 6@ |*6!7BX(LIx쵓MGRP8P~N.å/jJ鶴Թ q=!iE׮ GWcxx.Үg+9L\C@O#;7_0ɻᇗ2` [ **\trmtX)e~- ޿j'zm'^ X0$|) g n(^7ݎ'^o64'&^65'gj1:"oDkp6l8!F32l9,`6sG|cǬb͇_-Y$JS{o|@N7C+U*?m5z-A$E ^nv#r!٦\UxXnW퇆˷Y"myU"}Jaȵ+DVXq{!{F̣ Б/u?eQ@ /zǹ S.gp(xZU'HX'~x'!x!{aN#)d++}%1OT]@Z   s.jV[Q> ^iŹJ`v[a ., !Y"5ܛy}&g(vZr0B="1FMz@r"ڠqdR mJZ̰w3L[k{1J#~RpZ, Z=d4Gkc{*c *lߟ 4ܗeQ5!-vRLMïG >Gƭ/f7dMz5Uϖ *P(<LR?ȻΣAphh:niJUJD qR8x*>>)Lvz"k^Kd b'G=d9x 'iVvFZIc͆]vbmoe\O֖ǵr<0Qb '_62w<*{FxCF&38/! kX֥8)l]TMefr4(CVx4f"<L̮ z_K$ƺC,3tiН, YݾzAh 5Z]])oܸL#,ˑ3ζ<mk ȝވ/>NuKƪmFwpa(}Yc?k޹؎ѐEX(Vl4#\ C#6nvmSϝU.6t1mkcj9c|E B`!⚭vCO3, y!: Z?r$.N]0:mx! Ȭz%71({rt]q !wM| &஽!YJW{1eFdϳ.{93j3@z^(.S㭠~^J"e+1fAgVEnVlD{(ZԨA|jz&pʍ+ WބXDOgVBΒFtN&Tҕ[ɯYtb3oVsKE_qS;.tݙ,˴%ˋ/e 0'vHb<5)JB~Vo-I>{iBVB&.D;ɧ@i%XMu;zZt^/$ݾ#Zo 9R&]찔r,(^mO ɦoFr5q !^Mn̹Be˺0jd>p%x#@nǂ(R[Gi&Pᣏ1o!im|Vy O/<ݿ$+Fhv S{P8!R)mZR0:2w>D0}&R}ClZ\j0J1"FdΕtn=J&jN)]v)ƬɎAt)X{u4-UY!?hw8JC,ٵX@f3-n~<~ss٧5PUQgC k+fk۳>T,[}BdVb=5`ip6 9Nmu4%UćvqNJJQh0X5`[3X0'l>Ә gFr[uvT1a+1Oϖ<aG^%9L:Ե+<'fNެQ3]`gC%NNkKp@XcS)Kɴtf-ZDyeJx&1}Qտ!~C>HзՙSp_wxazk"Q#b `>?$X3o3>'zҙ,!}6bA` !4wP"}@7/F~D=!MQ}X/bl뽴p h ͽ(~z6޶/ocdMFH>/w^JU^O!w$4#_?vxw%55 -q|T֌<言T$.]E6N.ฎZN G}$"V|[ɕ~7~c WmwÍ᭿ 5{~!OJ0u Ϳ{̉Ҥ7vtH mEZw֫(Ũ),WӴR92dv;z3c*I7.UP,qZ.<ssi?ҩL;(]U3#+UJb t< +`CON P&8"%H]ҬysgŗT]k؟<5Xg6 1$VҾ=d]" /*/;2]<;OփC]F#6Y2e< Nt2f Ӭڧ`zj( h !Esp*8=S/Һ!<,d7CbMZG$uYl"PGɅDfd!c #^0C 1̆# qK8("{>tmʐo:zO%{V!Hn4sa.-L4 -&̎NM8^_'X }Bxh§L)dwrM/3۵V^#]]KHd7J5qo_V# D:c*Hmyvz!%#0{ءpZxXMϸ|'z""%Uy/jw﷽ %,^Mnpo{Qز'7ZJ;i]'EӚ5߰_,B'j;޶rT!نn,u:ZoIk/G|ɋZ!m_sxjSTd_o([V/3a:j BBE;&qU'|B@ *%@~yީ3gꏧ~K@nL1BF =/yN 'BAbB~hTXb) &Qo@Ͼ@􎒬M N"mdq`%F HҋƕhIȒLeWw/xYI#Y-T~Y#%p } 8DSwSȪͱǓĻ̒.$$K+^S6z(At66%zVK^K_ NJ, fVfWȴc~DGI #G?ŁiO.OCۣ@ tdE!2p23|9ß^~ȼ[Fs,{-ZQ^erM997zxȡX ARyLংuqV!.v x:zVY orқH k e<0$AhL($O֔]Tw24w`ly e0${2REc;Iۈ\$3ד"0#@d}cF rҘ=U|a>Inwq<оW7BNpM¬l&`[!P[V/tco1ڄDnᮎY?ߛIZ3j' OsaydvOykȵhڴKDZ#I3گnmalu%D}Qgksiv- lXoGK!a(I Su5mYѮVB$vHÇ̤G0T]}'#8),85rmV.PDQa#lvnm /iۋo8⥄!JwT$o=#$9n{>o ۓlWMeApy:Zoأ&L>/T! SQrV/⨂<6dϾr>z\">Hi9X5weFxo Q dG&gƽH{`e1_Bm0m럠5 {([aV-}Bow |s&6$yP+',ׅSRBu(!LLô{`=(v<'!pv̟cL ^`ϳwYo:x,3la ?lpѲYSX1TKA?'b)>ej-\0mp _1X7IK4oqX !j8l(u76׌^r΋a ]v ,a.d7iᝌ<6$˩r`DG)0 DCY2Bʍ(*7 /j$g*0kOஂPް< sKsT JƹZPj Pдo0\W f$cDOQqGb^."J~&&x3L4Gw5JFqc`AW:+>ӈW\ÂK |P Yrw4{L+=]nH/k^@Gg]l ͤ-r3 Y;8Wl*8h'|~F lVmKpz:u)Hgmg]yD-ȞH"ЉԈq~_-W3 tI1|VQ 8)؆ϟo^>)CX"k;two98#aMsx=--}SPh \>^UDerAi,Ȃ\rNEG, qLlĘ/?hۏRD@3J6 ٰ!5ѵIu"ϲz Xs}V} mdIfASF'dWIC&G+(~w/,20F̦ZM(px@[p/=DTu!Y>'pįI(FA@\X{p UZmdž_b^aa`>苦 K2{͝߉ydOو!dzj(jE9ɡGk>/hZl,KBIqd3LDʭ-OG=JҬVf 's86yh$h{Al}_r qH pw]22:*;Xj3eXRh칅,H5.15Zs-@ke1wB(s\3a4u2sCuk\=YC}Wn< #6`D'㸨;m7Ficʸ4D zIYӨrC9tvJ}2($*"͕fK"wۍxL's5@sŖo Ifr keΕܭS "`!Cտo;Eׇ|=~o5Kdwx7!g}>ôJ'!$ۏaUkOf/?`A8&bVH0(.5r2<ݰKso/▄a/5C-c.˨r M4a!i t8;ȦIn@N7_+9\Xt4#nha Zd5r2@\O868h.rp 9ȡzEP 4YR1h0.r/ih&ߐktb}jX(2;=^IJ;SeW-iB4@}!ht6 ]R},|蜲"gۖP@фy{wI/~fboh Bsa;+UꞐx^}'9bGQ{H hŦA 2mUl~^U>} !N@\3:j9n~-Nu}3M۵}6_8R"&_o7*E/rhL \V{Tb:-P{ѩ鸝m˽SQDs1sݸFVζ8b{բQ#^/21 2/G([ qޖ!X\ ح *ǤTS.*k 2:6n( [Lm_) nDr3s<ꍸ؅F3RM0R%߰3,FoX>62Fk s@l +彎ת h?9F^+9PBCWb(Ÿr/dP,MQ{&/cSܣ-/Fzuȸaf4~1H~džж\cIX %p5,BlPh)!SZ;R'?絘ț ꮻ Xvnt?paa8kˡ-W/W`_n(sleBS6z\ԬW9DE hM \"#n5wlx Yp5ow ,[l /wsލj8^*wi N H S|;z}}#/rL S?z|XkY:Q5lT1a7 (6c{9,xrZ'}H P /j[ڬ$7C=h7z%;._/ Kf3Ti';O]Hv[P{BA#8|M0o Sc'G Z!hp;$&9ڴm'l7>Œd K<%>Ѷa)((97"0!Nņv1*|H%9l]13ظn:&`pBY @4DK^k׾{&_+ywgϼS߼ O}O}Kw{寧k?/^oPCo|5f2N{@> BWanZ^"YKx!W~v;Wj1ש {܃ۮ6J(,.M'bjXdJʠt~ɤaA9Ӭhl$7$_>b 3Ew6csZԘqa~ j_N͚h3UA|M 'Ƴk&L[2t~bWwcʅe8-Z˔ȼY^b\DED`J˦6ܐx $ASuAߔ)G][rKݤg,s&K(rȮ ?w]?7IIbXUN]VaKֽ$1ëb\C%#h{|D!WIdR@]К?? S)78G~2;fZEE+KvAbIcζ:(0c]rRj;/}f(zl('wGoL[-|(lCv~$+^U.KHaq|h7 ?OF&aBL <4.d.B{uj-Y-Q\ qxޏk!=6l.)M+~:쿆Kfε= FPՏC\RP ٗGRU~+N` V~g.P papZ7`X1,gUgEI} 9PM v0 e3I 2%V\iySS1v>B Hoۚw:A>H'4H#%: vULw\(hj]I)@"S0g["R0u< A{@(yhbz:ēX#{R|߅zg#νԙ>&9>;oEvGJ>ݦBvbab&>j2ǀgAPhvih :zӂ="C/>X˖1aQîؐ& ; "u0pBc(0}Mc:H1 )9^Z#m۝zk6g "|12ny,oV\SB,iO;=f. 4ܞӤ1-94^*ёH(,|b!fNd0YuH^B8T+m@ |'-vU ǽҷ➲"ϵ.9(BeWqoi0}W̙὿o-R!YT@߅T2C*{l>9!FP%F 0î*@ AT*Np*lH|~>ՙY'qD)-5*6u2"0#^ $Bfc-H]렪x,;Á(C(FP6Ұ<1V6T%֜+dC<ۉH[`jqO]uG~<YR*{AHݢȔCV7} t &yx?Y4=CobYpVm)AiS mKXɒuP bvnF. ^M02'=$/a!24QڰfI% hZbU$Ҳ~+<BgnP'~EVm^)ޮ|rmuey?[svG񛪶#[>о}jxV^tQyPp\ |Q8CROtGy_97 HYh)7M)@`( ^d3vDV;*\ >᱋8Z僋, j!qCeD/5y^^tPDPNҏw,LZ7MÔ ˸i?-)v 0i0$d!!uҚR$T6QtriO Y"./~ ,;# (?:#puWDK -&&l[| dNu1 =%aWX5]KWkk>ἷOHaYy!!a$]B3i`WFܕ.1ƜhU{1iE?OS,t- -@Le3R`(%ާ%މr_/`Z7j4+efgN"Ǡ&38IcRokHS)&E0IanBkr庶[Naʨl`V8L zS9R G*!u7u>XXHe^96Ar=;ږK2WiQJ)tj8~|==Z/b/I\2$(l $Gr xÞ5>m,6= mKl9dr}o6Wƶc 愓t=4-ZJ_pÇbF026mqigڂi={y).Mqk!)!Y GX:Ln)kx6b>(mդEeʏxa+İŹ{AܰD^"IKKc(TqN0 눞ElǏҜ"TpEqqXl&B\Tj@fꐰef5=x=~ nwi { ʡPN5sȚx:%vn4OZ"m46Kll^a|9cG`?fs-nn82u6'3"v2)ߝ@4mtqN6T\E+z7j4ІЬ "H{b(ϙqzLQA.+2 IR&:\2Yj%J7{X#"_:tP UݤVgxiNϦ=YYLoM`U8lY9. rJn:{ LysRE N s]bD˜ҰUx~jDRXf/5(oC#&CS0Q1 &~f"@r<ܭ&9V{W;0IӋ׋ig3t,vhd^+]+{iO^*tSmL 33q;݃;f4ɗ6 ŷ,~0# s 71I Vl͎T2MQԉ[ X;7,MG9'yl*Qw1;,S` 446E3GlBYQ}AB{^IbtwgQy,_r\qױJPtwÈmt|PVT8~1uӬ㇅10$а/aa;p4IT8KUhgh- iAdnk`S U1*MRTcsÝU- ߺ-ؑG5|ç(8?n^Wd2ZL8I$6V9,a.o(s|NzXgYtنR>!*fP^'G^mJcx%gҿK2do.Th"5U^-Pg.rÒ E`4s8 ĸ )Bs sF0.;6k:}R 0gr>\b>l ?!Zv0,hQwWaBJ1<& I:.м'r pS ?HohYcwј37WZQ9Kн:Zu[qN9{zU}r%znyz;].}P˂r9@U6نR3:7PDY=L;{Ԝ'bSe^w'eSPu%u7e=J__Ӊ88{Lv :lbi1k&A"u~XSvFK))& ej2R ޱM Yk ;@a/V|U)@~=-Y{KC=+Y=  0fe `-!˦Ik%dl/ 5w8Ǘ/L8 M'3@́9e+_ 9W*!RtAhwG}據T][⢶X]_ld.h;."uT'dyMMM{헼_+2FL_`Clʴ&fٷJ%8 k3fLkks&Kf1 EbFTr^IC!ߪcz6W~< +=.#4v]I/3h6c;Q.Ðċ\\`h(ҩJvż_ؕl( q 15)Y~Mh 5$6Qr*O{vĒwcxU tu"[8VW‰;Gge}&{=Oqq@S5ʶq7iI7Qz0xaS]Nox(@jzA|ۑC#sꜱI/yjqs*$?%Ի!+5$5 J)sׂm ƶlZ,Cn40(4rQ&EA/ᇎC QH𨟜OBHEWyB@=:,j0-(g bd6yVdm`^pŏMy7Khc }P+a-@'* a¾6Zj rn?&Ĭ:țmF9Ha3(3!8lsY+q>;~W;hC|v݅~XEyPK=gG< _ Գy[}WpM3^$W2s~S ^ˆZZY] Aݤ8(#%-^0څ+O͉ڟagfb WC`I._ e^Ƀؐ8o)m\.W-DŽ@iGyT5":,b3ZoW4%JQg[\Q59y`rdbl@9ORYr'##v@/OvoyT6d[؜nD^짿;}9V!8"NvRJvk!n v{/rrܧ5@\r1ue `"LS۴9.rN_V ^l+nR]DT6ؽ 0-8]o89fJXEayk)<&M&7m^A;tnLv` oYg9PQ~=hhM-ꬠߊz*Gw^++E}0~"8dwl+B$ZZI;K2yaa[_8I"06i6K"mQ] gQwh\ǯy{+-6Jai_$T?]ŷBY+v[q}3}8 d3[|o=ιH [*q9Z/@5oX&v 2whB4?věӵhgd*!Oxg$q`nߜo`̔|">NaW&f#g=Y]̊mYAx^i*2K$[B݆]#߳iq\s5YI\9p0ԩHn"?ۺҍ8Ůom哭B?R}Hm2A\2nGl"|[5Oz,3p4#H\PߘCy;Q>ό;R fnpdX\`;:|ByT2N}lVFNcnVTTN *6'C45/q?H>RlJT'TUĭHvaf,Ԯj+Ab%=qXEh(Ne6g x+:'Ǜ{QsK'쎺^^U~-A#FILX4Zh;o>MZ#5vFЊIKtR$ύOS-ghv*oJLWӅR[6I'yYhP٢Ųo̶"?snK"{.menm6xvFb{̲l}aRBS8e.FK̛;D\9kSqOQ~pd82ioD7^?Vɺk^mMڐj+ an!? *[^=Jvg4C4/W St}LÀ!#CQlve%\J;}r7`{(%Ӑ׵|4c8;Soĺp9%$Olzo ͪbfeRRܝiwI_Try9ԻCZ^[{蝴A+wMY92Tzb(}٬|us@}oTAMhRXD&?Ʒֺ NU{?nιNd);p0{1?~cvj5Nw}@Zik0q&.\{ΛK%n'by|KH">ndKC#yMٰR-Qj~TjԸ^ 8'˟&]v-x{}#Aw (n\ 1YBVC5?pדNēkI kX.p1}sdUPUIy ]41ł$x:m2n|#zSQ4a#?5$4~~_ 5 6 SvDB2XO M'{$ߊKmډ=쇬=YHM@✵K5qE  gM^yڄN5N.jk!Ӻ2cЉH>#Yk:XIe-cs&O457kl:n9XWl!zt1 i1`~R;IPSXA]p9D01gڷ;"i"p~|S fgses-ޡnip6c= O¨O G}ARe 1dcHB[iiƃ) \0vv`A>AEly s{;Jß7%8J3Zs>J}gbsYy6~=d֤Ib7gLK 2r֊[ll=Cq^?=/J*FbmMTKV*߻W;^p74#ЪY3[mt!F ~:Dxk-M;j_~M0aWkJK#@UhbZN٫0g^Lr"ަӈJ^ϒfKm }hX (fX!ɽeFo4`[""(CJcJ},UJm;8y'[fE- J[VhWѴUax=,}W[_:GU.Pbd_ƵEf|e&n6# ۀ+Y-&8VL!k9y!^:`G&Ǵqd {?9̓׎XΛn!6\Y>L%WL&.Td_pqA9'L@K&FRv݅[:G`'&`gmRmH5BsL݇S^D;dG[5oiR=釿l'ubP(`Z5?co}O%f1kDΛ)R+W@{mKQyfObh+j*ճ螊a',/Ks5mߤ>gNz?#x~6Ir-0bI3Y=e6N9^=j3x-WŔ_|YH%FȄo(h -y&/Ei9*&\$~,zϚu\4M9ck7vo%Zqf][`; k| ouptcXWF#iaL=L]Λz{|^ 8]6Ha E ۛ7T' =a4GG,*B)Gxl&\R' l=%K[GAvP,> Sfc\RVAu;HJ4G0m#|y) #p;ua(5* o;tEgO~eȺ3o.viN?̡."b=q5daZ%m"boYΈԻ>HE"w2: ]K3Cn3e-RB{zK%h(̕2~^RUϽȼ etZ"!!u8WY}md}p77ӽU#GUjjHʖ.Mֺ>ރUg!O*lR?Ε\ .BAx~𽴈/itxǹ&vr>ȄsO0 ɫ{]\˳.MdE2A›ek;TW?= q} m "vJ6RCeMT2 پA*emL6Vq$T,KdF6}7.G'y+XMZF0>N/hs @։#Pk|uu@`[=_>N,P?M ,fz4^߇ʯZf֬HxZ-m.ldw>I3fY1RIrQx)5ڽ]]" 0[V`m5Z/MB zzsco_`e:6 -KF쁷g;@@ooM;ᓉR..:5NΨ+u]#c, df%4~(Aqɀ;ILAA%Y AE}K.WqYpYq{DMDj/#6NE]i#PU ̍t1u0$QrŸ[6htf(I1a?\6VfQ"u7_d˒"l߁3}FQhqpyV`;Vv6MN& G>?"M1h-%npG'zEpTdȖs4[p,TqYSnyv XaNe-(ZZZ.W]V@KRq\~)8ak'mZۨ|koԴ԰mUꅙ?xkOړ;h9wTYC=FSf"9H rNlDRxggvBU6\w WO oú-ȯ+/1}v'K@K]$o+QHώڙڠۆ3S))W-GR5ĩRU5;ՇF-Ю+^I܉~Roͥh[M .4ߵ`ܹ\^ʆP)Ub N`, 剷xɟ T 0e1'<^R4eI}u'~ޏ79&>\oG{8ĩ% .2:J:FdiNʖl$E>4f(52zy\ lu yHepӋ`)h/_4LrZ5"mdų"d_v ZMIx UCp zj, zwd˵bn+=fjs¢o[L/=hi7 MY)^";tơwX.MUQGue;KK*i" TFT\jXRQxpvͼݸUGr"0kE9Ñyi|oܻvlӂ!Fy2loJKVI_}BǾ۽W4$eC9cFzb.ˇX']^DhPH˜U '1K_P p:O4\N.Z־@ 2Fb/sԈ#a7{xJ 4DeP ǵتr W{Q6Н}e .^\8aT4k7:hTNcm/47*kya4r-X8nv;Iw&~y6>Xcw&l x@=gG7AǬYμWc56WOkeG**:Y _k-Z̍jy7~47Ktlh".Bq֫.ij5Zt́x\KH+5rNBYص'p.ϾtB8Bx [|iτ}1)(,SJV܉竱\BJ:"֓ hvWt( n"q쵇B Z'!ieMC@Ph)Wxg&^-G&ңiݨ$SQ y;Iu0&`hnUTt o{†5Ӧ/M۰~2J&+&0_U 偂--Maԍ)B.AWgZi/OMDy3& ,ơN0dMkuFd^Um7buB0To@/sUV۰*pż36Gwߜ/u. ۸p wN :RL/vOUN +hS\. ;_Cm~`*ed~#Yźtm6]g |uQe|塧a_8ő pI߁gEhW~Y{f{n*cV2*"TbpqTӚcl-E"-S(v 3s=!NzNS 1K|uV^"V-KGmybX0*籔{@}`!*v4 `u7fպ} j b.1lΐl y~ֽ-*sU4~36u;t"ݒ197Mo 0lG-\)m7;Isfd#F3lʴc XqPRU y,.,P]R2F]M6G ]T[RvO vTF%r!-Qt=Fz@H^7 (^ʠVM!@tЌ=?O;iPP~ˋBĻ^ԕ@hMB ۗUӵ蠀xf/ѝISĬ;r&{ ݫux0N%5vMӛ%3T#__eOP#Όr8l U#$ pFIy8sw?L7!,&6֜# c#w^ ;czwcZ`鋗H1ed2W*_PbLtCh_q=Zz7lİ#&cC:7 ``3hx)ܼ%eZ! BdjSl/!yP8nkk:&S8ކ8j,@wu4}QeƠc1p֎aȃ 7<7qkTG/jUlH-oOwhIXR5߈LNb8{PE7qf9iU#af}ic?~g'5V 9^CHA63N1|)ڌu2G$Gʒ|6LROx ]xBs~6?7RǬLȳ|-`c`{n@;gڪ} FQ 69H+ m?޿j$16%=33ATr<]*MJQ;mǫ6)Y@گE;5LDif~ F.hHfs`-פ'c=gH.b% I|NEsIƳS*v/f bե1EL3sqU 3ln^3\U Ч\Uf& Lfk6.lDFI$jnMDO̬x]4FR*;@< a!M&UoNY'n[Un]Ԅ[Yc(}k&mI֝G+~5L1:1öm{U(vz;q eMa6sheِ!ڈiD*-S2| $U&6)sD %ri5_mʼ5dܼ`uiB\k n ihxI7w a$yPA ƈO^8-!^lݩf1mФPÕjUٖ>?%Q4[٣c4bkx9" ƌ qo#<ڰ$[[h@VB]z'i[֦d$~#cLH<4{b=Fnb4ZaHRj.?mkG,яtlb;ꑤγzI~n3N:sb\#q[wȞ(7os -:Bbsn?B~5@1ӵ~]"vFiA2 ;ƻKi\iS=Ġq$vwfӻ_'LG}CHg APA+>Jq]\:Dq;?V!y,m a0kaް 6V2V],#BoX~ֵfN:݆xǬyމr-> `lLoA+*W+cpC kghJMF]ӎ8@S(Z<Xbo3ٔPu&=z[yce-W 3Л^qʂ7W؄+1NrW&[MMi#3g]+_J\3ٳfd /cbAo{m'y³@n9 T)86w2#2 < + z0.x {;X/=3_::٫]_ϣ&5~nEh@J7|l:ƹtA#!qי؟.m#!Ɇ|A=V:H6 ?M1#"\hP^Sc2pIœ] XhN&XS20lIQx~;xRN43|#]nUbb0[9p6Č Wݞ9 }H_d~߰}ϴ_ }VΓ`c' ,Q]';[.ka6Hh2e2~k\$ٗ4iQֺf!H[ߴqHQR:a:d!\׈CcMz2Z.[* 68kD*(g4ukȳn [k}2a[0)g Ь [fNfoe6yxT\!¯W~eTt"zoGt:bPS.81IBu kˆiQU(jS2=\!H[Q<$ճI[rhȅf׼?EԔhGyRI4fhG I3Zþ/w, sư{_!a(x*IcH7~uRts0FyC,D2r9aο7^8G]mC/,Gf@,Hiv0&rܜeM]>o;0Xjhڂۓ](h0:3==X,~y{=_ѡa#Rp{n^ 1IǙ k_qWJQ/ݘ/;חv(~ťc95\q+dyQXPŪC!!_`:v*,q;F4*gӴn2rwsoLgtv;}YgM~'i nt"9_^35i3ܔ5/3鳷U;d:gzQjsȌ'^Vv&O/Im9)GC07^4mP6FiHח+f;A@=K/ZQ}lR&!> "CmJ\DC 1eVI7rKՐ]H6(:8+MJ-<-> )ATGgk1/Ӹ_D av=b&@$x`q&ּґx'Mcϒ/ӕ6[kiӢԺ.l-C8/% N^P y@*DkIkq4C2^iWCJ7B٨ p⵴aOF >,S0rYǘ' ceQx=)U!U9GE EOʏM#KH[yu VWϯw ppH|2`(K 5UY{F\?/UVS'q/#˕ls{t«iV(z+DAz?|Cԣ \;]v4KO.[yC}S }|sߧkjI,}mVgyUC~b:5u<>_WOsV,G(f?t:9xb?sfdŨ1%t¡wgՅ'+W~]";t,bRSFuDx[U߫5UR2yOTUOº?z֥ﹺI6p{WQ-%SomU^֗kjcªd\jVE tpi0^8`og*ؤ1zCTn vS C9>>9(΋̷g8r<;C*OX,)AX͕r59IZQ@LT\FU\D:P*W"r%tůEJEw_8u lZ*RS1uʯhR_*Q |4qGɯ(qMRʣDU >J*UUsuT%(+\+t;5G%654 -*65zkRlC;+XC7UT ކaޯBR'կ:O_2oojE=_{ȞjUK^u >^f+wk\\[Sb\I>+}|7_\*?~-5k: Ikcb~fO58/(w,Y8`{'0X XS> ]ջC"[F+ټD" Jz<]Q{OS`#Tz+SEzH }iU/&E !t s18e u=C#)tمJ v!!4Hww !%!)ݡ>t={v=s]p|73;;; B -%O SzP+WBLbwpCl_MjjqUU>gPV|'/:Ɏ3UuӖsGS?z[˛?;\Y22LJm&)JImʤfҘ2iLZm&)NI gT_gpRo d:lQJFz{*w ٻes7wYee ;r&܌[ ˔ 5*(¸v܁;q=~C(GB[x.=5[ QٰPuBr=|h1> ?!6Bc4AS4Cs@K|V6hvhN@v胾 Hh|1񘀯10S bcfbfcba a9Vb5b=6`3a;v`'vW~!)yvX@R"R# "# #2!3 +FdG܄q r"r#"  V܆q=!0_bFbF+8LDLdLTLtLl\|,B,b,R,ZzlFlflVlNO؍=؋C8Yp## /!? 7/cbcbKHh8|٘XXXXo+k[۰;~n_+`/~>!1G,ۣ:: zzcF(OJ4ʠ,)AC4Bc4AS(W񘀯10S bcfbfcbcbc brJjZFlflVlw۱; ?G?a7~/{aNN ~E\Ÿ \ȁ[ bqCTH胾 p|񘀯10S bcfbfcbcbc brJjZzlFlflVl^}؏8C8#8c88S838s8 ".O.s@J٘XXXXo+k[v~AaQqIiYy\q /pW1E ANKBjAZCzd ȈLȌ,Ȇ9 qn-ȉ\ȍ<ȋ|ȏ(B([q; w܋p?!#|OM-Z ڢڣ:: zzcbc3|/0 %F`$Fa48L$L|阁٘XXXe˱+ k [ {l._W^}؏8C8#8TOȀYp##n-ȉ\ȍ<ȋ|ȏ(B([qnwn܃{qG!1 )9?p'qr,H8D*Czd ȈLȌ,Ȋlّ7f܂ȅȃȇ((¸v܁;qƽCxEc((xDiAYSxQY<^KxUx[x2Ejj>D}4G!1)9Z%>E+FE;GtD'tFtE7tGD/FE? P|a8(Wo+k [ ;~~o؇888NұN=01111S bcfbfcbcbc bV`%Va5`-a=6`#6a3`+;|؁؅#?=؋߰qqqGq q'q qgqq\%7e\qN )HHHȀYyQQq+nw.܍{p/!$yhۜ"HxF^ՙ.olBךls%ʞQY=[ʹ]j:7nw-Y;tޒ9{B[򖦼R934I.L;ϫk= }:TŹ}$K}k<$!u} –mesز7ed -+- |Y{Aԩs#ۖ^uLސu˺QȊka6 ߲r!=YiÒ[UlliBDc69[UٶBdJ6uQoB!6^~#tgn!69귒87mSFQ'nSz&6=dݦKdlӼmzGȺMew*΍loN2wԽ&MMY28٦s<4vnS*SFm7'~RS3$M\|Gv>&r3T@FUDz 5)܋1}Sr#O1u yBturg;,{MSClwrSߑʍlwխQ'lZן){\*Fj:7&}G(궝p@WQ*΍l#sS-4#{G?Q]!6\7*Hf9&SŜɼgμɼoμ|`|T5gj2B!VsߩnQu͈j354LMM9SKmd3u4L]M9SOМPod3 4̙4͙5O̙O4LCM9Hil4d3M4LSM9Lin4djՋI4fD3j2̙VLeĄ߈ 6VJ[m+fɻ|Wތ*}w>dڛG^3LM9QdtdC~V^]L)HyuլnL7M9]ad~7P$zGK3LoM9Gkd34LMf93@h d34`Mf93Dj d>3g>d>7g>d0gd34HMf93JmΌd2gdƘ3c4XMf93^`Ld6gd&35I$Mf93YbLd1gd3S5i4Mf93]adf335Y,Mf93[cd3s5j;F)9KIb9%s8I-1%̜Y,7gk2+͙jsf&֜Yɬ7gk2̙ |.*s8嗒6iF]?$9\3<4gvj2̙]̏̏nsf&#!k۩eq~ьWsWMf9Ood35C!M9sX9bd+EW63|!P]TYZ$NS25 M9%sIkvs>?oΜd0gd.35K%MFM] ݒ>q&TfL4z܌2>Μ=٧4g|٧2gRi2͙ԚLs&&֜(>9NIoΤd2$+1-&s9s&ќɨd2g2i2͙̚Ls&&՜ɪd3gi2737j2͙Ls&&#b;wڙKI7GtfD3h29+3<\6grk2y̙I}s=}Ok杼&Sj!4.t=ɸj/&5IVq:Id퍑VU)IsF/V-&~DgpP("lM0Q6,Jk"lu#$m:W3rwER~ǖqCewK3]\16b%ϩ9wdn*IGd]g.5mqQs{̣ϙ^Gbt! ltn3$S9sMk%d.c}rٮWU$42|FFY3摩Rb|BU3摩RWez25#1Y T粛G'W#\rhr9̣KV.O4_FfWQ=ʹLߠ]W^)sȏ(>x,.3I2y7N)`{R(T\9+7U(6L+=ƭ ܉p7FQE+FE;GtE7tGD/5G ħhhh耎b1 1`*a߷/˦ "k\IE/ߴ%C|/54|7_Ls7-mΎ盓=={V+1R99򈳿?嗕QْQ8["F3ʔN}$(kNm%4On/#o '&mYy3.w~ɴ2ߗ䥅JW`K$r );摩Rhȓ6ڛGJIB^1ze3 Z,"MhY1'=5#?ŐS-FQNxeW Dg: s2a&Y-NiONjqz8El>mȈ{)'#Um/ ِkJKIryɨkI\,S2թWm?VQK6sQ¹O.T;nw76^׵IRݳ^toO:Y$'I5f0gh2͙ sf&3؜ 1gh2C͙0sf&3<69_e86t=^'&s#Q cc]lù~vT)ILV*pÝJ֬敨JIbl #ӌlyd$ƛ5w MkskMf93Cedf'ع+LNGvf]O$3']rr}I@>5G\s6Md34z-gd[;7fd"}0Y-u@VefdY@F's١dtNu.=virr#3ݑVf!I'U߃IsHj&g3//̯_5+nO =^۫Yy3i2̙}~sf&s94gj2̙Cas&sĜ95gj2̙coP<~z_( s9888..,&1E A8S!5 -!=2 2# "nDvMy\Uc((Q O4ʠ,5T먄7R_H;wQ}|ꨁڨQ >Ft0+;z'z7/?` azPhfbfcb~b|N2O6{=2e^.4U/N&:K*ݛOg9HNZ{LE[_Lps 9~Yɝ1ͦҌl F=()GΙGMj; {+?c_L$' "eGM iazP/&H=r=٨Sg$bh+9 RMӱm/jFw)%Mr_Lp <3G$u|&NGC^鍑cߕ)7{;X"1"U$œR=J"ΜRHiN$ʜR=J"9:fDdOMHi4I"9% &HoNcî$S—R_"!ˋ2al9vQ'e6?zQ'd1T)Id5"4+j"}-j_hކ3Q'd7oCUJ90R}S7S'+fJT$| M6D9'ߕǼU)I<qd/-ܳ}_=;2E˅N99=&=$'%w N{ļy+QnJI1ZQJD-h.r 2|2៝ۖdJ&XqG|2៝ۺg}WmNR[͟rRda?;/}R)mʫdʘﶪ$rp;r摩R_k.'3y'݅|%XSKVWZqH=g_PEK_ځ?|RYjQ^dQHLE6" MYIz·>VMaMʫߘ\?7)%:HgB٨d]ReJIb@R>6YoR _ ]!)&c]Ç (&\)9Z5[kc|~320c131 1Hn+pGq q ͉\ȍB(uiD1 ̿,fRwO x4ӳQ'ɍItWI*U&:Ί6O lyƉ:Ijyޤg&Fa+]1$YyzߑV,mJ)|sJKbQR}n-XK˓cN[aɨdVwUJnf%Ji۹+20$mMF$s̼T)I7o#( 90ȣKIrrc۶&Nٶ*ud"m[4+Qr%XTrB~}as&S4ъK GIլ'5VfxƾUfcptW ?w$ڽTRnh;X4,9"ZRRϜTߴEkiV˨G%D Ǜ]?%#{Qڜ)ɔ1gh2e͙L9s&9&9&Sޜ)T0g*h2$:ў3t䜡Y<54&:IBo2$TϗRx>YH ѬDI`E^"/3/j2/3/i2/3/k23h23j2w+I?$*InNkRIUҤ0}747{ߛ-s-MsM9SYfTd35 2ۣ\")W>řoy455ZL-M9S[cd3u5z ^54Đ{z2>>JKQA G{X/ߏ'4s޼>> ,&М+5wnX} OƚXs&Ԝi4Kt.υ{_\ o-/)7uLD{`rIYDd" f%JDGr5G+BnfDI֤P@w;IflX&.\;M9kr;~Em͎ќt2g:i2͙ΚLDO&>d" 娓&)o2$n)UJݓ !]4+Q=Ѷ[ܶfQ(#Q@R4=0N ,Wg]v]?MzǏ(34@Mf93#/:33ReΌdF35̙41Mf93VgΌdƛ35 MkskMf93QdLd&35)MsMf93UfLd35 Mf93Sedf359Ʉ6z>Zfh2sKV3ʻdV%5Ws,= !_-'W&{͜dΛGs^`\d~7g~d.35K%MOsOM/s/MosoMsM9sY/Wq(Acr)JRe n:&H%#7R~(/KP$T/KjR)Y28J3DUJ)%fd#S$:/#md3}4L_M9Ood34@Mf93Hl d3C4PM3s3MsssM s Mf93Ln d4gdF3#4HMf93VgΌdƛ35 MkskMf93QdLd&35)MsMf93UfLd35 Mf93Sedf359Mf93Wgd35Mf9PYd,d35%Mf9TYf,d5gd35 Mf9RYeάdV355Mf9VYgάd֛35 Mf9Qdld635-Mf9Ufld3{5̙4}>Mf9_9`d35C!M9sX9bd3G5c1M9s\9aΜdN3'5S)M9sZ9cΜdΚ3g5s9M9s^`\d~7g~d0gd.35K%MOu&cS<4͙5̙4eMJ|uכewr7M}KI]o:sg-)?wrT؄i`$?7pG=g1'S{~^ ~k_J I-ԤZI-$XZHj&4RMjY eԷդZI$BZi~PZyPZeάdV355Mf9VYgάd635M&Mf9Ybld3[5m6M;s;M{s{Mf9]ad35M9sP9dd35#MX Q4QIפN:I $uR:H&u:iML 3@Rg5siRIפ.IHwM@RhRI]Ԥ.IHOM@RiR['?@R5+hRAB@R1Tl XM*E T\ 8M*e T@R4ԁRkRiIѤJI $NJH*&!TM@R7hRIeԤ2ʤIe$YH*&-T6M@R7jRIeפrʡIH&M@R7kREH*&+T.M*wji~}s&&לɫ3gi2͙Ls&SМ)2wR%$֌VsVMvsvMsMNsNM.s.MnsnMsM^s^M>s>M~s~M9SDyy@9MAsAM!s!MasaM9STyĜyDyԜyT)fd35L M9SRyܜy\)eΔd0gd4gdJ352LM9SV)gΔd2gd6gdʛ35 LMsMYsYM9s9MysyMsMEsEM%s%MeseMsMUsUM5s5M9SQyݜy]dTd0gd4gd2gd6gd1gd*35w͙w5*LM=s=M}s}MsM9SUfTd35L M9SSedj35:LM9SWgd>4g>d35LM#s#McscMsM9PiÛ2hfhZÛG_VtMF*ElADd"f#ge.5+y%Rhd.-5#ki*%OwO5wVL+Mu3oD#_ZicMM9Vigδdڛ35LM9Qdtd:35.LM9Uftd3gk2=̣4gzj2#jm 18t ~"_e w|MHB*%;ԈEEET?( R{z Nslf?8=i,duZ\\W?=55&4/8 ʘQ>w-zc)S'W+Ų(Q'U[*'U[*'U[*qȀ/ 32a"L1)0i8”SfJ"L))0i4”2Sf"L9)0i4O3<0 i!ͼ0h´|0̇|0 |0̧|0|0htӉf:!Lg0]h |I3_"W4|M3_#LW0ht`YH~otGodVtĄ$$v}{zLOL6[%~t$[$K@Mgkq$[eAC%HE@gkt$[e1'$lm92B"YD)H#l 6ۑd8#qVy Hl 6f4O3<0 i!OSa>sa/t@4a:L'L3 tA/iKfBJgɨtC4ao[a{a~}qS`FA3=75_\>0?FA(3u q3ZO?뵵^{%Za 'Y {eL/ЪC+D)_TiԏH#j- ݈DoG2Z 3(%þȮ+0oӏf!L0,X%~3aA0Oa`B3C/ aPFa70if8C3 0#if$ŒQ3fF#0cif,x ~j $&HLpLG.g$/It[Rb_H#j-FD7"D)1̴ّ)HfS J~s0MbL>7-CfFjT3=iՊnT@42 iYt#BLkd6 XJN"e}o,C2ZNghͬ@xeyJ`*$4aFІsv1&_qײ^bF;V^Iˢxxd6{ QJl5iD%6Cd2D6fB3[f+lE4av.IM3fA4a>ٟN?*@&ӛn{aэvaa9B3G(Ec\CΠ#T#T"Bp:PIPIP)@OAzp0=i'[X%~3 ɨ#B2g$~2o~j۹n,f""Y0if1,%f# Y0+if%¬UfV#Y0kif-¬uf#ـ0if#lMf6#ق0[if+lmf#ف0;if'좙]ȄJ2h7ك0{if/죙}f#90i Csf#90Gi(csf#L"$" 90I4040'i$¤L œrzr=p4Bq:Pg"9Gsuɇ0i&?Sf "L!)0i0"C31K3G3qS>*S9)=JC4iq*AS:J TI$B)=B4ǺUxWTvԖ*GSzUӔ^3G 4["MCEDSz5T *ӔITF*4wU*}Z)S H7|=lPI+[Jg7NvzS=^cz8\d4SoSm.)eٔX_Ksf]i˪1Xe,nkL,Db]Jݤ34022~G5L-̳݁3󵬪BTڲ*MA#2mY8Xlk4uٿY|{-(sLZejP_.iD%B3lk4ّJF!}IIXI'LfN:ZeI[33/fIwDMA#Rl4 hi=4_J\: -r7% D)H#*;c_uq?黼tla'Q}t!934O:CEtfAl3+DwDaFEh JG•(h4T~Z$Ǧ>c}]a/A)!{I}0 hœ C}HNh:`ˌ ߿#qȒ'DhF1p|ET\22k3?uLG0Ub` LJ1rAaϒI A~ kD90i m ~"t < f V]HTAuW] %, qz?~lu7] wȵ$0(#}@ $}w{zg7<윙sΜ331y⪍q,;"obэ*^~(o>єjb0LlvY' 6v,>Mb t2Vr59:O k_AWGd@=?,NCwέpEW/Z"q&>7*fiv:}t"H{ĶL..B軁ۮpIi vGPa\a  K_j?=^Z=E+:ΔhHք5L)C+}|K2PgrR V{{I&/MC}>sW}hۿ+/{Yyolg_oW>?`?o?+KC:W_#?~&?w(5y]{ґ~>Vu??kzOWQw|?w?˫}wmm;~}_3a7W|sOo_}gKwצܶ ݷ| fvIUxqEo~JXoq?w)] Ϳo>t??_{|__[۟~?n _ܱ]Ŧ=oow[/M}aOǗ}iӳ&K66ּ㕴=㠯ev6zٷ+ڻ+cco )mlEys/kW7o}l6T^kCOlTcb2"ܰ_عElS{5oWlvmT7=l?W)agc5~Ͷk-]Ǝ=hӎ״k\ٖq;߱3پǎaծMۖobm aӳגe{yjk-lWQf'y3r]Dɮsmװv̧]SȎ6߸Yնe;ݭm7.;i,dw*igcϱϵlOmdݵ{Ď̎&hٿ!;ϙbܷmѶO,<ɐ=]ُ]jגu_VOs7;Ώom4<}dVsf:vny_e;^OSҘ|KmwCvϙ=m oG99콸ia=h&G6#{%fgc/btilUWvv.;Wk)= '۷>k۹.h;C;Z9+ۖawO(fflg>)zܳm.qƚ7e,zv盰}?]0~wcm2{ێ rd)S: j׮U鬎Ǝ Ƽdmƶm\<lS_ cm6O~vԀ}m۱#vڶ7Oe{ؕ콇i:ĐQT{ќo{c{"CcnTJ[v6YG~۫Wٻ]g-ٖ}>9ع̞=[mv//ص=7IEю mmWuK{iNcg{QvϞK~O~~X!sYm )̎з#81{?dwNZv ;~Lm/AS|]kQZا;vN[{7jնkڞ;v=}a{5)DmO lW{³Q{gsvN{z!HKص7<8QhtlD}mUk>=h,r"LJHXӣvMIԎtn,5Kv5u9Q{c>7c%o[h;Vclk=K~6um3]`g{ ^57dS}37Ә{?v-ؿu2mw5ɳZwTvMOsʳŀy3jv7;nǞq/Q$zvYdU[)6F?lc_Ͷr;=ųay k5e1%kxP=ݜ=-`gж2vrD\3v}Fl?h;9gXxN+1e{9'v6iF^'+;9;pGv}]s?O5gvE}ж'3v2v Xy=g3ƾv4bm|4`ڷw#m{=6OZ̹^w ־9ؙ {{GHI~_\5]'(3Z؝n1N6˶]l1"BuTWq;p`Ķ4v*Q;iwrDf(^*Uش')KsQU_T,zqᖧ}NbF5h}rX~kNL FjY$_ æ1rӕs}U`4v ^un6wvEa*3H0FUh]vW`]qYXzfF=p?U0U͎򱫬ս̫vvpʮit;;mb~L>?vF:ݡ zǖ';V3ˠؒծ!Fme_F,<:HKtQ vaQ"_缽r l][hϪh?0';V69%b>a%&Kgl[GoW[_U>B#;;/ :oe:(V o2Ju=_GLA]:l[5C;S=ק3 g47d̶G} dv#ψj3]-%?\[Ŏ,3cƌ*RNUol2܀.>HҠ&n!;qD=UO=Z ^e;bG 1SDO~.^աmqBX~>v]#j-#|FD֘BWr~J2400)޹ݥ)7}ݮ>]m^zGrNm1#I% L'G/~eߠ>Z&"l/A;^H,3<لE^KSث ۧ!xD,p b?w6vwcYvU'ZeߢWIܠP5-(-i$UʯG1Yytj[ZG]l/$WIE]kxy9gW rD"'3b*]kg˔;hם ڿF'o{RL_թRiڢi0 vAHy˨۟Qu;aNK遌WLQk3RUy҈̱"]3G`cIxQiړYt3|L+ƦFA;gwo 5#6%ۗ<%j{ ¯^NC;y6mwh@J1'pc;+!m@*M nqq!*!qA#Rcf&eܗH֧􃿄;;V=l{)1*֮`Ow0w{;55X2O]8[peG'߅;mjd5yNL0m~_ٞ{Te Q*$GUZ:K{q[{ssq5xgb[47:4j+j(8侜Arax OxNW^\]8Zm)q{vGĩ}ZfG%_RNDWmofWfBUbFz*  Tw6īlN[R(\a#/F#Ҡ' c,mU{*-f}۶Ihn.) +"?b Bu¬cm,#BWϋoNZG(^!uM(%7Gzu{ag;QfjYe"~ߖM=ٖef/\a0~g"V8ƪOi[ Iؙ@__Ay`QXrWG\Ox qjGtܝQn3jd[w3qg# [@_GodpTΚYvD{դAܞ"oa#x.͎g# ށ,xuhj{ rħM вmA+=rdư 9.{y'"V3ᆘ4Dgr%k4(sUCk;"/=`*cԶ;yQIMUڹ6`@NQ8`L5^\D'd]MԑÙJ PI jpE:PQd{?#OuS6*= 6_ AUCcuf.l, wjt #p-ET+xvVU~_-Y9V~9uۇt ?{|ڹ@Dw’j W%J=a'>Qq=`x{ߌ7:|i6- c~@u=,;vנ?QA]{PPH/2 uCƟ$JDO1sN ^%m qnKS*6;2T}ƫITg`vԖ+N[+Ú1ѥCq`p~9Mi+֜ѫ#II4p84_"v#. vJ;8yağ//nPHsr}p,@_ۗYRs>r)ۇqqo`#TaI3 'r&Te5ƳR (b(GFb\AeU$;\c#` ;}G4y><:7^]A87})a9^ndM=#J IPY.My?<\^;/'FJ9CbJ6'aA$ UW "%. -n|(psW'CVXPWPN.=({eJ)'"̈ zϗl}b7t29/JPF]q=a >AZ2s_hbhNE#t^&vэq 곒D ޼s yQa"8E pU)Fya$6 #9R8pOT/`XCd+|\21+(x"h5ߚ-PEf-%3+(MWW^*|\sEj?sc eku\Y>CXua޻ϙR/<'7I:2\|k*+ڀ&SfI9 ҧ+|QޚO8D~7mj`k8h9D7L Dz:,ꈟjyRP=D75'R[g 9TΠH s@sX0:y>_-:]qNq*&.\sYvqr%ēƉ|CWǘHf낻p.ďjg(=[4\4Z ΉcWl^09FT*%\zp0F%,W;|HYpr{_C-;kT/AeE3'jԊ*5pN.]Q-ǘ~zx6x]-x5en릪?t"T'K0.`Vn$y)DGdb9zl70hω qdPLVCt.1A=:˻?A,?[ao07x2b8DwXurTxi= ܆~qp6ptTnIP&蕞QjhbSx]'ڤ8Frw]M ̐=@jOxCT OumҐ> kң@'hɼ<psnC8f ;[qd A‹LE܉{Ğ>$}rǛ,:@wRNnj[-˨g5}*(­/ŽT"_hߨ: ,QʌށWXpU7$Omy0\M:ۨW8\VL2胂dFQ-Tn #Bp`bhUT4+ׅltRp(Y#t-5oDHOC.0VPrH‘>YjEEq&u"_=j5!0眙R^vd/>&W7roWe ~ٞ뙠EhyaN^PT*SzoT0`9N\'v' `GJt$.Ć.3K%%]J?# w;N[%358ʄ "`y`whZGON }"j|IE7ɿs\x3c~A*L.đ™Ara)g_t7r o209 㴹'HsME 8u]litѢz)<#ɴ`^54{Δ9}{ƅ龧n'f->TL̯r!cӚL?403΀_ [ۑ*]sdp|edUE(RHQf]ah82+@x'yZJ0u!i"z/vOߐe~e :V wt4 W~ٿuwxj\j;jνn2]YۤBXFTWڅ~?xMDzh|nB JBiD =5O]**K+⅘V>Y uX#,yYhgs'j̖(rQ x?r~: *F3}yE*$,X]-zr:Ge3`sWЄ8:i#a~fF4h~9ք`0=?(/a``d5Guw<_߽^fAY*2ꀤyrVVr[۾-b0^D nWZ9[L7bkn[K6S5!Mv_/Io0ʴ8yR-C'LUhpFJNWA_бڌ/r&f/ a|f=CݢۯH~e"UE D1_8>&t9tYeqk#ZB*ɭy_H} ڣp)x}sTaa:}N0S ʌ9Pwbjy[ Q̋ S߅|Ux֠ઽ$cS#g`GKQ8G.Э!/v>3vR琎KR4$ A3Dܰϭc՗}y mp>B9J{&{Oq|QwG Sq=Bh g1)#gD_%oy̋<Zɛu G{TK`}Ta5 UW;ouay0 ;iuA&"ق37>ן5 lx\r#ϭuGp/>IȢE {WJ3rT?}n Ksm!f ,9Hoq byx,D[;Ct lp}k=:(KCo꽽u2JK>#b ߣĞp<9谉P6kě4Kf|$,Ma3ZJZX#FJHgL}pJ=e|R7z6CDm!~u޴1y؏?s߆_pCdxرZ =}_Ca{t ]D tUN+2>F}:_{̫46?Z&zS^Gە0B%A>勶],=Ѐ[Tu7O|ݡފ~틚>1 )HsA3 6tL1CAiz=Ez2prYzYFx 8"IP9Mh %;~0>QRd9e}ǛEUMP6X%3E&i4G ?aLp5L~S^ԓ}[ ٭kg[9Ƣ湜q_X-[e#3cmV3um90]֥lWi\ĽV1>ޡ2ڠ,2/pT0ux/I\{JIP{f` !H,T3,AM|Rz [5H\p@]O=UdtP)Lݗ8tU}ꕘ?wX2S_@jˬl2GP#k7uo Ǡ ̆NVϭB˪kS+0w+Fa{t=zyt4i-su :JwN)T!=%Px.q&^/)"V2OOQCV="*WOXZ0_jOXkoh=9 e4]n!cdt@/1}Ƃ!.fJVlJBQэaW^JY}UL#2dDKxU#QM2^`A?Q9ʴBeu<n Us[;x=]EI<QCk'QpqZAEbNԓgt|n s =u=[+蕾C]=qPo08hs[{@Tn=GLPgMG:A~U'd- !u"k2\C%K wpK[*IW~ Jts8=6}>ZA؂6~#3ڴs$l=0s#Zz=@f|}%<}{Z`*nru}nVU%݈K>J8L*@߭A#YЕq( 5~'.LVsvyƑ;1tIuPX(Lh&qAv(Ð%X5֘.U 37p >pA<?KCVE1 `㞇GjX8 8#orKhݔg9ϦTe\}a[4Sgp1A1-YঔLJoQg};>/|'=_8Q+R70>3`(;y :ּYwq}]O+ iu:emـ6'D$~܋''KNCoЫz(ӥ ï QE~;ϨJ[&Lr'Uks./JtN}2"fM =qj Oּ-d/s-aDި/0+p[O;2swLi'S&2VLCb`S_ʝ~~rF+Ĺsb^v%< -ɨ^| qhSBe=61st]wax'IU[Ǩz+tm9 gPO3w&N2H2֍_dQ6x6M2bj¬΍N_VsT{aO|<;IxݤQUp:,ea(_u]tĄϭ2pFcc@G 9h=ϕٰAtTKqy !g{+֬C3yRe| 1Dp]̊zus|/"}f s2Eko`=eZS5T WrfJU咣 a nZޚmx&cT FU?a$ .WGh Tm=X][y_AIx"atUƈpE/Cx &>ER0LiH:ut4pa<5 n$U<-a(_F{ܪ,^sU!?PrgnɛTC0?qEH1TH>m o0%؅8YpKN2c$gMZAk>+c`> !*[rͳ9Ngbt G]xlqā}caMA5ߞWɗlZNTzoA ~Q؂rW-{<.[sI=LBW)Uq2Ćy"ݲMڳaחnL}>UP8Da =OBh5O#N8 ؠ,҇ᅜKZ؜{V?.} ߊVؘ6t,2K`7+v- t3h>8 p_BF\xt㻂S9\}Tμ rWOuh:䚮H3skpWZxeBtF%o&g&l0<-ݤ֯Pot+? /'[7CH[w1\*32r$nQwFHov6ϤǪP6*7  l,d8|S$cJxԬ9S|o0BZ="|z>> z߮?rF}ǽџ_Qj=01 sSӾNe\U{ =w#*Ga9Tp8ԸAwtI[\T$ 1Cy^Hh3[ zC$G7nu8-Cc8%{udAgT1UNY/ Wkp[&q^plS60=w}ϟVnXsxײt*{jס2]O$qRMgjVV*Y@su\ak=&;s$6]wVN+G*<.SOi?vq:Ln0o5I"%3 {nᦶG>arKt 'Z^rɱ>^\ ?֥s}[Ǖݽ.s_˱uZrxXSl{^񑸷@W~fi]{z}(|/wu}n-C}'Eqez c=߷B uV+a&0veVVI8]2WҤᨈ_m62Dv8YtA |f臨+^oW fx8,̛a+2^ Uw{'v̜C eMO VBn {k<$;3AL ͉8e+0f $'/F<<-PVx4%U:OĽj[ȩguKpzrZx!K]~\o }s3MZhw׈u~ZT r_ 9 @ Uq%Ix:ޣ/^eaΑϭ_Pa>uK`VTQYc3䉞.1 "&Lݿ.{WPA,_&!p jxJ/jlBCGwPTעog]Nl.?9:`:^hgěWōEiW^Osk<@Z+ύ9]?[ k*2N|F>$P̘!֭YùQ.L|FOEiR=(8Q}a|ǿ}ۃcxyf? 'u~֬q= Ρ}SAvvI0nm W|#ƏV\{7־AYc*Beݛח&P]Gϯu7 I8ybH#a0[-lދ&q.U[TMzϪxD$g8;:S+xAF>=#vJ}ws;D;L ;Fnx}*Eljj73:}{}|$tv4OQb88"^Lk@Mn>uQd-Ww[wVFbFSk֙X( kaAz21|[k8O B^r5~8?l"\MFe[C=8}KnjG|k5Ѹe.'I1K\pFaqx4zy9BO}Hӧ?aB/ou8U^P\Pe"iV6k3&0 18É\a}`9; x>g06=yNSU=Sϻuz=B nY|‡ :o<(Te} 0D1't86 pӑglnPD#+Hok|nGHf@i.Y8,8S1Kʧ|/d)}4i 9 h×7[9+uUEvgqUص,}K,=,Z:Q}S;pUYDpG{|:}ƪ[ QH=¨ѩRC 3tN]_t##HEo3C¥At+>1\j :z 0 =tM7|'2J7G v ,Q <,C@We8ck{|g_GBVU};/0kgaV#gN|]շ 3HxyB\ ,ϒ!Dqc&'.9ă3 ⻛D:Iruok_ADYmR9Ӊs`m(n-'/`ϭ'o 0 Ȏ^ϭ0]2&y1 @oJ/@}*Mq5;3y,@ИS_^8} = tɾGF[q ) =oK"< F=^Sfo X#_s =z[p1!CDls5]75m-ĸJK04 t$u赘^Q1xƚTe|!+]h~`<5DO*{p+JޙW2 \i؂[^YocY^S^2AlPɂCaISo/Ԉ#SbQ#'ڠauY KOS R+;&pEBp߽ZA$}aOYv XS%A/;f90t&| pr0&Ɂx"z𤿬e\fUȈ܅V?SqθTYTa?w 'rABm^1a vH:"8!`< :CQudA]+ݶ'w '/ZH1St ^V=}L ncaF_<;xJ9GbЄ*OOJ6Q=qΞK y[pWxu=t; ;^-]O'~FUȟ`>>A~ެң7OM lqk.-%V AQ1.n4r:p9ӓ>-q%}sĪO2 /yQ8>P.FEߤLQsWQvާ!28J%yjl~Fnp 0[/[k(Mő)ݗpP2 4ޚuOSF%Q?s8[@AKԕۀN_>jt%n~Vxo%6]Yq u`&76žg7ij3!b=Q5j5o:^~qJ!g9}xF'_c<`S`UvKi5E (&up|;&Nlpm?8,fNwƈqr&kU` %QN0`lj>gys+-}nNGF K&V7>Am~И[K#*'˸@6tm[x,;Z뙾uwkh}"tuq ):̞0YVjf#Z883μg)Ƥ SBÂfÖ,pkEzV9z+8O*]!af ;ghsUGY)/8%\Z2 .I * =7wY?wx LѺ}/W 5@u=*L>6D h( 2`C۔3K:OO @)riBVL.A|P0 |UgLHu*^.u4!\q t&*:ֺHjOWz(FRs0g#@ Qݷ\P2Ԓ\_Vt3IdˀjNwrOup;$waoy !(fέ*r{Uy}MJ2[9^Θ ``K1+/DJYtź㊘TQ>aCpIWqD\;QG<1)@_PG U썄Gҳ+KQU]}n~q1^%U ^pMLhż+ޛ6~/ʍ;Y[DyOؓ'}cT7"VeLTal@AycU~xUxߵMV fHv½K vR;"Н 'u[++`785 95px\ u+NX[ o@Oe9b`!KYk ^.6_qʭҖDk|ۓtG6Zgok|n%kbxZ>{A8)wbL_W9+'L~>hjESyn/Qou+)`p냸NkT&a8 =(\w ;MBT^}sAҧUӭ >`O0G +nB]9U^V|њA7ؗ fnZ*rG-! 6F'ZQRo>33T"E ݝS)]s]%a @ǏR7&7Dqq*Q3C(!L=땨+DF͜nGGq?m,'~T|[hL Tə/\= u@ZEQ>! g ;HkEx &Q}?w3ѕ@'W^Ƿ A - G(D.VD]o^w<;`?1"kkRcDN9'z\:y,Jއq>̕~<}{Շạױ.xV0Gkd҃:d )nD*>zvv`KjBugn}̞R$+`ɂU1Pd6j# JUH}F3bpuGf pi} REP.]|?pp}{g' ͢o}n.{ufx֭]{μ&ovƈc&ϱrm_EZ ̭ЁjR'o13D ݍO"xyGbT ٽGI̱$C?Lu%OwF^0v<<=D<즾91?xߊMpEБGlR5kZnm3}Gi'5Ō_侕-֡{PLċװYIxwxˣkt^MݷwJw\[0̓I%y&Aؚ̍xעNOX q/tPI)1 I[$oBΪ\k6<+y_{GKGQ]!G˞xZ[k Fk8cu;hlIR.TN=G}٦ 50cuD;OoDkӤ;&Q-zjY:X"?>d}nj-l:{iT5~6Tg/'vOD#ϒ"pC̝=sĭ*D#G4IeN`vZr1B1Dҥ/pwx%5m5Yj-xȂ>s ) 2еڠh?{pS3Rci=pmV`PiLhKU>˵UmY/.wrNƥ 8ЇX_o>YjOtiNVQnr7Bd7@sߗO~?|}uw?9םSF8w~u/S?9*ƴObËZ7D z7Yr~ng~v4;RMWg\oS?w׻c???OKt}\{:,~G__ARa_oUoN{\u7~/__w+~N.;WS~up\UDk>IQ4~[?oſ7oW~Z?Iw~]AU4#{~=4Byg}ЧЧ> U'س?]XgʋwI}7ڹ5NYꜴ~Ʒ|~韢c?&^9i^ܯϟQtm_ύOOF:#}Oߋ?Ͻ&,Ks2IH?A.'czfu埾Eߵ]ٻ׏u>x͞O>o@ >I>|g?W0|7tN-Wy\9 >"wGoym袆8.tUir̥|rOgى to$_߉toŚO8GGU6N}?e;y_H{Twk2MЯx׾;o\n螦ozD:uoT#t'zowCW5%;Ĺ}}i^|]] |{eUX]CQo~Z"?X絞3߮Tr߮:~rm_#į{/bCW~z=nO;)J5אﻟEt >*twS~:⽫Cqm50s/k[yy'z4_Vj:cǫo OO'v8_/pǧqk4X;~5_~9~Y{^=Ɨ9uDֻ<}h~r79ۦ]O_"2g)<7ovx W>Ox byޫVoϯl}?o|uKY?]_u >g_c)kLW巋Ў\W:WOZGt.J[}}Ӣqz3>2ÎOΔr&ħVmϹ놈Fgu{n|3PD*0U *ky >V5^w?Joo|c߿ןOYG<k?]?iMڿ[h_W:k_o?o#?ǻ<垟?wmͯ?}|++.o_g:iN1N{ ۼCEbZV83>| GR~UU)(r+i*tA<ơCC8/10 DԝicC#.Z/aako5.qEM,0Ŵ 1{g2]gP30ǷM J_P;pxW~;o=Y:)bA:|G;nZѠn0V1%/n& *G|is akx`Wrs\с)8իީ1\ٽEJK.zέbM+]j.ы}xׅTqi%􁫚<רOx)\?@O3*fԅ #v/MަDPrVyjxP^mL= +.v$tc𱛼+36uSİߦ ]IB8ޱYi=#+%fL3JT[#厾{: |aNh4\Mg^HKbgGk7Qs-FǦmWs'J.nθۤ '35VyŵL(ibwLhXMβ#nD@۹yA0YvmYkU)CW|4v`ѾΚ:ZquLf{6.8#{>䂩PmRu,tRs7e<8,irdB cqO27s2JwoxԹ<cYNޑ &|fi>gVt\\ >3"b#>W5s vej>YD,1n+WOWS};;p/c-hT4QT{uuD}mB H%;F7EEFk<7ϣ8QVyC[|.Ms8=`|nju(%z+"L*Ytα"kQҙSCI~cZ~~x[bʃ>j^k}C-OXݺ/"sHeqsPrgzA:M a[ﻮþSNJUuJ U{N1y,L9Qٲ❉|{pcC'c#|!HXTnGHU!F'̕X:'^ j.Ee1yǤ^=>%(BZ^xug! i:ޣNa[o]si["[(_T1 EݟȆyhUr=*ŬZ>ūWJ|IJO4wб}3cL>ho`bAo+y :R9ϸb^tAԶM8W*b慚iפyϘĻI-^P&EA:!q*VpcW?LgƞWEޖS)~-3b΍♙|ufuq"[AQK<'á"ވzcwO2QWQ]TR {dzGyy;⇪ Oܹ)Xmt(KɗuC3]Fܸ=5S{CR܎w)7Br}Ճ]ͩ&DzL}]5%:x;.EgʬɎSUS!Ʀ ]ns .g)|vߘe :v_;n4wkCf a3煈]V:9v W#sf܉c 9.[xiOf9u{T͞1zհUG|s>d4>"t93D>a>Xs~z`L>{QNζZ:^V)YQe g4ܹS@5vKTPiUZ G?Ǟc"81H"uTU4;PAE7۸e7ʶZq,grLW߱\0g3K׸#qg%or]{bwjQD(q9&P%] v;ID޺U!bpQ^w[;t>s=Qg󉺻թstݛ:T3eĹϽV w +Ѭ4k}Z=9/r)]c6ShWs{Oذf2Z-˅5~۞aN90ʴ"TusO\V ouAϠJrb^ϛwxK"Dv r4t93;y=!AF;zvg8);VaZAL ;Ht~f t6۶'{nrwÊiD '4o{?i)WW=?zR/˅fm/0MHk)%K?=n,?qs^8(b'6U-VRn `>s)(~'s1ٱ2nl ~lFz̾,~P7j*=%#W3J͵o^DTK4#(CM\,-Oh~妸TUgY:\1\8CXt *gq(A ѥ  7n`4b-x1#E[9Xf Bp,yg XO\Gŵ 8u/:`s?n:3&Q˺ۘ8`=AEGo MaN;xjőU_va/pWᙽs9.wt Od P_vg錗G9Ӹ]ŒZ]G|'2c;}ˎodOK'[U'jծg8漣j3nd,aڏXKӍ6UO0%S4!eqmkjwh %کUeJ#lx]gte2ΙI7i'fC78{P@͟Yǯs}]g)-\Iôns*pOAkŒNճ<LjqOO1gi6%ZO i)Kx=D {g*Зg˪u}cRْ9=ΧڴsZt ' VX- TX%)@-3PGx Q/̅gRucm%k>>10 ]A/_j}ٶ{nktl 9oB]gquVh"͛Oh7DMt<T5'~ut/{"M҇0UDXy՝{gQw(Ѡ4yiqt4۔uUO14 =4]䀑X Č J.m:Lhߨ/Ϻ'}ji0u =ie'jNp]Kzo֧%#WnDk8 ,X9Bb ,βqUo7{%;iNcވoTr7$W3Yv韩8ǣ_^?prw^ruxc^ĀƔ'}}?tEXXMZ74nxRqnȦٰG6$ /Ӯ i2!*ߘpb_/?70]O7<|s|uD ?j*4놞vsa12y̐}sIC> :|5bྚhSxĥx%V+>)@kjN4q:덏TD-FM^2IM./`5%f}ǺA>aI^˭<21H$~+7ȿw 17x+L5laϮO.:'^My25k5^͒6LaYV}+08$g#NCUxU4j-?i7f-791.Zky24x!\xvqR5uи$=e2Ƶ+_̉ <?f ToB|V4s%-M;҉0ʫ=%0߱'>n]!+P4bWVƸEqUU5 TMKgbwq=3WMگwOH?CՍk:)*tОh~iQ[꠆35uL {OP4odI .][yO{o'8\^x/RgGװ7`;Mڔbc5떝veU$K3<\UI@:el=iZ*zA%?h~A[cxԨ9`y Wm4=ŎX+a/*GUr%,3jojM߽x0'16"'NV MBO$f|MınMK֧?=.% O;[nUѢ'cSW-jW[qˢՒg,6óKp ]ʓ.wt}0[OT7"B%4s!J"jEZWCaW$_K/wIvI1):p${>sT]`mDn)C]%b>+*ukS+ ܻ.M^ w"=܈zRNc:^u5I/ӧ/kKw;؎ć ʱNQŸ;Cއ3̩B%Fp XoqA` ̉ެüʣt23Yoy=M3=ZM%Ts%{R%"D][ RgaFJڥ X\QDȺo҇oU5:m]Yjfkjއ\%`zSr|`zraOc"M w0PoЈ=Y>'N1Q2i&T\mۂ&;=9⥈ںHoIt39Ya7 ]״iPJ.t]_gt"Pv\wI3"v1=C ,ts1qGuY n2PUBwTY٤T5KE5ұ~P;*,MlƬzEU^K<@۔-x9U5V)WMZlK}i}h]=eUEWHZ"V@mXߞAnMjT䈬kx'tܷٵs(TSq#:qFř,V}\(hvԜ2.p yĊk=1Th6)^ Yby ~c.k9.%ž +ї@-D9'Hg oEnxm>]׽9zPFџS$^۞pe& < LgM=o@÷{(H3hk$+zxDjCJkȝŝ?ozUƺi*̪ulk?5;b}ڣ\W|b9K砮R<5e=[$}nќ%׃(W(t9¦詮PĂ1@9w -c_gRR n^|r 4w:ݣhrmÊc~[]V};7eC'yogƛܹFmtYJ., 7UI TrB ߥ6zPz|ZX1|OszȺGTo*pG:1<^*lRu=ܶ|T n6P.U`Ma%>Մ!C No"i=_Nv {#z5+b`7> O̧|oYb Ht**cN^e$ưA]ub 6? 5LG]zLٌܲQޤONG}zlN kϦ.aHz$e}soyV(fX4qjX9[9^,Nc>(\鈡]ڠ,JjOmчwo'`]7:~V2W_hj*~NX-avuLr:Ċnu )S#m] :Nsꘃ5QF.=/^E}98OPw.-oO}?T.qd6%n6'cphv /|<9VT={Յ:x{ #mt*ʪy.Ut\ߺooaGIgX.tY wЃ<&$jy0^z6qaXn'7SY@ٕ|ez<^Tx8~mmBJcgBWK"xJ|ml&.iDYC<`G j[琹/_Wd%ӑkOxU DzN뮪=ԅtRR7lol0_}**FS\M=k#TD*G 8t gw}X?na63Cf9T8Ѥ%8qU%;|i68K"$k9VKGf6ĸ-Cm|)]앬{u4[|'cOGiD4ƈO ǝhs} 8 0&{t+4i:fa VV?ȚK͓- tp3K1MLmUeNC a;KWХ߶w{Hm;];`w8  %?\/-Xӑn{4M7rO )3ZV_[SF3y:]t6NYCuGrn@ Qࣹ)2.ΖEWS~/*CWGtF؜69jߒ=~8^bUWEu! 63ۡ\l^W !oL<0%#/ĵ$uu+LL+¤Va}{7N$QT@_3W #w杧}R^xk-ݫ(_[|Jz5\zob1uX֞LrEzǠ49f*K B^@D"$vG;khne'=hZyWY:۵p-\kި>|ML7MV$w кϻXgPDd]]|[)]Lt(*Oa^t*׼xY.zcN kT8IEux[9.m| ^rpX=qEuGVĤ̘ ^Lő&Dy`̳腒 jxDO$խ)_6`b> 3{sZ H&c2g?{b\˕rR1>+Ǻ6vG<P$nngiHN!c[ѣ } أ1;ʒ2j65 L4+l \f*F_+VaW::x5ShZ uCD&-:On( ;e>?FNDuH<Җ~9*U9:Ё*{=&+5YcWkQK<3ՈJ{XDW Ǘf*b`XXYEKy=|2RA&‘Xz(cLJqUtk~$(sԞ|"I#STÛo8Xtnzt[~8!}SVT^` \Ưuvh96 /A@ =M=pKw)?[t^"ţQ `[T̊:«܊4KPmΎ-j%p_CԸ 93'c5H+t~@8WcJ_snVM=+Yi}TK|ڶ>+9.H}N3e˙Zr8 ~xK5qRzJ3JйuIҧ#Yw#ZZϩfja=WoguBb馣 ޢCG]ԙs93u\ցU L̠$bsӦ,hEޑkxgnb“gQ/ ʳQUPS~GQνÚQ,l/P%"▲4tMUGiOpw"~[W:U}M!Ss~ 6j ߋh\_p,~nX# J{9cպw[*u=N\ɛ2g*:^D/}oy#nDwuG2g܀|d4)q53Hzgi?-eɟ3'hT-(E+?ĩ*Eu{CȼH:[mZ gV4ن83rT yx z* uQG-q׿"zM0â־UPQ' iff٭>x&jA yT-KdW-4)T.JE d8%^wO{Xvc]99@9+ئW Edh؅p!j[>A[2@MzlIk4:S6p;{>g;Ohk˰ uP˱'Hv/^:&̰YsLPu1֭|Xg:蔒ez(zu :.(?p*7^\<zJWJf|bnv(h9<|*$ALS<$l~ǥ/Ěn YP,gsRاlE-}MڴKyx>!K! fx(OEWpt^*9{>zM L󪢃x栋(GwO:tw>Ֆ7ߡk=.ɛmj%\`Ida}>RJwt,{ߡz@gPW=bǎ]YKVɿ{(5hܶ.du} Ya ,j+rS2Ӄ9/~A.6`c;ʢ,{_4"JӲ3+68&j0pptqq8Fچ)\Ѝi ("I/%N!;~0c <<+TX\dlNRYx ht3l_gҷ^e&,Omw#>tzg5}Hp-/'ϳ4 9Mw|Ί<봐P!3t<1[{K|+-)KSs)ژ:]OVQޥJӄb66,Rx?0|dk+p3ʘM9#xeqm{Kل`{P jdY.#` 'Q) [ ou:^`I?ku= 7RCz۩].}?&1fOʆ}}aBŎl{e ̀CTaclGw˝{鏤(Ru|^YРVhWş:Vl4Bf/P* #r(c`VѧR %("x!FriI#F`Y}J۳~z;rh0V>oN(LR~M%[=}wN`h0WF-j oO/K'i PB!AO(vYhYoBirFUS?T[,QSÇ^y6Ev2]ujrwkʾO眣)fĜ |R]sP];g{Xq/)x/(ʄu"gq颿ۥ>? jVnI{z'±'7b psV7K*1^~z|'g4z&=&;ַb^IVGRu;"C&&1эNZtlW\jBkГ'3M M &K 'X,"lCO7Z\453/bӏ_ 0ExcN9"Hxf,=@s ,UsIZ\t:Dv34{Iyvا+qJ{2 vdT1',Cuf1M,7vStwhTWd`w Eh_Sň\ >:Nsnס:392P Viqz}bsM~wui/ug9>]^S` >-"?蝻:G?2VՔ*sq]KJS\٣pVȔ;_濹x3 ?ThBcuţ4]ؒ>0:Iקza_ՀY+:0+Y9xH˞̾XjٽjqE ll@ԋ_؅ɝK*~rUuuqnG40j؇sB07JǺCCJζuĬ-K%={N:R]BhI[b4uvsyP% ,4-y"cD];#5=_ص.b<6eUU)d%V^(7j$_&F>r<^)_1q&:mC`7[<ѻ*wޱKZغ U7L'&t4QO)otm'5Ҁm  :DF(3&⾅^y|0}ZNϚɻwe'pWuŝ94Oj__iy:E; T=s_Ҝ4 .rnt},r Ң5śU5sB?v`\=s]C]XcL)Mˎ?-j OԴIuL. LWe$*S֓"%`T1c~3W_NMQ隨z8% FzEԠS 6؀!it?Y/ncw!x,Ut塱>,>2KSYj9\z3vU/غ 3\Vh1k*OLqs#{}CJ'cme鴄75i }ؓ8B`i%eWdطF`Eh-v?X+cנB ]UC)cj=vNdgWbLvu,UK\-k<&3{tjw?-jXaP]ffZ+wxR>g*6J' &VxeGuò|C{8Y^i7*2qto9qRFa}2-ۀ>_<SP;kx=Tz>Uq5 ҄}]ه48wP^`3Zk$͂4j"l]xˋW2a#vMظRK x:v鱚Ĕ{C7;c)1t ;|ڤ -LAE:k \ySj9}Euw\*@]9)rF$[;+ڠ7!9NYu➽Y]uyQ-DBYMtoy/G\*{=y3p~T-A,jND]ƻ'< 5_SRl-[)\pP"ʿ5vRzݵsޖE[M#˴٧|Mr`<"̧a ZrrL0vȳAwjZIDGWYY#d SAg~oj1±^}#tzOgi>3 wr2GveҎ0aĀBN?giB5ӽ3=UgÊ!h_Vn窃,RLRǤ8׳CX¹kOd=qmsFh/*-q9v?Xy)åRQ=?b.ur\8eÿԱ9݆Ly}H2)S$ 8s'9KYܾC[q'^ӮUm< MU>WP'c:ڕ]A4Y)Y:;\Ȫ٤^\,ĦP׍ 7TЕΚ:=+u^m׭ Ի ay;nl[ڨ o}"{ҥJdY65/ҩa@Ux:BFy"֨!>%K1 )D:>+. [^+u1C̱ 殧x T˹x"pѻ?Pr9Ğ\ňL2YqۄfZ]ۢc}7Ec#&pboJYԻ wKCCQj 24(;?{lہjKpyWrڱx͝Ӑmrl_kP׾O5bOhnnЂ ݡ;Dѓ טWS[e^yk9VR}ҹ"5ΑB{rhrAA AGfN}](:E6$,ܿ){ױ #'ѤN _ =Ѣb˺%^y]:=B#빪6Xl3Zz]&vmm/lXG|m5i^ܓG^T1+/3! ,{QBvmvLG&cRnpPە71:i'8*=qQEQQ}@r~_Y:=x :k2\$~-į5PpvtRN";'xBYHR.kKKj]adYKnʄ5=k&3eQq șК_Cz48ԏ W&B5`Oi[44&*(TvK9&0ǃ Uo[GuӾ6/u&ы>a_|*a}h3‡Ӱ{,M6koW| B"(a,kǹJy~ҙh5 ;pgOiEW܃X|0bٔ}47팪8ܣ'e\iv{w4UOc+UŬ_(Z嘖jBr˳9ܕEk*Kۚ"9r9ֱ9CӬ+RTOZ. *T~3{U'#>ҥھ-K8Ak_ф4ES;ov)4Ⱦ*b긳*b@*|}}ALPOJ*7sHmW瘹D Oιf!B+rxRar[b^hpNME<ʙ(m`(CXJIXM66.aw9W;cRurTqQfL%xon"7"2?D bK_7NQēf\сI.ѽhuj7Yd8Ws/ovw.f鬑WG~@y~P=n4E%x+*׊Ohei* ?W^^pL٢Dą4YK-`%F[eQ= >. ]p'7ݝNU] G,qErv"E'2es}I$(?n̺P/)Xe1 mx9Tlwn^T?Do4k'Z 0=;=ӂʯgDg@ 嬩2[?=Í,p9,i0lљ?\OX)7aG\V6+SY'PQc>sUi>(f[Zۑފu&_"a'K!;Iμ\0߉n rܳ1e𭥳03>+,&e[&Y?,Sċ+]D\}}9>T4Ǻ>Vm3\渀t0iWc{P<%yK{^,t.v솫(/"/>&;Tlv e̛gr!\ ޾?L*+?Zgc˝;4}mДx]O{`ı{DT"b.Uto}Ӟ b_t}Rs@Z=];bh1o zʅ;b2v}J@&.dD^?Y0{-=vu`Šɿױ搄Rj=/7{4䮝Jo>!ky5G=GtZYkqj<اnfm<4m vҹK404\ZЃ^{+4WF4eP,>|pJCX6u>Ҕ={ICi5vwzp+W}^Rl`Ť6\}ׯП;.#j /~ SΔpƯU kr\MroclnE҉T'jZqxW%aU_ OC(}DF8RgZx<銸x[cЬ798bb^wrYǙ Pd˹BoQ ;f3ŽZ.C9MOT Cc^AEߢSY+'fCr[BHg)M"KcP-u}ZYrAU-nw#K'~[+AvkB V8Y^v"3]GEeq r>'uO.:8I c߁L8|wiǴe ҄imPUT~(nz@Ͻ븅'EF |?ܩ0NЂ-cnbHeTOM$x׳VX= ~.o6DXGt[yh=M+jn+zM eї4i5c2K|<c~7W~]]s&D^AWP5A:6gwJxYkZ: lo̫PV)?uw^UiOa -y;q$Ltb^,UlTCyZnS+䷶_45z[{璩2-]L_wDu_ zՁz$7&~auhvD:݊'A߻Kc/J趞emxy:C /rLθNe:iItmkw(Ϟ^Ko4#鈣/V*䔖,P-;6"~o[RYJ{QEP-M-;uǞŦpR܅MNSe}<b }Du\F?VU>CLM9,zKhIZk&晎M@#Έ\E dpxC3YPSxľ~aiʊdU oviIesYߡ\;Wz $uy-"rwueGyn TCK~*C4mzqt.sY[)h 2g2ޥAAD1ZcudM>gi>R]%=~4 gѷu`)1PGjXU[ juۍDfMLy(.Ltx6 xL0zuڍnRmMdi=#cӑ<\};r.vy1mFT̥xծ.\=McimFmʘK#@)t!]J-52ЈN};Vզs=]e:P9DrC1E'+N@0wf^Va[v}Q/Y/Ue*58V/CkPqYuV |e[c w)~F蹊Z.[;wrMI,49:<W?\K]U@_VQDDQt-DŽv$y2TX#c*N8E+M+w:מufr5EC^,:xrlP'j;]/wy PcU31?uKp%.3Z+5@e/lb]}=Ԡ Zu+zjjƙx뉉ySڛ&Le1ŏE 5˪,(Y:1CUצ TR䌘l TAUqtKp+u׼6hcM>kNӑ]Wahz{h.C.DCG|o+:LŁQ왦jc+ /4SCEy@k h~ĩ4mhS*wCe9N ץ;~+*diudi{|6%E:0\iq+3M Ʊ|uH-䞆vlfDMNMGHAҬCI O`}}b/`1KtUm֞nzrΖ|jLW=@w` uG Y;!K A_boeiJpCG{Z !>TMlU W-!?B\jWtpaL.ywotʁ%pG㏹ T[!/"әdͼpq(. iu)^('VF h*fykZJ莚dC93_zzj@pu>}dGFއh=]л= 3/s{X]k9pVfsӭlG\-=T#TԯKz}=(7Rb*ptz Y;UFBXsVho쥇E9q!?izB/XWjK*@6|#|#iJs&wp'C_zѧ&}rYV/BN1qJJwn}eWVރ-S+~6";mF6|"(D ]1xzCY  3=ŏ6C] 7G'ٞݶK8tzOjZo4cȮM=ԺܵE{J'lDK#̦곦z^\+,MAhtܚM<_rfpyO=Ug2=.[141%}E>FY;wMbM n+H f6*5'=H[6UkZB;lG-BOҩ4߾+&X{0W9:_L[ݓ B D !EqwwwwD' q'=ZߞϽ9<+/RZe}wdW:2=<[^olwZ̰s!Q:¯LtJsZ~52a+L{+}ih273!&_k~?l$m=d?,; E"$3sϕj|w+2Y~sj9^mq~2ZQzNYiVٙA@c|Ki[lNo_ -5M>rFW:dd)ĿyWghZPK_C;w]zσ~%\躧} |={p%~ZzokWq|w>ާ3F~+ }bCNG[9̯ _S]G[ o*}M(xi[X+g 3sGJWm(O{f`k])Nq_y)R]YKf23w؁o--YZ4'ft{M8g̭=ߞ绐{z [zG,,m{{L-Wc3e+ikZ$ךf;*rG}& n?Fun[!h%C<yϗoj~Biע5s=tri=xߵ01umaE3}MO-}{R_j\;g ]c^;zsh/l߭<3Ǟ>cm^?uߩ>4_[u϶Amﻫll6f݃DrhJO3=FɞI}g|SnjP'yU%?SgT;<=6gW3ܟ+xs>)== lߨ׵jQΦ)6j$v}k-}wDˌ~z\=Э}m^}-Y?_ռ>_QGy'O[Ź>᭳̕}06[P7ZfKS؜+bgz^P5>rGoםZ;>fK#\ <̓|졞iQm_mo*܄hisZuV_= 5U>޾[[H#Ǯ fQ|}8__<{~!'e&j<~d3ᾆ ܠ^޺n7w H)W@Wx`w`el<5>+^.t^ wzN <>O]TU~|4wZW&yZ~a7ƻ:kjG0^}yīYfQ_w|nsz%6FUE[p |k]ћkgx:G[^]mtyfϦ{ޥS]3Jի%VņyQ־Ja=3} Z?W4|y\rYw f?k14tR-MZ3|VeLFϊgކyf+oW}V=_O>3}ekkg!fWeo,\X<>˳Rw~WnO k˼~JtW/}syflUj_M+Vg>2LwfkQe[\|ϕ.e|=lG8)^'N<;NqhRmmNF/!5_g,'z?uū^ύ-O9~ms§:MsZ> {9#̦]T)Hüe=y_#k}5δug+.s2}R^SW>7˯qe΍b?~w_i y9OfGuZOsuV}L_1Ug5QZՆ3sCv8ՏaK bWE˼VL_ԏ:=캑<:urj:WvUS}M~9wƔ{Ll_?8Z]t8OY !N*J?jŮ+y=t6Wխ*^i؏HUJ2qzYe+lb&l+{Ny7mEie!Ʒ7lABxT߅DUbΏ>w'QCWcUmϸw۷hkKܙ^kwM<ga?W9*pxWx׬As۩=Up%f~HQk=[xO_Ԕ^[ܜ]=D?VW*{!kcm 1sz?y{>ҿ*ıYF}.u_+gp7:|S~I[Wd9+1,ai^+UuWGfyN1{#F]ŮUdk~NȚuC;)y.LE'[Z3b<[xUίd2~Fzgq?V$+UuwY*~e2kl^ϾgnۿF:gE{>yv+o} Lu:G׼׈__VWìQsFnV[dn cUVe:s 5J m526bӌkC;RnJU7 e8eʲiFe,lQYY,aFeiU2mQ|*l{P&)!Y(붡CY[ e- e- em:M(k;;VL?6>c3d22ʸ[({22 e8!qb(PɡSBC e8-qaz(댌:3c,C?st/63363 ruƺa B̴}^S2,ɸw 6; `fLdvϘ~1 .9ŽFcDŽQ 18>C N 189SC N 18=3C 18;sC 1(K/ ,+ >:k >>o >9[o >=;|y_z4'O >y{!PWBݗbW`|z[o:/ u~'PB> u8PO ^Pסb`߅=3ͪYu4g`aVu|Y"_ | YjVogYfV߀EMX;+_md嫍U]փ{p|iV> ~7ʗe|Y/m ,1Ɯ/2sh1_ۘc1|mcƜo2KH6wAv۠u*Ab]V1U *]A׬b-t*=AϬb+*}A߬b`j`b?2*Šb18X *òb0"U FfQY`lV>9+[{ u>!}bPɡSBC u>-}zPC]焺ņb{/u_OPCv>8$Â>8">8&>8!N>8%ӰY^'g|rv9'|r~'bbaa]|tieGW\|rMŵ_\|qcM7|pkm|pgw|pO|$P'Bݞ u{ {:JP簫C_u^j [C u8PjLr#|քZ*sQ\@eް@eS2oT2o_+AX\26Fua(PO,POo[ 2|bP:^:߳-57o3;v/-&p~m1X ~o>ycIv; ; EX[bwaU{Zac-X1bc-X@ .p#awx=1<>x$ S@x*/c$caG+wagp '^p a' ~pN 8΄,8p¹pG8p7B8G}hcpx 'Dx4p <9Ss;wȩS1+c9sr;w̃g7<^S[8vINmҜe9sjkW̩֮]S[:vMNmڜu9sjk7%xSNm-9[sj{n;Μ⢜]9Żsjͩ-ޗS[?$@NmC9Ňsjͩ->S[|<> WgY |~ E| _?Wp) w oC{f2X߁0߅=X#0? X~ `u95ᗰ\W6\ 7_:օz{1nX `16FO؄Bo[n s ,Ma `3xlO-I K)<6t3a{xφ9<nσp{x/]EW>J^^ @x=op 7-pvwQp 1.8 w]pWx wKXCp<|NQ8 >',O=Sp*|NY8>g, `ZC>bZo>eO[3o,|>_× lqXR;|_- ;|߲÷-pcq-];|߷,C;?O,S;?/,K;\aq_Y#`q_~kY0?<&_7е`5;5]|1fms6vB;`;`dcmy;`7!!!!!!!Xn7[:pkX6`S1nMp3n[%lK`1, a+al V=vM`Gv`3n av-a7XR=ak a['ܾ/lpHs"F4 !+ aw8,R.0US%r4VNU5VNU-VNU=VNU#VNU3VNU+VNU++0VNU'VNQ^\jX&rMcRʥ6KՇ?rX9UX9UX9UX9r-cT[ʩS5S5Sm+j+6VNQ|K8FI,Xg4ci_(QQ|KXK:FM,Xw4ci?(~QK/_7 .WŒ/zf 7o|e |&p9LF楍TK6R#/mf^Hyi#楍K(/mn^HF6K4/mdF祍4K)Ki6(/mq^yi#[楍l6u^Hyi#䥍4Ki6"/me^HI^Hkm`Ua{X vaGXv5v 67]a nú{a/ 7}f/ [!pK8nw[a plGm(-%pgX wர5 öppÎp'$N) ,]ឰ i{ {Y a?8pÁpo8.B8}p?8 x Gƒ(x cap,< #(<{ca<8'“$x2 OSੰéL8gLxυ{lx>/sp·ý%p.}p_x^ W4 <>π3#,(<>ρs|> /b>//+*^ _ux|^߄7wp9 o[V ~V~f \?K,/D푉ۣiG'nIH=5&kM==&k{M>eO^H&6{]"mD i7%foNޒH.W5x| ߀p1| ߆we.w=oG"-DZ#Gi%҂O?H ~2T"-DZ3gi%҂OH ~1R"-DZ+ॉWi%҂_OH ~3V"-DZDZ;剴wi%҂OH 0Q"-DZ'Oi%҂?OH 2"U"-xe"-kXI H.&}"MD4i?'҄I H-&{"MD4a[np6&\J &K ­`TpJSiTpJNSiUSiRiSi5Ri5SiõRiETpTpTpT-Si[҆N 7I 7M oJnJ66<6\J.M J N I M K O wH wL wJ oJJ>&%&5&(&|p*MT4Ri‡҄H J>*&|t*MT4Riǧ҄OH J>)&|r*MT4Ri§҄H J>+&|v*MT4Ri҄/H _J(&|q*MT4Ri—҄H _J*&|u*MT4Riק҄oH ߘJ)&|s*MT4Ri·҄H ߙJ^J^J+&|w*MT4Ri҄҄H ?J~(&p*MT4Ri҄H ? O҆N ?J~66\*mT Sivӆ/ @L;6lw1mT면aivOӆ. JQ6N*mr?=UJ#~?Fl1m6lL=f ]RL,6lw0m4bڰŴRi+Si_҆I J.6lw0mTڰ^3mTڰݓa/iö̴a?iöʹaiökʹadpaۈi_a4ª҈TFUFWF*8*8*jUi:ր_špEp% o`-~a=7?Mp3 ^ _=p*[/9+0 "iyXLaVZ05` kwnR?kAqgZkNg*ٝb0ۭ+LsW+ R`1wJo^ɭ?DG٣ptvAھ2p~_e[9>)CBhK,Uvn:֟Vd=O0=tW50.רXZ<Fw.Nne{GFw \~zœADzu)sUǁ^nSqRnG[QS3ڢG6| \QIwۣ, b_gwJhw5΋3mQų1s!8-vCU5AV[f~S}6v[+1wZW݉\Ʞkd6Z~dVݻquxo5w+_r~n_~]7\ru >Pć:ʏش[8dpO/={-?^qq5HG犲UYkWbuWT<gGov鱊3{bodzz:y5~qL%V^BsZ0m])\u~xl5͞Ow]gx#W#m t NCf ] ` rf#CAp"r# \ &YyANK~h@P<w_Un:" NCMWU]3۹1vs}p¹lw3[+e~2O5)Lp85rbxtUqfP<i<5s.E%/*mfC8CiX @y{ưR^vS("JXuZ@'vҶC3ºs醙JAH+hf.V ; ⽡L$+rd݌79/.85"XfJr`a%U'LL2X-^>[}sCuo,ƂFsaE)߰tVa^yJĘ:80%siVl ,ٍ-`<W `h xB%GTǫ gAU6˓| >5Wfx_|KL߁mxCOL@n\>+xx7'Yk50Sm/}jr`AǫbɓԻ)p5/ ]Z{z53 hM+߱FSB,'rxxyzu(xՉ`U ImT-8Xqm#Q-|.Q0{[m?q.>SnlFW7(x7ŔcplnZAk-RᕶDnVyLG*ݻ! t̻}+ndd""}wSSA8tYbVp95njֻAњUI^\' }/ 8e{jA^7A9$MMCۘۿ1mۿ7V\˶mp.-Ut m׿:95Mm9H k;}oJZ&2߂E="wl΂2Rkޚzq힟AhX8ZWLD/_jA`!ȏ1 sR2HAv%*3嚃_RYXbA:/B፸|7ձVlwUz('* 7`B">ׯsسoC G{Loِb]IpaaDJ0w{Ӎk$G,ns4s;L 3Ȝ]-o{sⳙUW5/'Qz[S.\"6rڈ^ӫ\(߹6NE>[^&7g3UBu`#}?p=bDay3F= _]CHkҲ`}رVDK9_ug7Tꃛ.+_kબ7AίX\x]ų`%3&<1X TPU\ cuث8?Wp | 2PqЫkBi{A7^B㍩p JG Z 8i>=O_Ӡ^h¼>P}H_9Zȳdd"Mk\Jӂ &ʹR"^oB)hJN124ci[hV*nvԊ+TC24lF~B=gR:*+8 @5 TͲ1 }m{ /6׻6Ia.L*χӪcbG6s T 2 GrT·i%T~8P#8l:cgR&bMd NAl*yÀj5ѱQ%9vT2 ǖt>L޶Z+0b/ɍ+OhƵQTc5lOsأWƛ",96\ʯIaLCl{>v*b *CVmXZW6"f@oޞ$F Fg:8*X طbYl@NkIO.@浞R+ԧ]Lro-|sЍt T2@[ӱ'R[DA>LJtLW$*vOЉ44+fBgSa*ᨱ=7\ P㄂ܯP=(q-:\*% Ni-ԅTm2E\ߦc/bW+_ba/ᨧ0,ba/ =zUf+.ڣ-PKSgk@&5רe+8*Te~vz-{%{Ln)GAfZE~D&ǯ :_M>-iZz*vW3h KRd뀖jָQSe끖kS˰70H TFi F*v3 (o-6Q}׳hvr{3{lp{}F6Xa\{L7;x;SoTV* >p>&ۨ^:6* rth ;݊mjvǓѱwPIDI# >N*@ٚ.t_ws n*vmsIKN~}E{?;QPt GT^AYL ާ@۵: k=R=csӱ?b;MO,4Dʱ-vVR[!%Z}B/-}l-0P- 10lL(S`I.&^`;ba 4&ЯaQ.^RCerQȰr:>G}@ 嘨G#> q$ ; ߧcG^(N1lSTfo}|h;T;ei>N0v)n.gbC@S mFl\;ӭWǂŨxgyt*,$W?P܇ t\w&VYsojM(+;*a9Hշk 9b1^@7Y|c( G>kIVI}qiU߾myl{8&~Ⱦ%ƟmogNk? 9:Eo\1_<]/׶i9a`:|]s66Yvnk;uf49#lxkۃŏG}׭@ULڸgOngܶ}ji!H -,"SW!-$] i!Sz)Azkںֹ1)”^ iUZ_mJ1BZ:Sz)BMMfH/3ur7bgn#vµ@=9Uzrymf8YP\β0D1úSi}ӌ= :df8 wڪL3OfzM!o{{A,{ |?Ȭ Kҧs*L3d;,d27[Yl4&Tj64Yy'̻ uȉ M5 Z='(4=:}Dn3Tx'ä:ݣspe83hLကױS'IP7u6IJg TwfKs+:ŭCj(ýCc'O`օ+H"ke 2j+dIn0ׯM i3מabm LmGxGʂǼ8^[Y]{+_ wzY%5w{Okg0Pgl08u:u >!!$슑8-HHwW70G?vhg]Q [p9~mG=qYe=o\j\a\25/[(Vd||L_P~}؟O#3*|{}y? |V|i9??W !zONSx 8,{?٬'U"!jk BVIg#O[#"`,B셪yxv*ghJ 3{ؾ?%3(2ֆ[7i!IށأyUa*e9#ᐌ?v2*F`Vb:X> Dk7,L0L7v}?+_ Su6b*D2aw>r Q˨`K0modGVsM&R\E\juaޭ'!UB[|ʗ1%1d&NXjw5֬}V(V& t>&⼈dg%9vvI*v ު]O]riNcb, _"]{ &E$ H%@$Pb,"A\DEApק)B\vݍ<}5gs $s9snFžJF{4՝t}m k4vsxOΝGnNn2d`鶷`w)`bad)`bab[Q[˰/` P/aߖI7ӱ[SűvbjJ:vUy`fcm5 r-Am;i;鞤 :v;*vv8 !_+}!{Ӆ)tT9vEhs"* <bjqm6чGV!;Rgy@`§y bjrBYDde)`wbg˰@Lw+ zϻBLmPc]UudOy |$cwb_QC`t]U?;|[:LLS{P/Н컜DŮ/0] *v]v NKNbǹ`[dH᱄ cQt݁w>N~}6ݗ ~AHFw?iwQ&?^X O*Tlq'@DZ:@, *2$x`*MM=EZCvP*v[vaߥbag23حe1aT dwI$rlM5! z?3̂VuK~%?>CGx>[#͉ .׾B%`hEo|Vrpl 8Q1Z,6jiiߜocbOtk%{+/~vag=Y>-MDt>5s 5,)~kCF˨<`k{ ׀o~K /bɖ\ z,UXns-;e9]!u 3\g=~RゝcF&IN[M6V_ 1m5u+Lu+tTvk=o99Q3T ǀeʉ4t8s@Vf“{.YGǞIfg1 س>v>]@d7'>1gDܠZSШ<k,"۔ZkW{^#?^Ogٌ4DNByXrM&jEZZp?e_ޠsEfbkBH6%# R~#9zi dH'ԄtHyUP5 53ΞF:0"AM6TɯyUH/ ٲ_W!5旦xŒ_|V}'B w1r_%.*v n6P}7;Kk`yF3ׂovX{-{n1V`^OrשbH}AP{;N豝p/<xQUեˡ{d~;j~D[{Ҿp}ewxkB>!mǵ'Cݱ]ĺbCE Z\ })<؞si#̔P0`,mƗL).dB{L9}!򄈴o6:ZHm͵IR7!s@lo:0ﷁѱb%~|)U8Ya*͔`od'7R*~a|/2M {&*e؛wC6mb_Rġ QI ([)v[7.ϷPOx. \q{=JvVMOye:V*vLl߾)ұQa?) OP%Δcobw}1 <{Lu6V{'nS$Kt짨VA1%+MziyHw3Eŷ2eO] mlP!xҏin =wAg!u?kBb xG/EWC~=L*ǽ{$Bn?ne jUlO_cLžRߊv}apzu3Ȋ}H#|Hi <ޠL=Q:]]nX~|RPM*v d+ͷc'9+`m!3 Z#}-|ǗU׽=kvf{raRL:o*d_BwEfQс?Pw}ڑ/;+3u}7٧ #tNtw ꠈ]AŻU޽ wtdWXO||QޠsDl_h5"'" γ<ǒܵIz86ቡ? ӽVN, zCz=l5W'^5"fAc=854yIƯCjS]#=Sz}jU͇`?1#`?)أ``/fU5Λ[US6e^UMi}$.π vgP͗] (~X.M$8SNiyO/tWT@[Eݗg&u+B b O]o\;zr,x\L؊Wk4.DDcНb1_ƅ\|;ɬ} }{jp0.TfsBOE0~3"D*a3p4m4M_r}}'}O>\6/f)eoÕ»glN,sL+lP%p m1IJ3RľVOcԕBr+n\A-=xF7n|R?ȵꢙQ~׾Ãv-_<ĐmP,Quzgi8L+2Vaִ_~؏ar{74#4_a0cH0|YWC+44^}4/:}r]eK#Oj1 gDG(,4 OzZ: 1K~^m=$/zoZ:  e@9#Wn3mZIJ GٌPV e ;l—UXVnJVN;3by+d jR_"PglQsz3&`IF7O7$G|ol=Z u!qP }¨ɃxF!.XvuܳNvS9`fdD_*fT3Ov,[M'|9d+ݜJ2񐹫|^.%_mh 9~c,,I7*0Ӓʌ6faWxWTJ ey<*칀ʞV4w_$N*|c"jjV"uv.WJMK# huRRwa79fY!\cg4Ld1\1{ B?f>GA;{ܒFG?3ؓ)lt6.TJ?%B6f:Z3:)qa6CNA3ґ 5+\s4iF7O5#ImRDs(\NEuP#"CbNEy6ΞS*s7Zϙց;3ܱR:&s7Zg\(ǣ=,Wd9R}[I. ?\9GCIgHK5-67S[iʗ$k 8E}d>Z!XKL#\–b;@/cc]ni446},׍s7Fyhݫui@Lt"6#ƊdA/F6͵q2ޔZ$[Vh9SUw[4BIlS&͛ml%: b6.eċ>͋I[~jnHB_:FKoJmX[gq׍Ŵ6CPsX_7r)2'*Gvkh"&2iyQ޽6熼v"jϛG\⻹p;2at6mvj`{ZJbo ηKui֏rr:L4F)e)KPVjNJnITf'2.vMŒcBK<8l#r%lQ/t:09 SґZ5Hڵ~O^::^Yeu9)NᗄZbIS+%+{5iC-zUYpJS =Ͳr>}ϳgY*}L'I,SG׶}kQlD/qw iƈs4-֔yѬ5aAṮ &)5M]rʧkUNVEZ9i6E٢v G!Hg[zJEZ4~M}Ҩ32h.VV%,'=Y>sMWSsŔ4Uc(g٨0Ku32 ߛH9q&gL`VJo[SZdc;2)wn#}xz\7R47b> ηk N\m(ѝܛdwYĝ٨+p;"P4quʅzCmWV1VEJQ)YFksg2ӎ$Tv=uP]{Sd]NQ߻sn]:mA)QQ֦k8nɞ=}g ]ۑ"64KgW=+&REAz;^UG./6ڠ;1iX-g>O,w{ $ɠ;?l[+|[ms V+\-_O[1uc7fMV-M3vQw!qOMVecPՏ<1i 2JJY^rd+ghoQxS{Z s6͋R9:'涖9U6k^,w^+EzT;Ll*Im1u}2~g!'1ݒ~LNy^X[o DsʣWm՚u5LU: *`FNy6r9s(.d|.U St! ?]H+css j^g]_q33ѵت?#$nlž,W9^;ͼi(ִΩr瞚BӧMQmgb6Orp)&Th2ן\KPsH8)j^1vPmaHsoxLEq V78&KzMJrGӶbꪲj\|xnαy޿}:э[s:c.gq.el[It#HVLdrD՛3Y.VImlVb Gr,3(J ؋S]vA&M 64*YOe-dCz[Q;c,a;uH_fj֟VPѭ8ΰpI42栍Q7L*bc|^6W]X]{^=K)gG3kOy.G۵uJu.yBkQcGtfiڸ6Γ滶]쳷j垏v^ d5cf]{M&u 1JB(sZV&>}=w&ޝY*gZi wmIМ a+)FhJͭyZm^gjb5}?]߻v UϥZ][ܥ,a2 }UŽgRگ=DВdqkYz%[FZ!M{L+1\HmKzv qEp^Y#c%V/ V9R&v/rY19S3hWԴ~M>&1Q|f#X&³31J=]kkр8~ӆj6\kߐS:ю\RU;[?x_~4݉Ƣ""Gd ys:ݙNvF!`'C[`w -eLB#E3ar*,oUdb'x:um>oxV8wW!ZT@LGfd[*}>wjoezf>xwnpФׄ+HE-o Ą5`;uw6~ # fpKhz+籦^yssX0{>~^\ |ro C|P?{ ,pO;?;;-_p)w?;v|,/H'#NB: n1i~t? ?J?*?`K-[v>؍`}B[.` ] - a``oU`{Bjpo7};>]nw!dfp`qKmM> ϗe>n9[nfppVpw] pV\>;)io=ܧm.p< n3K1wA)^>3fպ{J[<[4XEю?כ7xqGxYCKvPdaȳ omҁ[ߋE*ޏuń.g&YRR-%cM;xB%˞0[")t ´"/t]|~?/x0_lPitt-p|F$}+ .b,n =lBszGNWWyM^SЩH]z4)f b/\߄*Uj= .]>aIP3x ݡzMl.j:(@F.dupxc!L8:::z HoPk=hdž^IC+$!@LhSXS1[ K':±Cħ9 q@Yv> xxD6\sW}Wfc GȚqрڎswuM)z3ޠ!'/tFr:|7a5(|Ya0-vIg5xmZ?N g4ߌ{>,F;h*$DM51}Д,QU)ؑD,ac=–Q0`(6b熠ZGmG?ZU1#`?)أ`WTլfysj ̫6m~UM:اT `}^%j= 3=Vث=`Oɕyws)]x=S4bEVtre*l\ O]od㶏~ìxO[V;xFar2ֆi|lĶDK4QƏ!u<1| J P҉ñlai0~3"D*a 802MsB p8_R=%8o$F Ku;Uݡ&n\&IRծSiAmNĔpw%ؗ ^c—ϱ\lKYg6CR]vt~~Wq__Sxj[S5P}!:|IqQX_3ZplZ2h~qamU1{"s?o.R 6D;O=U {8"JI$`Y_ꥹWds:o3Ҹsuկ}GډSK(ͼ'.;'Aa;9Db ƩG-}BSpbqY秌CE ٻXdM*1e\ 0 a.\l "e>hG?UƉϒ?%)'r<4Y{+N]ȵal ˟Zd[ۡǕp\/Ov? xp _I/.@xFgȴD*L:@*v7֖-XˢcbgȰq cb'˰qXP{ȰqJ٤CMzIYHh[cOCrKW?y LEA!όb9y'g3 he[u7^W(3&@o]O7sE-cJVezBU`]`3uqa$O$7 tQt"9iӉ\ZPs8P2Y1=fD Y/EƋzpBn> p7EGiGq||)/ep|_Ke8|Y/kr|y/o_8=_o79_+9_U9_9#h  ˍslě9Pt;ŵ#hخ5ehmbPֆ6U;| 2d ҟaT:6o1aK/tkݮμ5:%M|:󻭙ߦHwcBt4ױPfѝe$uAI/R}yD&~pB"lυ GMŽZ\QLr'zTŰNq-/ރZ\TQijaQ4M_Ÿ-FNfFa*r;WG4l U*b D:pvc7sMp=A(Hkҁ먓%ŵC 2kARv21$Fp!=Xj6$aB`|8"ę;۠Ň6JMSQW!]0pHߛ?%ɀ23@rbۃz%Ԅ ̡dphdp%aA39v" fOף,LA_Q^m[0iرx\lӬ}ol }~Ugfln_;UٶW/E5sv;yG#:绩뼣;H:"!UB:`:S+D+g719%}cd@ٲUJe-v.e 6wuOy.&vien7ݹCyPV zY+uծλ1뼛λ:-ztԿ5 >+G7GsxIHoJ,gno8؊W|8݈4 &ysZZ˵=GWkCLj IU!+՚qPHaF@OWbX5];p2#xp`M a@n@çgxW  .]T]` @xn|Qe5w*h]r#L5..u76Z!kp7FRwc#!oL̈́xWf7-őuQA+u0}B) IVyvVo⣭5'M8ğTm⣥&;C3ٚkԋ=SOI?3(Oc_z^톟2)6_QT=֪l`ؔQuL|Mx &kJf8p4?֍ B66O4f[:x N|% PΉ|EC⮀ LD&)GrH1R1"t]N _ d=0%=L(`LActUR zg0[L?hDɖ}Wӣ$}lRNY$kK@IhGjC -3Ah=M"f,Au0T$JJn5:CĊa%r %I]is!$, [sugYN~,h7D.*mAI1|H)PryU`fzo/H?/jM4'm ǿ nKVDi J.qxż]$$Ipx- 4eF>?ˎÛ؃*>4vKUޒ&WN6:;9,B0+Ȉ1TFF/d*t3"fȴ$yf,KևH-zq#Aa7?̸p=Iixo#Qx\inaD͑E™ʽ upoPj콰H,UZ nv\{]s9Y{.Pjb\M=3.kUR3oCv]ަ^wޮw u Ty/7\D^T(WV Ei&χ9.v0ElR6vv@5 ]T}t"-O/fLڐbm^q|̆ߙ*1.eK "\ZPeroYu%?DcPcYD6:Ŝq97Ƨew U!$u̱%{WߛDV[нw`Η2#~lfCuLUK%%α7{١^|^aRlwQ/ b[JH;uu+Uyzxw_T=;˂K@zq6F/5ϛt(u^{[]~ūyU}u@iE3_uj[tkԉeM?߆;+aīr!釕A|58N|$r\: kq@6cMN|#$=\y ŞJߵ&IԏٮSe|,ҷue,߷[LwT&Uޱ ̀Xg ޛoxo֩U;}z_J(;?z\˥؝߹l#} i0!~Ku)dt= +꼷.|L/[@),!vyg4;;a ;TyeU@)[*Q.%db_֏=?JI |d&$$fKX#4WoW~drcZD9^j1jw{݇0lӿH] ~qO6;4XuI~q>R프0q0vGN6= hW%V~yv_FQ@(ЅuS_ۭO S:g۩OTEx},®%g]|L9vz7gqw;S e[?e:&S2sjWSH hQ0҇/^^HS7حZP7bbZb[ [ \xv;sHbg`b3a/?#Vfg |&#vyF:GE-꼏~>H5#c8>f1τT]>9>"묱]ަ]@uVuY(UA۴DJS6x{UBu_mZTl>{UF6-7TmFlrKUkoS]ަJwS*o2PW@)#>u߫B秀RZBO֊i_LL8!SC.,l,sZ;v{E]˨a#3$=t=KZ텛<T!#SkUcY 8<6L14..zC@÷ktsdxKJ!y3?uW?LX0 V> Np>dS:Vq/nfD1XN5b]qד ͅ(w#&=(F< 3c |<<XW \_ "V;.|V|Vx&=Ci@0` I[`d} i[.s8`kb.;`-sT}QcgsvM =\lO[Veʾ.0q%AŖs]l){=^>boJkn'(Nt"'mOq3۞f=l{nf3̶gmr3۞f=l(6M{ }3M⯍bE|+|ž>mx;  u`(3"GxQ{pasq0-}1S&Ņ=vxXO_>֟œ]t&8;lf.n̥) کx׈k,ϟWZۓ0umMx1.c?`]&/A2.ЮKϏ_۵cFVZg/gnLq+PX\sOiuh-tNg&:n ̘1'dSc(j+5͡5QVV!?agGfX3,QY=#u>3XУ6~RV7ǿ^9qZz0?U=^bxNup<ʼn_wb;(&߉Fy5w4yrD{AR2b/VEY'"Fe +c#A+[fC9kA_ 8Qjpqp|G yh<=GD8-(jk ^ 8&kXGȂQp<8q p9MCܹs$??cUБ^M>kC 7 zhz#r)/oW7J\žp#o[qt\^#5e1%Z{ЩQg;IormY*LSD:7-&׈\vz1J~uWnPezM+3=-@w֓_6L%EsJ}95MTj?b rt :BYN֠A3ʘI: oh%Vp܃󬪇fyiy LSOxo@.um.8eҐ()N9>{"&=Ji?lAzy,IH!c/$:(Ӵq Cq&Jx"Ǜɣ{@[/V_[0PjA>Bxc"4'/EwZFߎ;ì "Ɖsj#F~"e+gOkZ#l9n@]ڡa* O<5&&BGu=kUHڗQ[vUg j{Ylu,3eF+>#E~@ yyxxkbU2 ${OnW2*~2@`}U:V3EqZzbGij@9xbQZJ߆8=!.P7JZᜰ[8}>a7y#MWm\&6ln0ߏWU8#MoQkfMzSͨ5O}n(:j͘Q3BwIbVPm ;M,.:&HYǩ4|ܛb^$PR~!GoUJC jn*+R$A>R%tJ(-#[,c.m֤ ?ksR(bAc経UOc-k9SV M v}u #H +(Òև+UݣjBD$GOmaN5=ਃfgd :+"XR\VQ}_656V.?X㇋u!:eP%_/Z|DS ]#3s,\5~MI8`WOǒT9oqwsi/A% j5q͠5  @[ѣ&kA7F30աpFśmCdɛ! W%ǡaAfC@ 3Oΐښ[ #( &D xK@:"KPoN; )JgNGokBz)IR&lsӊTseC6'\D+~Z:HBx2}IH?]2Y\$JVR yl~v79͆=7hY54f v >_|*XU#ǻL!]׬w1-x|iat/pֆ-nzXO*K*"AJY\W.Sh2{V_LbiKڼk(̦O zpkB5v0`?(ږazS'oXaNژş8!C4ZĦE.OO{.?F׺ch 2SKncςJ`';!wAxwzޤzȜߩk'Xϸqq  !#7=/S\׮fqqy9q9=~vCR]*xED[w'S^_)ߥss<.ʌwwOL/뾿I7SW ȭNjtx ϟ6.M`c[EX<1`{MϚZaxyiww~zçg..V[*9мCp/'x80'?ː@}w>!ij:ˊA:Mc?0J<)֌<jq.M?3NT,o i]q RdRqF0EHtѕzkyC@+pig)R5~Ml%Ug>Ҷ1 n ؆H*zPiB۪ ( .M$mo9-0T,yKC#o|ay~*3{m ,<֓Qm!6s1>? Ŵ[ _q WEa[6`rY= z6ºW n,o0Fi1*з`s4ǁ E>{I59&nUkD0')_~}Ǝ1RL4l90Ѻ U=5+yX7$9SlBO׊ͦ5ȨE&$W:_tXb@;_P7~8}x =b`ܿ wM.duܫac`ELM \S;-S#mB 0΍G0XiAH *@e_ 94awȉMסGufGDJW3F=j ^0vp?u0 h-^ur%3{l}CnP:]ZX6r#mwμ 9iԇʛy}z٥F쪬7}j:_0UiQXH4*A Kzl-<- Ԕx oRA5pjx b'=[Q"I_Q>!B"" qˆ%WY w"YSl>n7y9'T pQ?d7=s;|LwXRm6ģ s982 <,˽6M$"c 8eO|E$F>r%G%FL05\Ba ~quu*Dph;(}+v:X_w4IbVG͎ ']cx(ȿ詨pa H`b-J ,Ul}`PB%;F1å/u_1x6vX=Р8s|ÐT;ڌN^>ό\W.-l 9[c=9;܊"~ƎKxVn{kFKMfoŔĔ1siG< Lcwwzڤۡ/V3 pHTW{]#wY@9&jPkQv_`N˜7NHNXHOZg>:3"o,+0Zdg{|,$^+yX7 7H$YLE5U2$߳KvFqiЭ$vP<@eBy=ֽ2N硦@~i >c:K),n:/5.|W3u(ާ=?YӫԐKwE S줆|#0Մ |Hlh~{g8D7=xT |!"#-RPXvaP8[淪]l]@ke>e=ި !< ^ΰ%@W~׊ jTqɝYWDE~^N:mF-$y9=&?t hg՜aNA6/9Z#plGVuʱK=ƨ^TݲGĎpM"Wmn}Q)b7 oO{w[h\7*왙;zr2{w]8w#x@=ZLUSѢjjwWxv% Cx(Fxmhq9"Z SvqV <ɷ#xtomeKsgթw(uPxn,Crf\݁y>p>J ,nKT`YעIw=[7,y2zbyX_ gx;3+)ȧ8EGHi;IH)Z(=Hv2.yܩ|T5o'z㦑.9!Y-=@4#%n'B1c]y?_?@o[=UIe+jl&GkIҿ TB1so5WG3P#!FOX T#C1&=֢{g(f s)K\>_Rm.9ΑYԔլ מ#|:a BZό'n@p<鯷xO5śyk7RUۺhl)-y;hBMpMVqG=CDC~R;;mEaw4wڸ!#YgqG#zG;nKt F;?9GvC9Ga2c]rl VkY5sJVP6 78%J])떈j-~@+"Ҟ=;K9 B+>%? Sfʒ^Ih!_zn,r*Y 6 ν6PUTMA1CD vx~eU){5pQE,GHM$Qu(95=.nz(l~TV~4.q܏^9YMgG҅ dsIMٱk7܏洏|^㢸s|'HMbL~;l_OT&rQ_4&ӄɘW2 _y}Sϐ$'MZ#>"EGdɈh>Դ0lͶj )W!TC6نY"tR ;a#HZF/o[`'xI$Pˤx{ >pp;8hMnkdref a,gH3|0G^2%$p]J ǿb~BֻqnMwVO+֦ܲ#&ʣ}7.űEw=<OO`9#p ,$G@`1 L% 2S p*H`A%)4 9OY $)޷G }r{?r=Cn ދ4վ1&2$)}Ρ>Fs++AØ%;fl"~ M'?4ԴVpUQ!] ;~s\l+l=z׻•H@;K_':@,VepΚhl-+z}Lg<0=% jr^`MzM/%lD6`МML!qr!۠|uK[nix&M'vkzlU8 01-( nS-Z^R_Ž 73v5Jy~޹WgrXYˏ'6y8 3郪$ Z4U~7 p'j# n% jKm9s$B-o8&[ qX򿊉 "e,rʊEZ k%"߉7ۊE@t˒]qM&K%j &rEmSLX rx,y^yX7)3OSz12řX AFI<бo4-qi&l+恍 vHne\R@w#opCl'jV;ϐ3D^cn0+%˄ Kk  g u'xX >]^fwkzm@z|RO@PeB G ҤWz1`DPDPRJ)C iR(Z齷ߛmn3}|{ofg>٨Ⳁy ٜ7$b稰^?hPF`izD}O8@̧F`f5bx AlL{32*)3W3.Fgdzc/ (Ba8O ݸ s@ qݓ?㲹fh㚛; z~lZs^/W0xP:~ Nl"8֥W/2$Um9?z؈iWN͖6ImE&f-$g-8gHmE"1W"rx`m-]~H2z$mAp .H;Z$\3dHFf}zEb:ś"ϻ.Q-PZ[Mo໪q ab5ZKdJ@ήEew3Ʈ-TvW39Ůf[@gסwL> h]uYY{ {>eB]m8=>(q=M~(U`dxzr]us9[nפgQ}j:m<o#sM7[6WI5nxe^Ik{wl AR5qtvC*ncKn´ v#.NJ$Uц2؍w v{b\&7T;`7}MqVP˾tvS*lJy}/h9.mۍ gQM<\nk 4IA\vcI[Pّ}c >%>_~g >n;n,[rUbd~˶[Iv>Hv/$-R?,$%iyt$%hTv kj=6vFlOp1JuVz;!3TO03 !A SMl"fvHZ=3Ύd^*-$U[ͨP7zH^W`T5]lnn )\͟A=ҍۤ2.bc8ngQQ ~^G)yrzpC %]dj 4󮞦gut仮+9:>O?Zp*!0B݆` L[쿯8z`w$F#;]KYSB`㼫#10K(FéWO'/81OyFߡ~ K40 hw5209q.(Hh%k*ST=hc\# 6AeW=$l3lKgz7̧gz/=uOIc *}Aҟڒtl*{_;ΞCe/炤et\*{#H.'+k;Ge ${>]F^ ؛Tv$MRTvI;Q?d2"`/؋{ ~U^"i *{`Hg/ v+{9B1+d ܫ4 ewcx\ĭ:6[r#p*9WC;+fP87T! *WbI4O+ FOvĕi/*1=Qkxb E{!n-0'4* CQg_Q*vŷUxd#Mv\}Îfuzd=#Mwo Atl‹/GnNn!.e^-ԫ1؉7+ jilZRA% ax"E [Ciڢ=Da7W~G5650=A5M-aQƙa13R=3lKru)X]#:{%u?YlDZܫkjTV0@{ B+(Pp互axk\%7((;2蟄wTv 5m?AHFݣ{g {1=^B*p0vCo5#əY L\]kcotECx|}!\򿗸Zkzxl\-+:@qQ;qŀ֐n+~)5x;,?omxԷ~e[6Mw\}^S!#E}ŃX%P п8HfըJ mmo0x{m_w5vznO}@61mH{ bfK~ܽ0^~CpbdC);|p%TgnΛvN۷EWzn>IWڴ_.4mmH랩i[u![< Һ!{n- iYtuφtKC7JJ rޘkHhHσֽ^hH'BZEbCz u//5!-}SvNu~cپ#kC䆈+Hڧx+]MM1ؿQ١2aь:0]^$mU0ؿ,WO4Px'A\I/4Z˹ʮn7"r~`ϏbRuϏRٯf1Tt[avo3<ݝ}ODge:!U;ʞ*cITvC2-@^!}˶\4H%$٧}emp_ 7ݺ$π#Zk mY`[>js\A.:<3.b_I{t.NJ}$ԂTv}RHD6e[eIߗl˫ REWnˬ]eQe u*}РAv_>/>8 )r6[+pt8%ZDte+`>4$}>9W&~T|n|x'*p>-\sX^Unvvo(;+kImԝ#d^H:d|'-{; $U2V-Ee?+{`w`GSc@R+2=/c'ح|2X`@_je$W2VOe=$uR3eQtTS2NcKƞ(I D*;= $=Ԋ1z'Q =>tO\{ M*}1Rb ]p_ iʘ;ʮ!vpcOIt4*M'>0NIѥ Tvh?IlVLg沍=nvI- ˹ )EM`=˶Gaw!For.{6y\qFu i?^e[ڽ$:2^Heٝ֫ lK݋݋Au\K%Ok2׉8uu\ARcyTKzmHZaؽ˶;$Ү0N_ٝ⏳0N-(O7REdv ٩\ݛDza&*"N{3miO8J+ƨI}N*,w#j ,]\e~Iõmy7nA#GS\ݧY͸NSٕe i˶9$]S'0|~.#ף^crٖ}$]Ws0c`Cm`-kWeETψ/rٖ? 0痨oB`_- HgPٯ i U.k tpT::H Nes. :T .\e~I܌[TvaݷAE#}˶ɨSPمd]4Okh-{ r̅ u?hl~+mzp1JoʱbK|z4k}3TY[H:%3TvD_ `aR2#6/t#*ظZmħiwag60~~вx}+jun?{\Ѹp03p٭ D]9x+6! }1l~mO?(1!*G >}3$<gv+K|y'+G c݅2"*ܽ@~. O"|Vl6z+Mp3\Ef)'6RZ~%y^#HH@QĐ EB]P RPQQSPGBC4HT)R !EB Mt@$JAEgownwq啼ڝ{;{;3odzŨY_wmn8ou_6W:K}=àh}EۋE^_3ooq}ۀ|/r._ZzI0x'6,ITTw)WQC5V+ycQaf9וF4S HA);r.ߑ rˀSpW.}LRUO/E顚_B,S^y:LbʳxuI/pejR Oqg mOG*kA8Tօ_}}+c57d)pB5e9!&tA6dİ뢏9 |Rc۸1MWDho~\DkT$|%|M&v gKM튄oR >{G>W~yܠ̛ m[dçҷ9wcϳ}Mv;3I<|@#pO S%Wҩ~޿:e&e , Fj>Щ~>9~5e5TX-`H:uXu|<Dg\A,ZdC<2m Pt VF,f TWQ%AѰ %&bG V 4%j4XIlX łn5ػܻ;03>z|Ávo;3wgfg$W/I4I4Z H[ nW;'Wُ.,[a}-& 5C 6;>aI) cfTاJ;EY7&mO›>}"JNiԢLh:Y TPj6w1~Gk{7nͦ6[kSB0"#&^-ֵ φU(oB[+zk>VAK R2-YKq.Exk\re-/ghsrgsn Ls]\owrPjwz"%GOy{;>emLoNiWl|/+~Df_N$G+}+1Rd)}k'-'s} Y\a:vX/T[ݢ ПaVNv|T ۉoPmu?}yr}k-HZ܈oa'16$5o]Ì m?!'6w wy:vkwVw {'Q ]f[f%Xs D )GM܇#|}ITH:fFPmӺB`*X;2з,6؏xKhu?&kwO.F>BM;<똕`?Eu?Djy~ۉ~I', mZKXWt҅`ڦum>`mDuC)QNMmF3vkQxgft/H $``Qݮەjt+O$΁Euq통DvNn%9vI\Tt~em/vڭDuCk<. o-Ev^n'yv }v>\d;?n& p{+.ܾE b&"$oڦ}KaޯEX"tk.BMm~`uwTt~ ^ vQPTw1n!Űv~۫;X;Pdv=vq]xxnM H`) oڦ\銷Dm^.{$%iRmbv)|=`9DvHΥ*/ gQ vY}Qd{B4e2Dv9HI]۵vy}^dIXVvask࡜$ W~+`my=9_'I ʧvEjf{A#9n4Ik-loH*$mo)lD~= o[;"[h`-cmWkID;]mk^|=``mIdܚDX}vF[] v%.+s6_*`W"H-W?/qF*~!'jXȮ:~&kp 욐tɚHXjE~CȮήeJkؙObǐGOVkZ $5o[_[O!)r浩۩Z[~xl?vI/?u;rqx;jjׁSvDԧօUbl]}`ڏDv}n KUk? Xv(Ev?'AXn%!־+q0n~Nݘ 5&&Mmݔq)Cd7l k͹`77Ev H*Zk)2yn I;s[b3!ַfO~zCounOqC 6S$U^°v ѵ-TN évj$y);k pd$o 8Sk^GnIݬC `жz`ڦ E /kֱ4ú~ڿoII־jb_R펐4ZhU;Z/H}ľڝ i5aY넵WT3.G;c}-] \y]z;C2k]!Xk7kQGi XnXݝjb_Xl c=v6S/HʫLoڗ[2uf6ro}qpw4$}-EcF\ $YK``ѲY>Tt Iʇsv_!:ߡ$Zn?"y IJRω; Q]1X{h8V;<"$-~^?:84.1Jsь!8 C6]eNچ~ /JMIxP;I8UH%_%q cmTQ;Hٜ7{O;YIuܠ8 e~9o.'xǜ.a#6x:-q~4Oܿ%oYfff́YloKFMU sy~'*r{$FOBNy9A):ãѐ˞RK;)&k"QBj8sX}e"zg7{;-=k p jHj`}=ll_~KD8eh߫-OHa`|)0z%1T Cmomm!6iPۜ2|H({(a&e[[-{hQ Z^6o݊jj$U!iጶXhOsH:p4 ٟS͏VtR] .:@6 g4᭤lCd"ð܏Jj=km`I}> `h_BR eJ%~nၑH8=k3taIÞv[ I0DŸf<,$[k}%ѐtI]Gc͢]1t^G`"{,$]TX{nT0R~3?ZT4sw]{lvg0¿o78lS(ƫ4ݍ C[Ex{<֖W $%V7Xjjں'@T9pDp==k[e$RJMB$M0Xi-$+OFk=(mZTHSYQi4T oOڳEe:$}!өL{gSNX{J*ՙT۴$HR"kJ+ wX WK#{$ %|,jf֭Tg_[ Hz'`ϡD2]SEW~̓\ Ij2. O a^|iXnOD.~J8´,kgw.]3,bBò]PzY"]Ё]@k/ ¶b=nY[bN&KXU?O}ioCD?6W>&?bmťTWз, ewP2};}!\Pr}Tt Hj  }Fdv^O쟸=`OUEWa"{5$&ǕmEQ3fj{5L%ck}ZHHjJkW $ Q_i!iKcʢ7@Rr`oڦuokWսiBnDMNrM}DԧH+>,7s{,ތ쭐Tg{;+y[(smT8=Ml.?E h|3x - gscC~bFo$lwf )!4(v+UOsfMH>Re=.w@|y_PwBNg&@/5"z؝ΰnla LwQ~Ew;PbP*t#΢- rFEjC""6KH7a9"F xmŞPί|->I)gPxgiDWmJYO;DBQ/g7Dqv}bvʳIu̗sQF)"svEY!d~kʊtIM<,]W&y#EgRe^1zYT!\0^v^ĝ a|#H^,*یQnc=0DpLwHDlۿc~1;;5{޾cbG+AoӑNѢo@J6}k7[g!} kO`EU-I닟.^bBlfڦ́o Wo]uI;={l G';[E2?P<͏e gWQy#v}PtĽ $+u^kQ u^3'@!/.K:8 Ig.D̒"X{w| Z+ W@~J{E$SOX{.}F͒x(.`\5n y1?U!upbKŖyԧY_hpf_i0i ]_>. Z<ư]Cp,\U~gA~2%[x&ɓu_`lxi-&l.˵%]t]Tbr0؛b+:óuRG~E/{j, +7{SԘR\a@P=ױ#rziмȾ3< $T1?-&SW0pNj1YsfE#{}?ӷ=U'8vCE?ߕLJ,Icj}N>X֨W:e `\@lW[!υqrɚ̇q0VP3_ $n~W[4?¸RKa\me04`\m՚5k`_ko9[loϰ{E "nwل.)tWIhH*G `EETA `A["ryTV<*2.j$3dL2zBlv9wI&0"@K4Jsq 1Mw.A+Yv.+rʀz@_D @O`S:1*{ 㹲 8XM׍}Vww4ă7x%T}2R֓7{SDwscɑ"sOȽ >`dTTK\11,g,V ,BIߛz2bvHӏс<\(fppzx)Ii 58@lʭ<~fhѦmPJ}swg='~>,}{2w"w=Θ4b:*\o?Ma7$u'݁)q8x}VV?+t&P^zv/LGI?(~G=ۭ7?,k,wJuQ QNoycmU?JQE?X-?ʀugŽ]pXw"+nL?r&Nh7ۖ*crT>Y5`gSi2vV2vEPlTqE*kaJ՞`W7tWveP:1IHe*{n2.U]J1Ef *{BwʞQTYS]k2v*{^ VVA9cIOʞa:bgYKl'(W v*;; 0&? - Jo;~ήJeO]75LT 8.2FeOq#]]؝^ʞ5Yi©tQ{>]`:>Ȯ J7'ԤW`&joM嵨؊+v}oXu\;Ǿ~^myP:`c,][^co*0P Fecvj 6ΟS/^sFvv;ofv:sHFR>d.(U1LR d]@-g#c>]#8JyT+kdqDZ. V*n@>يP `77؍@ZG#*{ c2ݘmf7 v*_2pk vS.(P>1?m,Λ҇ v3.2ΛBI9=Yfw .Wq}ނ˶ys%=Ifw+.ne[82&jKn-/;l<%վk>?FR\v{}0ܞF02v{ Ceo; 0&He;v݉&]Y;2؝2v~Beo r+YJق7NQ-z_ww,yjݝ^e6Z<=]1ѩwy @3޷C94ޯ`aX)Apc3{YꔈCC=b6V=-AT/8&FE~%)Ak8hp{OUC]S  {iY%ZJctxၼvj%jn,/(uw]@g%s VK2%q=cR8r_\O؝/Ufw`3|> @`$؃4c-Av;ʩSKKpTv{DC@ic5cq!oS=Rߧ(C$h{ekH/0P V0ֆQN٭ xդd)&pٖmT*{(9M .P0#lDl/Q\I" vmٝ J<;˶;E;= 9lKGX dGSA2ǀR55e[=V{,]Ef8P^dqٖv=ʮ,eP0^-~VmPkdj'd{VƞJ7>He]#OeW}9ޟ"3IFx$nտ:sQXzQ> xЫ?ބ.irǤn(ZEReJJ5Olo"nu݄e}p%Q"VEMa[-7y{6mT/G4PtOG"p7c7|>lsL~ RxSg?-=A}% ו^=IL_FvR?NhP-`E$|eh^zf]>Qzy:ן(ō}r8QjOmYYyՂBsQ:;k}t99X=ss&bؚ+A?"R?pGoi}^/{,hwȑ'Rjϫ4W#?G(ڽfH?/̺3?>bt;F*:{+}dw5vo !~QwLG34QNe?-J */3߀ʐqo6S0;?e]TP}.*y~)`~cpUtTvyٵn.|e[^;'=Tv9{mxpFy-Nm!NiTMs^jkk^r:{}0`92Ρ[&6~{'߁RetP:Juk&ϟo(SoQٟʮϿ؇:5Tϣq~!Ɍ*6/?PWMݻO8x$_ᷴΣVU<"kŶNu8fn; 2㏀&x7h5)sBvrD`fF?8O8*"|az?$4*|y〳Z>\/k΂&/XwK'\և-zvʤFZAϙ'9~HL8%J<9s ?3ʌ?Dw) r&p;MzODlr&޹=gʌOD8*|yᔟr&l>m=gz3^8g{!uum!9ȿ3?rf1{"-ss@O›+ӣlfPW|ϳ~ڎ.ԛ8`Tt?8݈Qd3ʼnh?ϝ161繾O_dQ5pglD7.p1W˨~qLz=_/i}3㍀<oΠl?ڌ|h6rĵ_JWl^!oM]Fkf<PD||v0aӯ@dd)kDqr\d̓eŔ\y9 8JدW2Q_wuno~O}rU?qx+Zf|"G//\S}oZH r^#B98wdtzμR}ԏuY3񖀋asșzΙgAě$3or=ə-n)g"3Ks$4*|yᖟr&Bsm<9Ssm;@LrNaOCcܥg#Y.Y̾Jλ = AiQ:>miX4ڹ~e[(Ms~@fx}|`e[M;1ʾ//<80qٖv?v2؏2+`˶ c*'Se}e[ڭ*J>u: Sth;*;Y6'k6P:oo=Fe/=`0PAi}X:;;lng,\!T2@\crݫtT8 JW'9>b\8J9esRz1un*^s硲Gb-/(EsT;cFv>PhX(nbOj`; =|J~*;[IK3 Lu(cT~-[fddیT RLv 2 RK cBTvnFv@\/)}M@X0K{LK3J݂`':.m$J(2*}4M*c<{0hL8;sxjX0c`sz>sp*UjJuEJLqR[MVR9Υ֒V\6q7 5w |7H`3Ww+aﱢ VIr/lFQ֪8M#dVa\';Vqx/3Ii4Fp0+6Jw#D˙M_~_*G ZsQ+ tv7QIp:\1bcnoT;>PΚT0 cϣ]E>Ja"ŧ8U/c ]:㣗ˎQWܲgxCC-5TƂ>HEk:׎E{,_a=ݝa=p,INwF("ͱ-zG<9&ߌmEϭGw9 \]+.s(i3_^~;wWLEWLMw*P0/PgebXV1ŨSX`]>)c v *]R|]>.+R}.Ee(c vi*]n+kM철4N=˨]Nm֖rT9| ΐQ.Oe+v]}ZƮTa+R?rK%f+Q?ؕAp]NT:jl: m9K(V0ATv`l :9G`pJ&v.[sJKSs[[)sg ӝbʾ( 7==sT{ah٫Jf5쥲Q=h=Ie/X-|K >-TEP:\)"}|.1ϦVG1ue0P@]}{ dpPP!e[8j;c!;>R1ؑ\uŹ$ l]rz\`-JI @5":miwC vCroFo5ne[X|ݘ+ (}^dpٖv7-j:)*; (.f'T:nysPJ Fg7v- vK.VC]nEn˕ykPک,[sٖqF66m1 rٖvAk8\tv4mA黠 v{r۽t h<݁˶;F|6C7]e;rٖvwoN> ﻳ(*}2wvBUC6`weT|SԵhgE rU`3+/4vo,#T<t~Yc>T\%P~Qʞcb4A'h쾠7<:/ݓ4v,(}|a1Kecbo_AUJm`){AC֏~^; v*M{`oePٳe쁠t!xn0ʞef_rZ$kAT2v<(] `S3-دiq8~]JG3CL'k L=T1C20Poc7N5|>Kc'*{_}w(=:~AgL#=>yG]{/{$['JυcؗHe+L1 vKNld*)TыN< QTy|Ŷ;!V}W B&Y8ETއEQ= ( [@I% ;ȾBؗ}G6 * AdΩLsI1Ss֍Iejj{^\`VWMeK;6,ū}-%Z_X՗6qK2|Me7y/3vh~CeƎwhS;4QٍQQQiQtv<%x;6-k`ucE"PV%{?]O x*? Ohm5`ix=ʾDN+ZRP~Y!ۜN6"+WdqqE`q֤Om }lqbgcYp\UP8{^ Y5Opө|ۼ_Go=WuxsFV+FOq=@U**"ž^78c˳[#?'';1* 6L.룄$j%5ݶp:Losl~ssDR̂sx m-/ )ƣ QaфN(Jl̈́[[*\@тKm|@fa1n^|@چ>},:v/]IG#hQ%on9ښހ$눣iÉmP!\F]88~o-֞Ly/bw==͇s[4̮4 i^T7]Unh`\#Md6t#GȊ( Mc zS8Gn2_GSK7cٲ=DcWTT׳q8aJǑPs亲ǃGc}r`1,ݳ+uk=6]6 , yP:љDc:qwXi.0/A(j2Dwl·'?@Jz\?h_`Q,<$z$NO<(V ~|> }>|*Tӳ Twhne)F~SuՠG8>٥ BAGr,j\4V'v@Y*O2j"c`:L]ٜ 4Yfgp٦x3T51w:~S{G ,.Tl4M=`ϦtK3jfslSsTv=fyTvJri惥fJ\)}N!7 JO}SulZT᳘*\CT_w3oZ`7޶,4[2|-S}q4ܮЧ e˦ =s<$Ze"=Siؐ M ,.;+{l!2T; ,}vEe'GIemc'6TJ{XY${vz?Ne5ã޷9]`ar2!@)]]4~^t/`w^of$6kS*3{_K/x/Ď}!Z ;ܝ7tq=w6)zu˥cRSJx9ڞe5%&Fy/]{9+z{=DJZ|WKeTv= ؇Tv? X*fR_Gp~N˨P}e-_.Q*{^X`WcQ2q>Ne/Ov}N OTR`bORKdlXha^-AagF^)k'Q&i5-۪b_}ߖҠɁgNsss?m|kVӿl­{$] {0Kh=ꑙ^o}-Ow| gZQO+K+f얔K{_x7^ތ_s"tRxv 7Q˱%ǭQ:#[H!o,vf {b!09`r8dDg2As%@S"y Ew篔`S} .- ~%N73d/4%#R,bC䈍GCo17Dw}+*Fd="VҤX-[b"᪮b!U7SCUXBO;pK!nl&J[!)Fy Nk@ jr10=\0ϣ6 e;g惥F\ƓSٯɺ)`:;.'ӽ,fZCg/&xcCM`tS=d]T^`Re4VۖBgQٱI%}^BeKEWfxYJewy:XvexO -e tY=H *+{`{3|9U^!"cTvg{Xj=b$twcq٦`t\YG.T}1v\c840Q 9渎iDZ#;Tvv3L'm%'|D'.4O0m}VwEh#\S"1ا2ݧs=\3"͓3T0K Y.T9sTvLyTK<eq&}6H T k`Vv}6 XcY+Bۥ+Xk)x2\5:'},a`Mui>IeK,.T-[Tv/} 'q٦o4MeX63wlSݿ4?`Ne ZBr٦iވ.},i`Mui`ߧceG2\"+1?cK?O.T#mC=v^ǂ`?&χع KeGLk:Ab7ۋLr OTv``?}3Ce (J.XSŨdS}/C/V],*Krg[TbȖԱKȖ?uk;_v 'g*xDnf\?OqbA %B+5A_g6J@6o($ãvDUĞ,w+2wyU}{/RDiDcN?xyщׯl6T"/ntQ_أy½8`9V'Oe߼x;uD#a%f'Jr92=5N~WIK~a3nN&Or-$Ojgl=g6-_gcT 1;] Z̆6!o:kgh(kV{:gERWάEfK}<+ʺKZ2/k)/RK KFQ)ƒQꋌ'TvI%<RI3]6 K%D;dR)5Mu4alUX*6NgWMuWiޚLet~6]E^`WtWK[tvU*;P"7l  c TvE[([+ؚ`wd5*u 6iul+" v],`<:=0%;Ng(Jeϓy\ K''aT\堠ez",}l5}̷5,X1;ʞ-^>fG/jtapcr늚( &yZw]tMF27R:=BVkyN6=RƮRT+Ce#Rcu,uW$W[+YW[ɸR٣e7FⓇÿ~fL#i e~)tg"<}?W1ཾad>@Mñ(=K|]H`ăE+|wN{Kqm>К폯Iz5CN!~~n0g³ نCx!<—GG̻f!«߰y͞\>j!K[_j^lB8\miCx) (0^fg@X̻;U4sf7{8WE4 01m Ft  Hf {\Lǟ4]Ev4)LH,MV]uCJVJRTRn+B-ϙqB?  ܌ӛeO΄c`?4B3P0ESl4 B+qaM勂?),> X`xYh}5h Xhot!+ +a_;5{DSF' ,VlvHfBOL\M뒰g”MfO%b͛~b}򎐲GtrP}א"ыM@ A~@ |4$ڦc۷_~j8p";?ԀnCQO Nse%Scc*rЇ4\P'K,YC G v\c؁a!Xu<<ºg Mq(+d0+]A ywmm 8?-<ϰtЂV>z$oX{L4Nf=`=λAM~MbZ\y5K7Rضn 2 < |ĻgRɾP;yԺCD]pQ}+ŸbGKi.ŏ VboV |yC٧HW+{.wu)F^IB%T_Ɋ%.[s:;2ZF̞nOWc1Ԏ λNLj11hKK]"k*Rxα9"|;p<,%ºD%.]λ팲 Rgl+A=ٱ%#uFɗp? /PdȎ՞ Hputl{"hzO@EWba d%ĮZÓ]/+Zj_PW\&8zl^H}au]p*JR,m /@[5=z~;ӵ.rZZ\guS{)*롧d zZRD% RvOUc1l7BO;(I=T=_`oe+ս fR*[X ߰bƲP# *VM{ߗQ;}/Ie+8)I#e;ҽeR;b`Ǧo"ge+x)?OvT;s7 v)A;< v"-[ds{')^$i+?DʶS=LEV:l5`'tRnR6O{OCV:h9wRtBOC({i 1GnjCO {?)LEQchJs ;샤lSUS-| ;T!Vw6)*ݩn-TZR݇%+y~J)oO1Ghي; zr4R*OM<͓lA1 e몚L =!EgҲQi%ߒ}J1A>FbV(iJ;lmUX_J"esT;GΦe+󓬯M>IF|k(اhJ}4!}͌W1gX RT,C쳴l=yqCʮ;zv;4αc)}-Q5WvϓBU/@O rR "FEξHPz*P eG~a?bɲ`I^}eP/#T/COˤE3?fD;p0/z O`Ӳk3vc9?T_4*Lꑰy ~:PʢhM"nS:#2e0FqOpkh&,H;Q|Mc /][EUx0!hg={.kZd8 ^ q^eAWw6$as|-[J#?^2,cS\j#xM#:4:mk×K [ݦ%1 ʉ$/I,,Hk8B:{¶osNc8BGP!~Gv[!yC9z{֍7{l{,W#*!vKERvuWoZB7d: |eLo -#.7_vJdW.lwSف2=-jcR ć?DV bi"Y5 ##e) XC٫\`nʆ!T~Q[ǂo禍_8N,"ۥt`K_ޒaAvUb␊B2RRO޾lPEp ɥAݦJ1MF[@$9Ѕ̀?kOhhq ;TH 9;]|پ}YK= D5a wY(Gks5SkDCL {֔t!M3UX= 뒹ĪQ-~-؏}7{28h^.sy0%6X#)}hv:PkB:$W n6V\!dw/u*ga:=v Q˰s ={{A !|YG[@54iP_as&&-Ly-L-[XZ mڵwrrtcWNnC5jҼ#FF:GɱBFM#s`pjӇ " fZZx `=2j`ܲvA>\& Voױ~d:Zͷ͚ƶ ߩc';wѳW>C=Ǒ&Naf/Z$bi5k׭q ;v%N9zHZzFg;k oܼUrG<늿߼}'º8HS{.#Хź8x#-k Lob@ǤOZw\t|P7JZXedI{atB 590yFHڱ ٪dEA*H26Iͪ` asёBii-Dyɲj#z6-*xL(n Ds`d#.bPqa+o̠{4aE.&kw)z [ kf$XT$D~«vkP"ir?3hN$t'2PXZ1 %h?GO=^Vu9`o.64zԦ[ל'$LV?"||W{x/Nf_Me6#M[3/δ}?Ξk`+/b7Sa_Qõx/V!sTNB>{U?23 5\(}xoNػ(? ,J JR"F^B")HE짢gD=ςwx+],`(If畯֍={ÿջ}~Ȍw>V7X徨?ֵm^!6à9-:'/Y;l- ON9 W@&mMFvxl9fb=['mM~a#]wz+Ϛ?ԓOO)cnYAN>&S2r`q!S!d2NϤR[)!J_O%ec$EDW:tL>1}A>K74bGϹ/z_@Jb_fAl_|aIq1%R W&Ru)UðV:4l׃qփ8=_/_2|&Oֱńe%[9ni;Qg:!CI$ۏ{ӳ'ya 嗔3v ޗtrP8zju|ȿ]T~+S$9lb.S~XU}H*8E5.=găI#HP2d7ڽI#2$#vN5f<9ƌ **eD Ԙ]?)#B]䂉l@#Xuv9w;BSCSKeE<ݜ ^uYyQR J^s9ѳRMo ^;t5dqB I-){ko|4Y{M#&+Fo[_kѾz#=7" 8OoZ>@>.:W#`uZq/Hsu^ρ磃Nj6UVHbsc!8H]4I?8q<lVŖ CV++Vw?/\mLE3=No*T ?Sb$'k 2DR,b~ 1˷~vR"m_]i"~qgXؗȚᥪ\"NT7>h8D!!4ա4TY%T3=X{݇ י2d6ku:|Gay'Nl_gD ;n|SHuQuZz"ji;J'1AZ)TW~P A(t\z4A!OP,P;c#qj"bW-Ŧt0J#8nrzGQzO'z}),Q n@xyəp$ ^>:><1KBUۈW(b#^C0FIZ "G7&(!ؔ`_lF|1 &@%v&H@0`G &D0`Ap(/$؇E/ Gpa3 'Epp'Cb"8G3Bp =Kp'XC}A " 8G AGOߌ,GsgmɢihgEN%2 ,Jtȷ6D,Ƿ>l ,٪y2Fk 2F 2F1&!c4C(I!cBl 6_  d+1o".cOȸe"1ꂌOSOW(\Ƹh2nppSɘlp'*\. qe5A9 q'˸Tj#co~eKCՊa#; ^yo+&fU:[&d8EiNP}bl.X8N8yq4ozF~X[/w1V8| "c'x#ȟhoɬzU#̣[nꖫ[n~>Դ(Qu"1 ېMM7w`FǦl^NnB6x #:cnaSCU*jUq&xqۈOj=-*oyT߿݋vA-a1`H!MOSJdZ ;w ryA҂L,duIΆ]o&f^>os[f~9v–r'f; vWkwmO~id?f+5^q6~`H U=W5|qO9LiF2@ jōLJnJ!X)$\'xce7V Whqc>n\syBRRHQcw+WiWkz{&6K'8O?7B I# BTv JFrUGxF>DE1Hn]>3zh10 e(#xao ;P~￘a)$,!@W?yDk_h  1ڨǵ- ջQ fpxEb - ? 0o]$me 243K3T 1⿦ϔ 13BJ*q5P*qAWJhiX\&HmNj::|[*Xsk>tk>7 UK*w^y`LHt8Ս\ՃʢS[q<KnV+'[*iJ%Ӧ+Jep .U&DؤL0N50i 8d UCyhTZ*m2dpMԵS;=2侬U,ˮ iSX@932]7veaPv"86@Br5~~~]*!)FBjӼFBʫ45'rrM4CwgHW N+$N22F$X)p[0U[ő[xijJu  4ŇD/$H[ȉ_ȉf4SIyc$U ȧ|KLsU @ƊBv?eӏ+ݬ?bUX6 FT'-F:_uz@$ٍ={iGƞ=434_w'BYͷȜ'?|yVdQSd UtZ,IV_s5O}xnۮd¬NlcVah^ =+ N.h.>X>A ݄I1l (f-lh]Ja+kưVzJMT `h;#R zuCO%%R6 wc p ^5 6q쨀pSlb]M;|XbkSQһIrf ,R0Sw(+P|lǤ@g3bK4hfoNœ9,Ql(Q8_՟[П~4QeM~U*f =Z-%37G] V[ЀB#hbSz/"*e05 jѦfX?QTv6 qiM> esٲlU ^;lj}/jlюcז!T=F40_7tbS"+(Picy bż{,`m*b)  AI&*[7dj2b ߓLO#5g'LI v1֢hk-Zv3E]RM׺Ȣkkk=4BC#5nvsdM7;YN>g)f{&EtK #ja4 M}{K:V;k -2&8e$0kt="M=7Iܲ.,c{nU1캬-d0 c}4bLᐿX43ř)<'=*ڏKzJ]XW3UʂE2ySSju˱b,a]siu-~89IgtV>NKanc~4OE6uI?wiZ?$=>wq{|=≯{|=>=>^uO#w. gܥ;A&ݥ;ҝ}鎻]. p݅<].qsvNΉ9w_q#nw편ݑ;łm#o {;H[G#Ͳjh>x.M4UmIa2h{kk8\(ѓ}b7CjhC(45C4C5jӼ/׼C~}x`Gdv^٥삊[!XF*%H日9舃f: _f(a@{Zݝ {_%G*XѰDeWDElW d\B^flt /QI6 ?뭊Im:p4nȞ3=c3=g{6aϦϞF؀}Q (|IeD65gziyH7lGM4UtbXh<_. OGGԺՋ_|e'k@ H7[@mxߢR⿁[$]L3Ǫc5[/M]}Ih=VրZ8NCxtTekO8U;(у -FGADrM<{D!=VGh"g" Edl[69Ol>DW˰ha3x%(.4G 8GS}8M v&2eT7$qE0ƅ45-ZEw+ 1go"%=WŒZ+ZhJ_jf5,jDaC.FrǚگYV s !^`~zli ևW(l?X!}2d(ؑ9 aHe2Ϣ6|X龏 ƱJؒj7 t(qH.N'b|1,>+ !LM3?n 4z;J~G%}NRq0%R,6 /Zfh_2eeu}}' GĽ*:VJ;̰=H㎄/|6a&4o"ȝoȯ^Z`] IGfO~ZxYAd'>'dM d$Od!3gB9Ȯ%{:G>O(dK^L?Q_9 ?R?r]A\sQջjCnA~A #gH7TH7H73H7!@ #zH7L ЄFab m*/H7t/ H7 "0ȊtCQ9nDa 7 PxH7#nn8$ nGtGH O7 "ݺ*.ٞ#.Jqkr.E~{{Nvj$!%n8屮޷'=>܁mQTN#øEY ;ۢn^+/ޢڇR["}('cbK5OuNy~_[u۠Vw}eqoÍѽ`}"_`%>G s;)Sjo }Sg[?sGч\,3B%A~ !p<(|=+V|/u͹[^v N*JW/ٶB6ݧw_2oEn>ڨ/6x=jw`<Ȇ9]x,cNAɹo/V/@P6%gE"Xˤ J!,سqFhѻ/&ky2,7!nQ#Ur}kNJY;6hE%2DiS1EN{O(1NN'TZPZӉKh=tBBH=m]{Lu;qq|cy'[ZH ^|blBhGJ~Nn n ٧]w,vQ(%].t^; y|DGϡv1PHDPLJb8|M{bA|{= e~BJWٶ;SI ybgTI03S= :b?qy3yɞusX->^{NSmC|z>_,]0튍Ø-d,VDj'`rX\Ȟ  Q4žCB#E!Rt Ǟsx "+ˢ(^ΌP"(T?~.3R( ?%3V8 ?%L3Q$ ?> ?%L Gg͍}:>VȌln=qG~d9hpf pƍ}* g^[wdץ2cYHJ3d8 #Yh׎3A/*m Ն}^4B&YH Ȗ3+1ZEX4ӷgmhFXT y#W Yh[G:13ܿ)d5bE5vbs0Egwlx[Eb#qD$(hL2s6nù/ H {o!ˀޮRP|jS#&SjXR "53K-mmhK8+­X˭HC'l%nDVڼ]j͓kmZ{.%YCt#3inFaE-׫q@D.%.fmA^Z66xE*K+s%:ʬ 1kn7kn24':߅-fMs/l1k̄DpGG58Cf!Y(Iu7kq nk+ [ -!~P&e~cش񈶐" AěQB"GFGh"5"cذyڜ| e,Zugqgg{<|f:8I}$UJ,GkʹeL#lPPG43ZE$vwhGF;fưѓHW˽U'F[ n6 "w4ˑPHXʪBprd9G`cC%N˓Ѱ "mghw$yoizw =y {G{G8}yA7{hʎ O;KcOz/ ٽ;*:b*^D]'7,oy|Jg=wwT֗{?Qksw.>{G%nsom[F- wT=ލPn%u;*~5xF zU~ݽܽQK?QQcE.[GdED3l&B{Ggwظ@aY8BHrV1g>QaT6+z2 cwi{N{G ƢUJ3d;Zfa4z@Zm Ht /f )B#HdYtJ ݁'@O39X }/{Jڦ^RӀ׀4t -:23, 0{ {? c_q`1pXǁ `A>k$8G$&S< %0+'+'+'VN}"X9X9%X9rKer 3.VYEG@6c ; +p1V>3 '9 X \ ..r+&*  lmw@~`;P( ;^ >a*6z? _?O%c'#xJh䈀9LOȃ ."0=aazzXLOD  H "DzG=1 QVFLOAO AÖ'DBD+"i" Ďzd %'Ș "i)"i"i9" czZzZzZzA="V# AOkAO'DГ "I$zA="AO∠' DГ$"I $zA="!AO:҃{ i'xO~W.6sg\w>A֕`fs\ak=r;BJ+3s O\f:vԱRD^=!teW+{= `^2f9K$X6G0 ٨FK͆&h7! 3Z?bf3}o9p_:h|/J_j>RMPP͝z[zLDwwKy)7.Pʘe e+r:^Fa8nyx?U~ڶ=v;.ݲIPߦ=[?!TV+h222oTUsNE46Z8y8;<:fgE]{}.ӅtV9w8n{(byڀ[444"5,yt8򢶶ԫCyNz+EsL˩h墯S״lXA'H-$wbVMNqEr;^04ϭM&E;׫Wݵg ѻ'VXzdq;ƎKnlai(z⛭|ivrvV3)߿O^f!sb.sw4ܹs95dMI҈b_"{BAU5JIY3<E-m.~u=5 $z?O,J#cez[Kĸ֬IMnmr.=&mp0*))1 oB_]fq:Ykjj wrEYYr%RE&t7ض-<']߉ 4"w $*XOQr \:r+o~i&T!Dsb!:u9bT%k0IZ}H[exgg'3#MGϥWB\>UUUϟ?Hx(OpFiUt Y3o.5)4W˛\?P%qUѸ' WEn:%p =aou ``$'g?(#8M[4CiԚ-Y>n!1姵֟|i/GZtp+R]njjj~ }`͖Fy!!Fm.oR7߬:rɀs ؚ[Ο//H) %mj._laЄtܞgF oڴCiOo?ҹ#cy7eP)jQuu W=|-?;ؤN,xa(xNǘnqyEyC~+WӪe>ϗN[1XʹK8t +l+f͔N)EQQ7_4 :~s'a]Uն5#]-]vpM,Ka]좢\ʾAtt֜P{uk̙(X,eכrtz/V-;TVX;mmA)ZjycGHJoN*}1>6՛-}LėDomb|\ʥ}^445nڿN7L׹d C*y- ʵWwhTfnI3<:]hƖf>ӱA:qW2ߓe`z`-pzo(2E 31b!JJ-(DSҡ0i\A [G˕ 9Fen :J5Kz*#?jmzʂȆnb]sѵyfWuyj0éDzTC^-Q2yLr >o_33Tt([K*xTh]S<zKz%lO[ї1q]ݢufw9J?ߝWqBM_w__R`LǠ`m~p}Uc*ƱE҂7ƲT:w>S\UmS=hIBG'%޻fƅWW0h|dy)\6J"5u{9F2󸒞xvUP؍ᚕ0:8.]k|\ktqX-"(I#'5Ƌ2^}q kg{]n|u;Vnt cV#35=Azxɮg^~J,?qKDtA׍߸/:oUGv9"WC֒ӷm_ede[HRD-yy[IK +*:coo8V{jmE[Ov,CkyfmQ]ژMz%ԗ}_}}}uuSYeXXݨ}Ep&;S֩ i/#M|/t{'H38&tX F³i(_3s?IMr`S%20kr>$ݽQMP;eC]{y'W&Jk2<6shamm}3ETXS$˼[3-YUe)C4ge@nydBtoS yyo}~ .>۝YR˴5ddd&\r6P\n6N ~V!y5;[uErg"7]U޲.YTO{-lG7"Np0,}QpmەG>\nSWe'_z u˷;#_Cܛ/Nj7755 XKDnw˃KtM sIohmmGS'?wNRRnRU]Ty]};76=|\Z7.=Zcx{ӫWyV*`ӫmgΌlZ>U=2QDIznUV2.-ov=-" fF84s/qBb"uz|@S 9ӻnbwRV~V֕Iu%%Dmmƈuyi]oK7JCg UNy64w+Jc ,Nz=(bٝ ̳?gl:r2O뫂5GT(RPU߮TA Z]_ȺpiNur7s$Uل((702e/Pf~8A3il,x9ԖM/XmKeCGѧ1`5-eG-o 7 \8F]P%tӺsT:Yw}pOβv!r՛Q"w v۝6t_w09B"$!;PyʐX#>ɖլo5dQ`EJ!QeU{|oXѦZD$/uBuc^Skr{]'2R,!~/șHșrUgX1k$S,OhD X2p?o 2 CAc(rQ*q33}{$AEg*vu_{Rk(m{[:m_a.D i] f(rPQuU5oxgy>Sp>ACsw!KSM Q7 H6bj =A+wa uՍ*הv07dy"S$H]h$,S{˥ ׻#7$05lq#o77 6ZKyaoDcH!)'{H Z^nSs')KKi4); Ǝ`ej4a[j96Q9C-'dUH!#H>BrS i[MT7A|RZ۔NЁp+y5ߕcJP9y1zLoԪCm'7p֜?:_ Q{̳1|!io\'?K\9etG4%}W?єD4%!)hJ"$)i2)hJBDSєD4%MI0=x[)?Ӕ$4%1LIhJ3%a[AhP"oDIG4'}IDsќ4IDsќeN"|hL٘I0u,fLf<}ZwF$l燐#(~Gt M80}/gDSgj_!~5Ws_!~5Ws_!~5Ws_!~5Ws_!L!L!L!8ʔqeʔ#L"L!L!L%.#L߳2[vj *2_[SU+Q~w?s%"Z…+Q^r̰$?n K<~خщJ/;OtKӓp[r^O=sWp{4A~ϴɮ\"^>F+FlXX_(aK+12xsb`)L]]*ǡvb^BO;}(46zL^uSMKL?mGq n҈toVTVTűegD,oUӯC.[755S՝Z0=nn~>>Tp]6UP!vX,m)k&L#V1O5x/iDGj r M=ͼ8^_6<^Ul(3J us;Kwir${qMؑ 9/^looopܲ@A[IEڈcm,k"gC3BɑƼz2ڟ 3nR&޷/cOq,'X/=B"Ns{ܱ9Vb5)jhmmiuBOÖ䩨iHv2OyӲ"4;sHn_^~S-%I\ryю cu}%Tsa:aEV_, &Y>C+a`` Epַ#al)5Rv_c8)RxeMs-lMX]ZHS,3"q F.gW OV_ԪQlìQvsa]𥍍_7bMM M NqEy\.Uѻ+e`֓~KUs, 7;T-VՍB%[i! j4rgCZ%E)WFA2Rw|Ju-l31>V58W.:Ņ#Av50RmÅݪBՆ% ?Ӳ0nA%lvZrmY o=ZƼ= 2]c o"3ofBuK[uKYD*iJbg$V$QR.McKJ:|Ѫ \jPh?vU4Z$hᲠfqrd'$G~&%Nl sp&: C0h>R쒍z#TbT23܊Cª N+ ,t)WKI1nmxoUX75Qؾ}`u&My{$184/H~E$%׻XͯR-+]}H--aT5K#=׈70f ]]w1زwZ* wBfG}sl6LBTgF,i[<8 [1O|Do~~Wl2nQ"?8iA~Aǜ~<;by=($GOw.X]8"P*pyj=; A d'IZw&?Դ7.g4RD/ LZo5V-)9X&*)INe$J*{fPT[E;? 2!a9%xo9* 0 oKØIϦ\jEEuU?pɆ\RE ,~4v!L^CvhYȰ|L6"eRܙ SIpUcn> ';ZȊك]/ ?"ztBCFGN.C*#4Y-SP29ovM2oy*yJuw5Uw ǐAݰZ*Ip +zPz?Q8ȶ{^@jGہf 6U0ŰpyNgMrcMiw2W\*[b۷ vc}%o^Z۬|:APC!ϧ II|Αɔ6-9:(xT޾⒣E'*t8"0j>7/hJKIx`@5q jOtG ]_G[\ߏ&mCD D 0-.M.]ڝh4FV|܂ΐ2C)|pF+ CpUc3۔{G]v#ktx]nyot%,&4qμ8&.H52G0_*\Jmø{ !呕 gcJ7Ɵ~dSϪZLwnj!qTj]8}EJ&s%ž}fS{C߂v(ӟDga)'4|4sF/ [9q$f^mIe. Z~4صo2CP_Y2'LQ#"5r4maeJb +1|<@]Bxtej@dz\jiVlQ\/::c͸uevZCet85t3s_ 'd]nlS>C+TI!EhN)1g;J r.c}!xޞKrZh,ƙ:"UNaD8r%r9-Fc^JZ$W7d[8rmaA s]P;+[a'5i\BHɱlBk)RrYRO҃HMmfVHrMl +POOz!e jk ,nժA߸IB0P_?臱AU] nhYz ́fζј7s`& q%:\a->>,2q1`dL*z(0+wV4_2G.hh lkl7Zm)9x$w 6jjOgd FS#?jubV,pŔt]_}m<::]>'M!osY]}f]f萤}li6`]3~~~\RLiHxӖd|hܢU*DfK:^> vNXbbѼw^ D 1@YyrbTkQHYԌCM7fbÖhhI3|~p-MxR]ov!=Q1P퐃r. _9VX gX E~6V#YE:H_|%s0ɴטit-mkrz16]\]O 5d07YG:#P.ՑWdLww*#W:y=9 ؎ '§9ި{ť"8A )x=W\߰Z@]U Z=|sJ=;:Z\*Bt:+g;jG }1թ]4]d,[ լ.溺֭t%9 "I@ C:~lj0ʢ,Uo1' 2k8LQ ȃa1 EM3scoUоp{Ge6. O~~򡉦)dW!5լ͵+\D+!r&e/2(^8Uچ+`*=d1,5Vv)6j3.01 &C # r.Na(o,cr Gٓ K&̘"磷}ELPs,kEGW7TTCԛ1Eha%taY:@Rj,}O<ΔNV'h1x.uӳ $;T YP2^v%I1䝫U|н\,&ơIt5C5j?*MPu7ϳmcU qJ_18ri:]А85ZhC͜t"f+LՐזXj ?0 S1 5孭T-3V"&e"2nN?uNy;fPE2s0I.Ay[W]Kћ*>@֘j}8X"E<}(7VSh+z{fب%~_7stdSi)Zm)%bzJYWɫ;{뵽E' s5<<|zf5&,4'e)|싘R$h54xS]OsV[㾻A4P5%Mk2s/84tY84L i,Sler9G3)ۉƩͿ"|[[ =s njL^q."1Sf7X q ȂXiЙuJ4Ytd "-0-r"0}9s;yxb띟?z<~i³BQ-\=̩+#00Ok_ܽ"ܰv| S33+sp!W-ɳ⢯POY80 J4C䆸2yD|5,i!F#R7l7 l5OrljenT(?Z,1 ‰cӛ\1#gYViaT3ގ iiDݕC WzW-.]PՂXg#tb=i[:.&͞Ԍ/tߤP\BD#K~泊4@՜>U|ggJm AgQs~ʪyeЀ"iR;Jli ż[ -I .҈3n0&J| (l8tBMV s@]Ny7e3fh_!t3t4=t'{.z]5xÅc j'o+M{xNL,vp8D4Vp %%p5t2oh242/t rR It;?A?d):`<<$w&n$S~Ae4Ĉ'RQ"@"2wN iZ<`c‹UӝXv2{-|apKX` 9Aqj>!'愪:N^ ;;z&Lq2GG4 .KRzZf}kbbOo( H ,#M nnnb|O~tF&=}UH _V 'hDN5ˏY$4n"q~S/*~", V4[•t~(x{?V0O7)@ ͍M>Cu(Je'Ԗ6abίcޕ~:ZMFD0Lȋ$ٽ.K|1;|='uB'{tRV[qKد=[(RcorPƶ+wx펑G%0.۩@;]Y%WuHQ H8rړ49.uQLRm; zS`}7Û](.QkNCdׅۻB'b B麱_oRnF+uwÏ&ϩj8Gʟ60*:bG lS-]eV|̎|Y Tw] .JT^yp{%CR޶ۻUWcurBp/%*1_wpZ.6eEBh:رSH~ں?}ooo~>Cw驓 {ҽhiƉ6lta))ǃu< HiԏHtxn*ANCoŠ M'FH+ }<+Uί#I gidaڨ!>cKvmZ2{r%B)6 :  8!s u.gb=;>d)Qqoȫez+1a4[QP-r#>#5b<Ĝv/J7coС\Xv\r,iv]m]a$a~DVVFE`ȮkH-y-1uN)3 @|kô\O*Y٧+'DMF&%1'xAVzD 7f,4r\](<_`.ر/_s{}H.Bv=wt}&sW-=K4?C-yNY'PctCq-J x ^W:1%HɊh O Iԙ>qF?RW *kiz᝟Ғ+dı~$K~z&'K)^+c)ESC z9J48⡡CblIfZ _!:=FMTe߰I˙RxJ`珍P+#{[<Cz]sM Z[Tǽl@&O`igicp~^. L!J9`HinP1<KB)a/ɒ@˫KM&Ez9HKJo d{ꀘ~3 T: `ֽ^DP@ Q2}JV?'o$> E\/-E#.a&n{k 7%i?teٛf-d,J .{FGSVvr"`urXwE1GG(SxHg>eJ"4JK[WPw|`Y? %MP}O(wܠjYyA7ǩ@w04{Ki΀~{wTcfI՘bED@o.Z;Uaشv# M.V|1^{N+&Tha>YeE}+ΙUTңP“<}6%ObTn\$X0vdG_\@ʶkեD۴v N0gg a?c jKWڳg 9,$ŸJTo )/{R҂~;r=EɗCcn46HXPH',1¦%H,r\bGgGmt(%_B?pٿgfh%@Dk |(h`}p=217&tr/po-uTyJDD}}OǕg-1Xg/j(S_;>}4$(K %XТǙTY(8Dݽge$CA^'dD'cQYM34bذ9&Fc]N*/8_P21v#Iy ?+NH=Kj-V,&bCKz&=@Fye,C< ^dn!!JFI̺ewMĔY"}!emsEI ͗Drx Qby>>}qi,4 k3x^aҺ,B率<.^y#bEam dn4K>;!M}ZHgWPi_Yqb=A? "LJ™q_m|Ӱ34n6v\f^>z@);vAMCF{?I&ӐqWy~eRᙓPMBPf;DrG (4ھϾ)4%Fl=tdƛZ1c [jB̸̐ x>|5(;O7Lco/=?Mm_E6. g*@>3XV(K@4l{!U4CUI/M]C7Y=[$ѐ-9t`<>TAtbQ &p@d^G'Kg˞I;=N(6jNdE wUٙ|նx}n;I (l.463z,.T sf ą1>ֲ!:,+MbyuBdW}*6%gv^itD-s*)PϏ1!@XYNbC `>t]%T1*lޚڛ~<xa>U_:9fŇgs7LH2s| C+N0~7Eq9fUG?)ȔVr  . ?Ʊ];*_.HKI\ce;5*c_ 甃tΫz\E&q[Lɤ$}vBYmȰ#~_>aHرm]e1< NG:==@"T`K'#CH .xlj Fb&.M&cX9hw}1҆3>PG0<>B){BH&N?2h\)|s~wBxt,*:qT};lvvc̟ϖ&v9'r(aeC28<K4C)iXu]>hmޕI}t0ei8Y^x 1 ˸Nq7x,5Q$III!!! ]?hƒgt'۹;nl:z6ۘhLjc ecEK'ɯ%QyBKKkr:p?c7)>,u8fݵp++au-6"n8I]mB!gH}z|i& @s]Cͻ֩uTDĒq͟;?Gs,Z# rl,ཛk$3Vh%>*rww=;L >4IW{j]eء:'İ c#Ib%P&&:֏nѯ%Zm)}:ìL ſHv6JˡDx'W1J1JÄo71Bj౤fp}ߪB|A[\B>=O[fKIv0e=U!qmD +eV>mJߊy1$MD;P(g/~*> XΔ}%M5"DBKUCNycLinħ1ΦÏ_l,.=Y aiK}xfmɼ~}ts v_nJ) V2IftwR=ؑ3W&}_'>Ud>+x>䪌ۓ'|JХـsBရ:7|@33/Cw#FaS~Q}<>apgq;*w8yRA2Q yBd#^ur9HWK?_V"H~WTxq-t|Ƚ1'WmraOL#(#Six%&U~/[<{}i~Bw'$ny:8Ch(p{ABN0ُ3͎@ ڤR,C ϧc BEbtDJ34R} 橋˸Gl/) Jkk(k uy5uզ~Y*UF|񵔳")x:5>3rzTsoh*|':g%K8Vw^ kb"^>6u@n8e"T4w)]|jd][8)z!WJSдkF,ZEZ\\ζ@l}WA&YXAgrBwhA% i22- X7c:赜$&yLBD^< mX$PpElb8Әe0[,=Ta. )66+N ЃqzwqNMsK8JXԉl~sk.ڄjS#/%Pt?r $1Uw$4qHmUf}F!6 cqv"b~c]%/WCps.H(`#tf>y؁g"8Q _'os< xkhލ^P>HRKFMɸc-9Ke0% )>[J:Ք:(s;o#o-le%.42ikyd WћR6{[9 uFXQkP#SNGGf*s y? {M͓ϲ&dL$lg-}Z(5A34!V<ܓD>\J*C7ᯯXIeeWrzl߱f3qG놿& @Ve$\6r+$XӦ{a̿L&9e`߯FePK]JwL 1i&\"Dxa__ɿ &3L?de0aku5 ? - a3X'D(:"`YSB; 2{*cfXU{[U> l@r"0Ґf蚅ƎҠ *%aQ?^`:%9ؘ~,C(_ | aer!A9mBws}דɹ?ϼ2U_j UUAP8]nl6zmP*|+&o㍗Ӭat!Y-777g/nH-E2IxR00'v{IdCe%.Pm@<3&s]pbUhnBr - 5U?fXP緋~QX;6. Z,"/AXR <潟?1v,zٝ-%6׾ >l&4ְgﭿ| 鷚% p=ڪ>ǵ>`$:>8o\A_563͌x>'n\ǸL;v!|?A+;A[w7C8́fX!sMc LlA [ wr'n%nC4Ц@g5<e;~M4 0=펔,WbQE52v80GN* !U6}f_#$c$h)ȠGXKJTwx7 lYn:;#_-Npa9d,bUb׹h<($a.UT^p(<,I ]ε؇8f ++}2a ~ cJ64Aܡe3Sx҄ϱXr#Ԍt= OQe tOGRّ=Se_U!n~|'Me] {lV.ua-5v&So=e;`Ң g@Wu NV&ḷ%],F'&SroјU$.1c$PQrF" 9ȝȪl1! c,l\,jO)YDf.8d VfITS,(C6z8UQ7@@`_CpO,ͭVǨa MD9%Y' Kg1V4yJ8KڇTs /ΎRg3O{r֫z| Lop!< 4ieIsj$ErRn.T6B9-L'eOYN8ݥbz6F@mTk-__AbMf.6BI.vpRBID)M#lr5:Pur~%6=S;Ք o7w̫PA zf055ÖS\w%fޯn-O#BrfKE[An;8!|Im2j<tjOHðu|}P)bƟ%T0!E]B^"!fDG' `IgV7ZqQޮd)K`ЌʢWtmܔ6i(Q[Ό^јW/DT{ |[qW=&D*}sdyDF= O $Q_X|v&%P&@&IyMs07Y$E14-j(f _aݳTLk=hDuyn5/V3)fBBeZZp7,֪4],G .7wy:i#k %k}~SHQO'JkəvzxXoTr,Vtjtc睾-[x79opSQz)d.TA}eQӘvaׯ}w8q&Ucӯ@Mmc?ͪ-S@>Ad/Y7u:3ͰVf ulji e94r\t3$/ƌɂ-RByg@\1L@CTEr5|REeM,<P~Ң>XYz1cxR]&"p E[r_в5[E"wwEi.!GٲWeIyխkFYc/%|><ޛȉv)]Z9nQq-cY[gR<6cYgjT<nEpMϕxy;o##塻1j޸/ AR~A ?pg7~5Q= KAyw tȱ1&nb;c#j6)wdE)PJL)w] ɤQަÙ8!6ԯV_^HI7M{w(Qʳ# <={uնqpqs#P"S&R ?3 A;}7?P(z9nd)hp|V2J|]HZLNڇ o>7Sv2φO1Ayll'0)佞V2eH? ZcQ`THas 9޿߸H@q?H @PLUtQ 3S?0`Pt>ʥ÷Pfj=A$Bq,BDf[@7 @gK'3[vQVb^cbQ{rt$*tʚ , hyz+@6104$mf!5'P8*Q%8*Hdt;0VG +6Aqtp  8tp x4;$Cpmܝof.濘gj}R}Z}هn`-W1Bⶻx 9xz̅3@O{QߕN.PKC< ƕt}j~Ό';8rOA K N7a&ihWǗBk.n>hLmn~2@- 3!Z5et!XA''ppM koLbiO l 21@{o)Pm=ڦ̋1iW"&CmwDdI3LmAc$ j$Q~mla1=???>>~NlW\|A]ѳUoh"=}f,AW#JٗUI<2T,g`2(.Ȍ&:aBk_z3Pq-Qk)Q1 m?S#;6jg/~]rR11Xh>ߐ ]_|>BNԜv0M&m(&<\|zciC#1w$d &@ jZB--za.Mv`쇡O:״ױpx0\xH_|##Ns#*S2N'@y#ѿP\Ksj$[W͂F׾X:HSTVpz,f:TEbёSօtw{MwV|1r(+5* "O [42W:3d/ MiV+kMi/Ys'%={ RF%l'5|=豚V1D DWk"}@P+kP`Áqh5ݸ[ƵG3Zx)Fݑ8`0)ĮU#\gZ |WK[h9~>!B QCǪJYqFd~E<5:ie7=W{`2j A5@` <,A|t;}(E_X9skcU  /=o]˯3Uy͕Zf yM+|p3~楖tC_[Ppj{D)^LŠ;.C@<7D "bHSsZ€bNW79<3!,v.=´ CHS&qV/zH5cCOy/y8>}x^A;^"7|lQg{{YZW9lv7\5{)ZvCi5󑨴O0[ J]*"puP<ӎ%kSuKchb*t#ٓx TQ l Z,qZ6%]op*?rd*,]k-əﰆ2|OX K[e=d@I"X8 vZm~}e˳`|I0#%q:5$>͓.ѤD'Q9h3>_eGXk!CLԺufK"-Ʃ}CIgͳF+%Ŕ.<"P-8 ,3}e#ܛ)I!#FDi:=Yl+lH,LQE*V[X q{kePqŇ2!E)y(춈 kc,,PG3!,w4[ 7w׹ybWA%I+Ԭw ޯjLx aߛ)߮.B)R<-qyߊG{}U^Ss|'Vei7V~l9’3+Ĺs4K'rf՟}Z͠@ I\;>N=+hmo|{w3ݮZ(gC@Xn<šrZ6Ew'/ֽI8-!y%/?7֗٢V\ab ) Y]Ýڑ Bmw^ߺ5̆)[?x'5Ai*9#g!5RR8~>$ jk-L+ 0CQ5wasڍ(诈 1 :n1k6(bee1F[I~SMg]l@do&/AJDE4 oy.։+cG9vCf Eh:2H&.εp5U96ı9w< sru3yx2H<.l]}X[ k/aQys_v WX[Vlнpu<7] #&ĥ J_[[itfv+y؄W8ge$8t7EI?Y:ߔ.ûTw?v\Dwy!DOp%v?$Y=ٞw\!kBF_"lzy%jSvQk s(ϲgvopҿ!='XveG\ڟn; m]w!u (S{{>H;?kcqO[l ƹ@:=A35>l9o t.umߢJP\]#ˡzWGc=] GB-zn-Jyy8?u]xXX?7jz塈_o~wmɈk1un;n`6?%ќ\>u׷תD[I--Ҵ3Gi'gIf P:h"?Β/ySP% >;bY2h(}L)~}|k Ue#{SV"M)H8cO?o+scIݲ R>]uS6S+qˈCMWO?pÏ/._hdi!~0>5| U@kI-Q|Qqt\ (0*18ÃnM$8M߱Rs5 еldt `>$<Gq]XQX?Gɭd4;\D-OkR<DzE 7Pi r 3.μS Eq˺] ik|l8B/ힽԞweS,A.䇎@] 53T×o!)rSQ8d{. zQ.,#ѻ^ ,iZ]N3@p?h{@oζ?3 &xo5FZv Wc -̴O @G4-@e̟iC<$ fr'R0X[:؞w|wsue6߶®Z]^M(hKUO[GA.m-թPT0F }N?*K9^wEXȻ9͔۟Z: lݔJ &7 ÁnHBWQj ҫ9A^ QkzǗ7*T5쌽@K" *4'3{3//zkݚX\-f Ѿ,ؿ6"Q/2@8*i&6i nl=|ZMI&cnzztM> @n.3r%Y@Cw[tk} DkFƕ+3OGϾH B[=L@ ;r `-Bc}VͥMu~G/xQS8k5?ZZ9oNƥn8`DPlsw؇Eg|eϗ,dmQE݉Zxԩܞy\}=:#(*!ٟ4ɯR]oM /_^ˏ!2 i]e&) 6yx(^_ܿ|Ñ###Q|г@f?̈f} P7#=p\Z2e=iOR׋phJlݹh>xAZZ# =&dtThB/4ϋWL:z2aļ~Ya•8%/rp|Tͻ}qfdEwwp%jŊfGw9r BIMG'[+^9`5DKe*;:&gD)H[˓,YS@&Tf_vݴ%H?  wr&r-;j3&7蚹B`tf1 t F1plO>-ұyM6%*>[PvY۞Qk@y/%v h}_\ّȑmGX<9:ŋX B%* BH|TG zZftd[NĞ!}l6t<+m8^b\UsF p䚡QZ0Z}[ZSnሀOC} ۊ'Qdrc$롽*1 t!oj5!g΀ѝNRL&_|*ʸk| ӶmYvd%/-,P:Qtӗ;U̜$ /^rBnٖ.Fͬ.ee۸h]}r,{Qg[ƫ85BO͓=] 0/3Wq*YnYZKH`'_DtZ{ҪZ["m 2dFT}a})vTF*J ˵׾_6uݑ͊'ˡA 2P"dL!c]xSBddtǼ(sGԏy ǃ{g7dELeUS& –&oKmyQK|woё%9yе׳}?IBFi/YE4* f5ـ5M&%۬ Մ9IQt>ܸĮԐ.TG.crjt(.dfXqv=Yy/=,?aA'03`W8b8=#$%x"$nmՁB>{p6fABm0x-RzӖ+u476썆Ϛ*ԙOlUFtZOd+ {Hu6×:pgp "9 H8w$O)qtIi\ ߰ r} [xK"qT܌l9e_"^I<\nz]\9sSdGp/UNm.ف`zɊaKA +jl,o*ezY)?XGc_YXxi iW呻4rg#އx-_i,i{RK_i,/*?<H`!yb쳤gi,$h,111 i,grƲ{P*]jQ422:r4'ʪia2yPV5B؂T!_)I}Ɏ!.G~zPo AKq*>0±. :YN3?dU>^fc0ÕofB 0kQV[U}׻5Β(!isP$n!jnJױqt7[mli"(G?\_ _1 /^DՏԐ}+Nŀ;sQs⦈Ԟk6_x)k(MFSAwu6몀K;%p5''x)iD]weezCmܻ HָI&|!oZ|5t 862ƣD\ 8"]&(T ^qQ_aw?D>!abGrLo)>\];qD8wdn|X\@hփw/͖h0IFa '+޶= x-2]#D4#&q$_ntD ?t/p@xSԬRln9_*T) lS׷h ͻ7pTv Lolq4@,llv *@-U{K|_U.\B =T =7! ~˼F݂Qy3 hjAbN5lj` pGēaCII ?CN߶zf4A ?PvHS¤}'iYJL@)gT9BG(K4I#zpZg:+n5?hĕjƤ-R]d,.mN[쏩#U<1BgAc޽GW CoѼʪ%75TBp C?m<0jxJ%Э[tyu:@ =ܨ=?'ih*}x2|u/*E`f%3x]گlLwRvi֏/&93gb[Wp$1:i|>axʍ1%R`At^狛EjV>Ԣ#tW@ *S h^myTG=J3*vM ʆTZ"?A*`%_3VPxlX8*D`uo3"pjdi Yuy}2f(lLtt)vՐ#.߼|fM67T9 S"bX?z'5?gň9F5x{]ݬ &ZG0VPĜwWmW |$SjJhp6y-EϷ7*ډ1ccpֳ(|f{e/GrtIue/lOK> \p6XJo8s YDh cSRic.CӉ#+ ~ql]w\pà\͒tDg'yz''Q#%O eЀ1Sg1¢ fgQK+{Fp^1Hr1;<5gSƋ |P ײwi.kuDh0-_r3ڠ0K|yꇁ;uA(Y1 G>X"yP?f2 K칩koUL@ G[QV{G6h-e o^PEljEj@%M| Z t+,TwVk[3MhX/0y"uBzϛrչiBё+%]K^Pr9ʼ-ilS9k)؈}()δP٣@%hLxaH*uKXPtTޤs5$ 2މeڐ}ﲗR2إˑlw9)ʥkFPۡq/Rx8U9α>$Lw5OrqpC9o޸}M B@A6ofBex ,ǓRTs7}"٢w:ڐN+wADjQy|bRXV: ә߾"̩ͩ_EbC Y#EṺ*`IаE'da6EWpHjm f^QQ]g>e7|\F} \llza,M6^Ϙ:$R9UDl[P~n|1@XAr$:;_kΎ ;DQi0-hd "G6U$Nmm曙 β~}s ?VDRBsɜVF(+koz0wZ Z!o=2x M~4p8, r) Qgji<=9 ;WSaWzR|_\lo?[>Y#I5Oz"+HKT21>-4>ok!f }ADoCR6&h5q֤ωgV {"VAu]<РGiO gf:B޸y[v3}؇O Oɬ}P b7U` ?DA#5 g q00oʑ!Ns~U3m7V<7 AvDťTWpv8J{1[k.SE8w0ф1oWO| 2)K 6&4e-6]9@ GR2R"<2W+Oc{5_ոcRIV^ŀ48i3($,[B)cmxnpۜYG")I^MoϹlL* *\֩IEWi#ۅw@0-6X\ $ !B##̕ҥZ3"X~$>wwwӲ0Qs&H 8S@œ lbƒkg'7v!NU[EUI"6ېW~N˻>Iu/a]WO)4B]fnÌ^s^ɡkXވ5X0^9aZ|+n15a8z W0;t4(ĞQT]zͩOۃG{j߰BAG5'-]~9.'wΤ5iHgEsYSx)Ni{ trS߃aZu/b`N*= 6UHz/ILev[8)fp+B6(n6>Murʀ!tù\)'%ΊOQچ<|m"p3P*ަжrJ:+aj!Pp7铭{~V5l+N|51]y*cv]D*jF;|OE9yЎT1ѠNy4HO(/ꔽ[|nuЮrq"YІ-EC/$Z,gqu,Q;b\d|f;PRv -,`ϥYhi_aFg w lP-$fQm ٿn+&Vg9Q(!ki#S S)xg$ =Feg>)j55~CQH˳ ӊ|*/{?xtE -ωA)h$%YنOVt"'y3+Һk+2þ^k^E C#S4RsLq;WlM ߗT$}c3O(v+[~6y'140:,?8ٶ7O|$! m yg7\ܚTTH_v!1d1F xԍy.MX[@^ RTS.:n_8v@Fk:p)Tp4_;QϚo^!ܤ-LjWP3=6wkWM_I7WI_We^?q?`2ΖgIL?J[- N5vg$U\|E!š2jV٤fv&noXj"G^WIDƼ:~Hzyx#dd\p"o( >^xìwhn@w\ ++ySqII辦\)_?2RD;W^zև?I?5 NwG*XL/-uz`nƞ@,KYLNTwF] R4nЅ2ÑL"f7yJ#l]_ȸQ%JW6wdGت{PZ!G4tbv=lv-%\ <]fGU.@Z V !6 [)G-qg8R,OY8W%']QPkVe\e˗+?i wV 8QC5}KJv]0|kL9\Yn2DnqIzڲ_hOl CSu}=u^R:B BDfrA~>It|5jW?i60bT)<Ed(a=AO.nngs .#3]M.t樂03zekx:EK&(@wKeKY6m>ri4 6S//+і­r蹯'α [AO5ly{p78Mr!v ͘mJ!ezyD_ D0prO;^gLEEGďGo(/wǃ pCZZXq#*PlD4h<3\^ P}^D;4>YM rYK=\@j,`>ú ~_{.L~y4/&"Kna~Yg:=?^r]ZHJ^KݤJJ]5gB!up"|uN $<wG'kR# Ծը#jtL`::>DJjbȗ&q{r1X M,s^liPCx%~h_ t.&?NSBC~"e!|$n.]E)m0l'֋ʀ3 d %0{d3~J1b.T||.NLNʱ/_Ļ^dRΉ預x};`w}sy؎/}y 𻾽"nN#}I-v19[+^6A6ߨp7ta/6`vQEc3]Xw3 !|1Λ;|QˢiT.13|?Tj} n/1rp,Z_VT,wuYSvFcKnip?5Fϲlg'K֒#I}VVVy*} }~;<;L0S(be?2a8Y4sKJtARLYnD;vawGfzJRz],6(C N2pgi';ڤiyQ{rq`g5Vсe{xXX:<^aJO"CԾ ̸0nt9Y\Y&}@n5 w%.!pZxovm>h'kdI7IPG.ȗw|})3{\)/z.]?.MH;CIN}&B4̎Ϥn.4lUV&m_ Wl6Χ=)!.opx&ee5=s[tjӡwޕFFXFEVRE_O.+Pd])F6̺ەD+f7r ṞCkۥ !kW-'Vq,VMai8>P=A]d0ud /&JjE? 6>ڷy%ć>ߐM>S! Xf~QqA[kēĄbgiqXH"ݦ#^)Nj1~|W^/5|TS瘘1EYvZ^/zlHwZK3 'R[068]mMHS+[cy|&Id?j7͈rGbȯJL?6[ll8\f"Y7 g挿s[nFRixnz=yz5˰!#fe?+@ߞ-h9(^<_am^Sǚ|2oLF&YPMբᙦΤ$ңH(`P1o&M}x1ՃO@^D[#c<9ݟ /YzUBX,L.k%f#Ŷ!-CQs{,IP3ѳc`SJJ0DV@V0jW=1#Ĝ>o%7jpS+O;oPQ~f5\>:w$wpt{l306Al !֌$-$"c'HAľG "O%bf^efx{oս[Oݪ{{]tUW_y G_jv9a;(b٘/Rds`u\ck.Zktwc阰v#T<^U5s`:Ge">YpkG Si)#/.S`ꚚD{'ǚVkv/ :cd9O#37C[IGl30$C{_//hHU?J .buQ aPjKxseJpe.'֏噵MdovXZ@l R9ۻUܳ;kGX/kT: rˈM5_qB2 :JIu^LЯ pPJøM]C7)0?-$V9'})*00j  48e t<],!R@DtWH !1\!TBr/*i3:pY>mY39KN4HzRD% zq:YAGE(v^vnM{~bd!:FΆTq%]ɬ"lxM6̛%f`aḧR:O[QNώ[DtXRzږ?<1>R#}Gd].t]a$J Z&”t0^ nmkGn*9HQ䦼_ՐK9Ԃ( u'F FLdbtLPRspuvuOSٸ)(TJb= ?*1GӠ'W6|iQ}ҟ4\fمvPkDAsD{5n^%L6g{[DɴOb Qb1K2@pX/[g ':tM gǵ{6ڌѨ,U 7Gn;ķN{a!#`YcpO r'Z 77t kE hHDм#a&_!1l{tOE=X'F' u⌛$ox{IBcqiWm\bj0q 27zy^.iΪH8JwGU%Bv1oBe}'S ٮdcK6@^&~L>ÂLߤh,}^F0څYԳ[[ x#$b3KDE$Ve!$zt00jV$|y;n곃6Lƹlן߭5wZEc>_+\߽tytQ!q[k7?-wxn1ʆo%[ȷ \ނ_HIgמi>$-=871,{<| %d.}:7+Y XkC"0;r^a]]gkmd)k-D5g|"<ҤQNg8R1l&Azٛœ0dp4(SItQ2S9*la{Uz}3]r'ںg%`FBYV~eX_ƤHhV7#BǶwO_8U)y}FENBLC׉_₾<8TBd.JEJD:dwH~4e:sSJI{S<(H&$ƺ\8Ž]Cwlwy@O'/W8Uy%В(q7GCI˯FpUF=*`tw?uV[H'PM%M:(O5a2{HyPpې_[fTY s#._=%bLrb8˛SB_ pgMk((7Eޏڦ;U} `FhRjGIwzU9@2 'a) قPZʋϳ?i %,r1 z˃u#[k'=ښ4lZ)8V-<ޟ^MiAr|}k@ى7,}AQy0=NJqD̝?ů_UQ.1;o:I: D:::9>] JlqT^i>{)*[ADȖ,=U7 <2UP[:M?6zt1#jmOJ|ek:bƘV3By?x  >J& n>uCK3ه`Uj1*.Sa""Aן4匶>{ 1?Va?r`? Ð8 @_? |0h#|x~F:ˇQPc a>21?0c ow0XOpX/:iX-qJr#ypEVr}ׇB)w]-_$ޡu/{п#8;WE5CZ*d?W0xQ}߳ [vw=[eF|!~!ĭE#J ъ+{SE@CYr)2\_,ʹ]Śdr4NOQ 5ji9%70Xy&RTLoFECu@-hӒ5"/{>_1V!wD%!h zJzmr\ ۜK׀ d;|ud͐tb| tbKDa;/WJHd$Z\u*NhF@܁=`x߰d;ƥnlN[@x.5L3 kKP:ӈ8fA^%ŅL" rdBHx̸ni/$=%|b6 7Itx=1v/~ ~P"vw 5DMmb[~#~K"Hq V8-73Nޖ{fDQN)M&=f a d oT2'v}aPKX\QHW%3hhYFnV{YK}i3vDq,W`Wi^NVgz*i[ԓK3/.ջ&tө/iy,/HEuR%$_zOPyP xedVQH_&%|ecػy"_OinɄvOMLyY$`lHIQ9_~78j(!TMGs$-,mƫlnZZ9b*1a"*;ʕT'[T~J5sljjKڛE*L$߱t6&p|_5{.iǫUCq)j$~r%&W$&_͛(W{U/Rg)F Ἤ%m隉=[(vUkR6]6JUk҇L_4[cup 㷰404<Z]uD"D_OX7*A[+((`< o-m`멢 $bJH5]B[ jd) ̈kK5tŀ ^TxJ%Hgףּw   g  .!kp n!|ǽUuwvnէz~>yqs7D " W7D1l Jy+RRih; su;T'IjȨz?ܷ>;?u@BxqGP#g"7N, Fs]Яw[’DC㍫=gNx8Wiu77qG|{oy՗E&Y |xGVssҀz4%x~1 GnEӥwFev_4ȪeOB}ndU.w6e ڿ=O% vD;_V8G]xYE]aSy+6wзr#IhiyɔhmH:㦻6^Wz fyReɹ?eݎ0Eu7Kj& iw`ȋ'f ep^Yډ RӲ""=n-*R.GiE[ܩNNihA'v&,V\DphKU\_s%Exx:{Ĥ6r>;%by]Z\wNp؇`ɩjb޾NP0޺$<-#cW|@sI\CfmC'&v~Y ."1Nұ0i| HDtLچ W ̔6ڲE.F9:~s/w2[G#eQqB! {M7Vvjhh9gOIh4|md[9E~Qpw XOi#2Mxd& ?&hkkO++a$u]R7QPږE@g^)ANE 4$~L>WLxt@naA;_6d̈Mֶ!̭K@Į"W1Ad])S!^b-VFby y\(-ЖDdؐL֠ ͇#T\Uc̷}ۤ.~blV/ /bflf8 m<.dn\aFMD]R\b[r̒ i44&RE(0JKv  y&[ VݙgƼ u|W&M 1c>;@Z༅_g|{&S 킠GF-6߼s{g aUi3H&e/O]{cZ~ݰ[@&T_8CM~VqDj cδsN; -DU$"F׬+҆5Vl4q±w X82H坴-bry,8(Q2C2 7|lѥuW7^=R@[Z__̆#F߼1 x/Q'Y)0ސ>сO}u?*Dl;Gxج4hѳf%Um+jo anUIgG*)c1 F?QgZFbi_l4Ii\g5whhR3\ e4<nghvE\AϞ5uL<  `8aүR +>a aUC'-(Ӡ)vc1H% );B]`yx D,Bg;^݋7bg0KE[J6k6'=Z/L J"+4f4,X"F˵#M@xU1ChzDAl3S73=C [mU9MKBf󋊪Jb;Fmik#'6ؠ1l#\<]*.0ȇ#ѬuWVra->%bQD@)}ՒUknF㢋 }xF3ۓuDmɕXƭB1 *E G\o\j2>V1'<=pJ땠omus[~ ̚Bn(̫v*K2N=?|e j3P, h%u Cm=c̲1Cg7$EE9 Tg!S+$u}ϱaّ>ڢ8Hgx?qJSu=Gq$FC73o&r$H銴/i>`= ?}8~~o@|$0fLE d'AU~ ||8"QNjt>bz#`_ >FLHO{9п؍Lۋ"ᅟ'F E+=$=bz))?rXTdS6ӳ\6ܔI" ֈi#NU91PlD&Smm!͜>^ _Bm׮ y2v둻!$/9pM%,#-!.$pr{_B6jA8I_ ' BBwVܡ1fz!"V~Sے؊u),gjI׳i1l4\} v"R! "j@.a~)`gvM^"@ԔE}%1u>mJm0/~MFZ`)'6Ta{@,sFLVsтAşXkm7N?~ӼmC~ {x9%`0J7Uy*Klv`oWnfIu&/jdVr Xų^3TX^/e@|X3{~oo.%nϒ Yt=T stmY$ҭkcMMjGddZ&*F-T!>I3&cg]I?ZP>:Ab%n]Z `:I'Q792H&&1adJyg[ qus '{ζ{qAEZk"%Vk8.n >\Q^0( (\6öuX᧏N8 ?-zK")DK[bF*U5JWs(G#C&Cz~{ @Z(OE*kn0?.H9W#m&F'i/df(d/ R0v.^f@Rl2\uiDm5w; 9.{ңzQDݞRC83EЯa.YW2]3I5Vk`L$h'DXْ`(g)2'L=w6 ,kZIaQi%|!X[83͍(k$NoW_񕺉=HB0I/Q2$3 .#?gX'IIٳ>6i!KVӦrܰsga&am&t߅K62z'PcXۄRDFp1?_~0*ZٟSlKvrL;e$'=Ec\EE.RkwIz(0/ %@:mڱ].%*Rn.}ƫv񦶉TLP9Ԃ]uJHڠ.hݰ=Bt(JknbN*s^OWr/m{%,cgizp V\0sɸ1>oBBfG_W*}f}ܕR-U}\o%0,R/5=Ep6sQ> &_o2AFu8=o#]|eRvs"% +Ĉ@.D馃gh( P圫XλZ'4 <B1 9s&_1 ܴ K>s0nz:YSHIVHO0 g0/=Z/*;o22JO *&]F 6& @i-dPg峙Gןq濺`Z7kl^Y{ؚ&G^im/r RDbOS _E Vq,z[CvVrd=R5TI@~7쇞`p`0g/",]We]&7TI{xG34m$%M˫w]No G?4|~(,:`&EgQX״Tfa4^vHJZkdxӿ71/ZП}@O6M1Jm^Dҩ?gJWˏ im"5١饢+XaP|cD]ƴ;)' '&GoxG# ټQ13fճ`TKQ]']DSb6fÆ5j[yrNщf}hO1I9x:eK$ մxCu9$%N s pm0 0 /+:A[ vzPsl) Oˬ}|҈u;YQ{K pd JV)<6H0AEt;5;%k+]eS|㡾n.LB$g$q7 R.ZuS#XrDFODAs`&GC: rl5*`yIԳj1=x;A:r&/4m%@,]q}5hBX@NR31/fMfB\ DB0b0L4y1ֻU?&*Y![@vY7Ww\klTLWvS>CޫU\YZ0Ԗ{6!n+Gg.'6U}~ __7@T9Ywӵr (ƒ H|$cӬu(aBRIe&41I4ٶ2Vr N^}HHHWqEKνn: ts{c`HAoBz=08ѦQ%d訊4c h%f ߍ;n[.=v쾴ugߩ”p~f_HR+U2kߺa -yI>Ң9U}%iS#%hn""WW\㠻/qi?:pd }N qE1El5DYsWiUv..ypUf |5d]"|ơJqG T/oFZA{~#}mdeaދ\XB4)˗Ȋǒ"%zOUOגZޣG:F~r@};@>ﯿP)虵z?[7]Y 5@04 VksحHeAz)jH`l`zF絴sbKhJXZ;I )R6"NeH(r?%O.RSnx0n_>M DD1F3t}:D B1+Z3Ng#^= [ V/V€ !3ATmRr+`$speqc}Myc%'!ΏP1xy!UlhZl]˻] n9ϐcvo}\SmxKzOy6#s|/OH𸽆}_Kg~k}_^tNuLI6m}o;@W;VON"-U0 F/Vnx_h>_{ӛn:!QM/l凜V"'f~* /tؕPoSFn7*H7\At) V"G`qxKL=&Ls's6TK!q k/Vl+ jh -Ӕ je+7O[>0/ P& ؟qp{YbBY Pqvym mG-Pck2ǙtO>ABtQO8IZ+:Q4YR͞MLI[ z[S+lĹ9A&nȉ--TBt,F×7̞$  Τ /VriAmץ FԗBkK`nG(Exs-q3_0&d-s wW%)s/݌ȡ/ /LdFL*5sWZBpFinKJN$c=]s~ %97ku3e0z+>Ǝdi;('g`/ ݬzI7ﰁ+tV&g`jꎜ2::ZڬM?H`Ox RLkhtZE>T+zG`by ccc(0"eB;ɄjY#Sͷ ] 6j=*{Pp,}c|]KdNr'1\_Ck?E_RN!8ؙT#,nG®-jl'm~P'h[YV*ޑm|*в@uݣ(6k7˟Nۛ}ˊjSՔ.4Ue7T< 27l:I^2~=!a1A}Ԉ-}whipCfI*5lUt(^#d5Z!PDF.Y59#%,JJPǛXNu&|Xب"RHF\k!lzDS)3:kbm*Cffm"Agq >ak8yɰcB^SvT҆YE fb+y'D  ,Zee-`)O)YwIJp%y;Tusqw,*z&eN uxћ lxM^i@YigʼA[ǁI$&/!wmtɿId2mӊA!]Gv̾KwT0CkWʄ {Jl~-Fnׅ3NVN5f(7-KJ_I`G֞q9k㜠6Ӕ 0p |!cHHvI.FWVtnjx?ŀsy@\/F02]b %B8PExAAAi&wQŹU5ICCGS۝?KƆ,ᛧ_4,w#8_J赓"GV#V+'B}}M7lƯg[_Ny "Π˵J }T-89{NDԙ_GQMu雧܍##Mn67{>ΜM7B/ףw. ~k՟ٳ 6$wd-#8egBK<gTM1~K̅ؔFn`g2d=)1] Px)'$괈.)W@Ke&>< nn(4&ȩ`0 4 ]$[_VMG܃dljVPPr5h0Q(jо1sfJK:S8C*ۯ#xZSg^;cx]Xvs^M8L |Lcռh}QԻZ|;D4C2-E2E v?ߟ@&"La-KBN M D+-qiG9"9bM% ;^'M&]Ր&]y$DKL\|yyN:sԽ9ǎ00qЎΚF;*`g g,"zh $'M]c̋Dd/3;D| p\; ]D}HRz߯/, vKkam v˷SWl`+TIQD˺ѵ>(Ӣ# nFi}ϯ:eyy}ռͥoaEtn7ur,fBUY; ٵ"q˰Q3 ోl5Z:\NP[/ &2O:(Aqv>"n8WS+9<qU~6T\wr18CoR({|"*21|Htaq`#uRyΙ)tLaro|>SOQm:ե.N3ui/-{(B=kQR0&Q84xcIъ/}GY^>L6l`1EewoxMLy_{__rq\%gLӑ"]T>e5nqIOUb4eZ ^ꔿ,-ZO>,P={f'(vlͱyc)ZZ4SZ/l{mQ:®wW7;{ QQ}F3NPk^-n;>%<1h!q_"UK#H|[:g[.%ϳe䌄p-M܌xá+1̧;/0O!~T]zkΒS0 MQ`~qS\/z_WZsQfE/ߚ~_%R'4;H̗NB< ] _->>~r2^xl21(iIEvwa=gLEK,|[$@ C:}]13KyuXA}%Qm~ǮN.buNw)襢!NF(7c&(*8v1F*)9%_#l8?_axvZG%:/E:+ /Ϛumϖ!6 lBᦑhu{~6:Qk-t@i J)Pqů/כ osvR'gve ZqәPeR59b r۱@> 6` 8ֶ*ݹnGШym& nP`Z }'G`Sۮx oBqt|hHm sUZ,a=fI#X<&l.T_xXWzz{>uur0v7&^C uW^aK:ZTɸw5IloVU"_@Ѐ(;cdE|; a ՅmUhr{^,:xCLj{rouyO :ƽ\̣"| :.SYRMe9ogJz- !(ڈſw&HN-_$ᗞ}]rH]Uz8J-lKeշ-M-B}fz=v2Bd|;WCk¼|pdF-Dd.$)Y I"šAqEm⿍r ?/uD `V]} ZHKƍܲpw9 Z6^%?M:U&_u,et5- #9vgs@(Nkvvyzk40Ʈpq\TNGQ-t1{!eoxuʹ4l!1!ݮ ߡ>%A+Q(-@ _?e6z#T@3%l6a&pUW%Oev: < ,,T! ĀmI}G`m ,*nYg%_{6f6 /GcF+Rh97XB8R MFZ'MHkĹԬF  **L{xhAA&hL|?ov&7]p<,uN9/fMxuX}F<$ hRtnLEgé4 yxkF"OAHoì1PW*j #iWe٪(O4ɗ9A:pSN*Jı#;}R"F |a(V/OPe3Q5$vW$2W"zx$=a~?4{' 2Fct@ c%!8ǭw._(;$ǫ^a62ζPL=mC-örtFn7-mE!JJ$xAwMƣP7 gG4oT(i:r|yxͱ(}C#bϵL= fAW98kc2m1휿dR}jk/;`G. E:tj7knҝr>ڡL܃|(vvkyx7ʯ6L~aQH[cn:B^YIBS1^>dhԎoCmxhزUr)c_ȹu2{8_ yeGfi3*61Lat|c.$*)C?Rx~sH3P|˂)d%媷rr|p U{ʹr8'a(_fvV;0ug-[8Y]aNG]#~hL4~49&_S/L0 2泾 1=O%N<|;'^$P+l1H eY>G#&ĒYheR6t}E=ALln[( F+CJ+>ûͮqmQ]VZ~ -:l3pL2HV>`c7r֭q4n_Ц+^ ]ɨ `e o4j=йTvW7\Y~\qdĿ>3mU#DyY+ϳ+pntotX 2B^~mk}etXTra8:b,^T@tݎ .D+x GzPʛW@arU}2C `MDMˣ|NLxY&0#h⴨d\ Qg) _[]gXB'Xs4o{AźD%\I >wiE6AY<}ꦨ ȋ~,콥ii]*k'܋7Ah S`SS4a,i_ ^.%C8JEV^{;0ڦMjzJJXϟ??mn:&3az&ilsE5X2i aGtU{@/x)^PWqz.Oj0W'Q&+A$DxUV`^Zq.چleg1/igb!nZol`J.&nOPiV,Lᚼrac|m5RUP`&FBГ_b "e:#vBM~6ژ %Sz^W{vɰ>qa*(gbxc2ȻQ>UTNYqX qDw;"H#H#H҆T>LKäW><* oI/4Ew3jEbrD8"H$ ~ی?^A qD8"H$T$^5 ?W~8v8zJ:,aeewk#_"@x`[2竄{M>0wSc FN8 F_`瑦^Nl.P][k Bo>߶^R l i`>S!:$!"ed!HR+|_+*gD*>oH+ 9pxJJI1"e'.1Ie0Εo]d ENL1=IQژ[z .y/ 1"8زu;^EHY+fr4B,\6 @ 7^ Hj(k(K#}||;9,Z5TNLb,DrOgc -*FQdo捖w6l+}ǜm#h93ZfӪ걼(Kf?j e 2a623oE${GPp-kc>1dCV$fZ; [<|ن3K@e,60@IBD/Go1Ќ,NwZkFs_V%+QtF)0? zT (^7Z/8පVx :'aw-FEyQvP!ꉃNcv:@#&dGD>'z6 8Z=Թ AmDYaqmNK E"jXh]oSJACgrLt e ˽7a"(91L=`]\cV>J+F{Jno7/bzz.$!8Oyr$#a:Vy.`25 ^x_gp+!郎p&d;u tUPŅmKr=nvHj>MΤES(ú8j:}Β'9qIRJi&Ϻ]mcx n_1kx;rNd+,c]4(cNeE~ nJSbœl>zC8Emz֕]%SVK6y4u,A.Ҽ 80%annu.\pM3ДMV}"/Sj^bn/c bOdyTmPž%2r+weE夬 ]`0_*@DZzQ }~e)s1P\ {޸'u^sN߮O='9x3 ۀTg.u c]lވP&IoٟB|LtLó"3^2?'LG<1~6LYpįg;"Z4;׹.ߥqo$E 0Z /7Ṁjwr!PϷF_I2IL*Sal(=$ܿwAqtߟ<[dp:@pn y~U[[blnmNUꪾ}s~9]a (@ŧNv90~RvY _%%k|׌!aG8f|%D!S FUӫ'o.`GmW:O0uiO3k='lH k/>}{ 8 <ǘ:7]cTJ5#,(N*'f,4 i~˩d<B30(h 7 PB)@GgGףr:1g?ӼFI@n9hj<1JL#㾳thtꠠ7؋3 8*yT k&`_ =n;j=}V C!I^ٹTiB,Y ʃ݁oSG[]n%TCv槜*oˠ!PLjX69e b5M2ҔPS_|jxt^'@[t99!w3TxXcu d]RZp[\:8"42LA&IYեl= X+>MP CʲN 'yB{NP\ud@U`yU|`C҄ CgM(y8v\2F3rDp >LR'U9vYm:-FD ;D^r(+g2ӑ(M{q."W @I. S}\BV98cϹB ^H;Ibhn(;-oj"(X`8R9RHaM)P|L=4&|L@!EhD3%,.X /PW!> *dlĦ!jɞ<uwqf-^ҕZ?Rj}BJ_c wz tCW(I5.aܞo\,],}f:*O, xP;"GÖɯQP#:_f`3zqS(NvM(ct+88؄)lF-q Ez|ىX5'=3%T3x@Y Pfpk+9+sI fRU. L+䈶 |ݽ`#E9H 'w<NOX-i} R`GN."نΎPjFxJAVBkƿ{I#f`V3mb)˦VcĴMFtAR7#+4M[,DƅLd8Ovl`GFrJBZ(wӡXq(p;gYlDvV+-F9BQv w dWͬWM##|B-vmA}=Y͒s,|^MC 88R^mWn rhhDNh`[d^nqBZ' I7{GHҵX~A`HPJNL9@%S<]TxGܫ(TZ߷u!_E~_}͹gꄲv:%,}y7Al[go {_} 'RBL| ZzY*dJM Q|7p9芕W@mg6ysHE5@6bml=Xf>}iP*Kq2:@NtOVbO#"$f+鶄8hU\f w Z_Txa?6)K RQ> A=eѶ]z"fߟ!O^{e:V_ *A$6؄Ш/8@X¢>RjzxiSPiiK~2FA0yLX3:2)T}R}{¥ IE.J,4 yWc#UiD~Q),aQͳ+}[P?*ݥoӨ쵷uC˲+Is {(ZxgDI}2?SOXvA\scJm̈́s'Nϳ;ݶSy8klJca;- D˒ɪ_~.~fZRN9,"W AyMH>}sxֽ&=ګI8_2ͽI/{x AOК :"ab,p{WItqZ /r3Nűv#ŒxXZfFero>i ZP`aukK;D'萠oVKT_ NhiNYh?Fg(,qyf!@6E9ыMU}Z$E|\[Qy'VYw*(9d"Y0n3й@WAT /ET\ 4qjC808Iz"4I%-9n=5a?֛ilވx֡Bӯ㽫R eM6܅_vOSձ[`V T 5׽lD }ZEFf4=35c$oy-\M1^ɯ 2FD2/{[ӻi{3"pa)ZQڣaep#)ti$lmAzGy9P=ׂyZ~-ЯKQQn`u=׮A Ym ^vDU}<6[G*FT˦qbR>MLU.բ|4%qlѳ XZ49zdcwkiC ɹkqr"bKai 8df%Ui(2OvŽTCLXw~~l`90ÑN[plP0-@^8eUQl ~ܳ)_yZoqqU$X_yRTT2&5}̔rz ['WTRjWjnPoT(nTHhAk3r#dh _E&%0Vld-"a dhh98,2snUFmG!j#vJD*;9 QƎ 4ׇ_UYn%\ڴZ3r>M'L(Y9^!-YEˇgO*TopIБ x(sܓ#gpa9Au˓6]r>n@@![?;g;V)}%E"&''<w*.6!:pL^7Ad/1?CFT8;vF>aApuZ`]W@JpE11!eH#pI0y᩺]Jq$[15k6֗U*M@g]20b|ޗ'{l[eDndn0#_jLu9tBum0b!{E#$Ǔ67P֭2oU`C<;w3<O?b佇KT=$"Ӥc%Eg]ك$2.']skʗӞf'Kf60:DNtS?kE1VN' [i.}|EnK}_jjTm^;ǽѶz9UA|^!;9RWԓQkyWⰆ~- .hQ'-Knk&4g-sZsW{^fGÂ4^ʇId dL~!NڴIRܐ|S;`"9<`D-Z &z\0 b€pRJ:(ql%Cj"P}pBT}wEp{!|D[]KDհHZ3JKpC3;_vXPVb1qzkeSMqi`a8ue'JUQty_AX%;oC|`D9^[ARH`GKu[̽(`ʫUЇ *r0s ]Vg#T8yo ޢy1]I.>~6c\vmwnb8rXط~ mSE^=anE3+58sE7(%; 0v(HP 6jͻʮ[JVAS[tjmoBoK{)*j]%:r[)å>LK`B]TхIB}{\s\ۄf9?)}u1suo~haç+=*@3N 94z|qs{BOI﴾_Il{݃uFz8&%Cl?&hr'^|MsT$Ju8Amu*|Z ;uʹz"@,c.4)/O.KgY.͆ALAQ5R+[iJ%E6axq)3h2hx9Xѭ>7xZ->%K K R׉]dH=gwh6EDYў0lVq{ْWv9hnf1AN;bԦʘ[i6q$< ]{}b! !Z~ s]&r8HdO:Π6pNУXtrEJ@4LjzXsCpO} U `+XcQM5(5ш s:CkS?`IWծ`J)4' ܋҂;͟=lSoj:] ӌ8# Fvqg|H 8 yR+6g^2nDmoYȧ4r, ;ahު8E>5 Zpݒ/_1e^j8o|b^6󈑹Aq>_<h)wO[r|DU }c@dƹmEE|.s,whB`łYu);;}@w $Z4 ,e3g/ 'tUsV+I(GŮ?_qcOރHߕ~qVr:Pvwr+>ȶ n΅ 2EGރFG--n~ԋ3b| `K4=F OL'tFaܸ3|Ug@T0\תPIy5srqe{ow{L">^?i)X/a.5ge. :Be9ScJ)^~"]$w7123ps#`'_6Y TiCC3;ڼ" o|DQ9OZpbSW0c6mGJѿä5.DQl'PPLhD㍊8ڷȂI3,S*-?uG}!&`,Eǭ/iz[V.)$ݘٿ{᳼Cq 3q]C-xU_`U+e<)ٿ_|r|__|/>gdy|d` m /t 'czf |wdz7q(qkeO՗dmJq B^u|-3M_P] JG m2-jWК@*3yyrGXxP; ;{۶nN!KȄo%cKK>K>{|nc?QlYn,]9P\gŃSÏ&;83qdee~ 6.24er@uL.}tsU-߮b->OWp$*|_w>y+~׺͵o >dP:7Ð5|9#%b*mY)]eXTŋq<6k[6jk(x#{f\޿z5MIF,e*W&罃d7![dFEӠHG hdVWBy[i|\)s ~++c;2=7a{2 Kh$PjGY w&qMdsA=Ȓ73 ',ÛAō@LżEY@=> 1|0ÙEc$y)l};70 )!K[ݎU7\廿{*7 V6/_W$w!W#-"9W <^d.t+DRp%1Ժnԏ߿5M%M5(՝EKX5(VI 3'5D)ġPp ROR*yId&I+~ecyK֠oB@T~j;ۚqS_\h$;Nd1;x' PaY = hup, W3q_qnoNZYZJ.x޴=Wz p2sGD* I3F210v!Ue N#i\*:ؚYGlMSsudSRW<.ݠdso sQXGOƱPӤܳ Ftԙ *f=4x0#;W"Xo=;Hi $"yNp\WXyZ7$ڹ GlyrZ&ΡQ[⮂w{l;Y:Q`F[8xyP -Ÿw/'Ia $A5=*XAW)`ʊʚ]'L^]""I-~hܨ<#1x0s׊nczs}SݵwG@89}Th%~aru2=1bQ}=h'D4s^%i͹ky 6^ԧm f0pWf/rAb]Rb(%4Zr(тg'߀j2p-ڨFڱQfסOM#Lk֝|rWYv9)'C"ި@l=iΦFB O|ķn, 0"!,P$V:}Y%2vc;9BN{9~MJ5f0֓6Iwͅצf3h' 8VWi.ܮ,8MZ%uEtJ"OΞd•7DÄo'>FB~tv'dg|̒<zgGT4MbQ-?s*-"WO<|V^ȝ*Խ`KFt_mF:Z7׺{PB` =FFdeCCعp5\[aRFyqI6UQB٥a5VaW!1S4cC[9FCj* 9m*дwk(N\p8ɆA>ܺNcjK;l4r}jZwy5R6U$cp_hK<;K2™p>!OHl,[,<ܹHLa&GKb>j `%'hH(IyЏpeXi~C.I/!5_{~3x+޾O²W][83Ad\4Zd14PxY饋5Ρ3 7`x4* 3厓\ilǾCZ ]˸ĥ }KᝣRRd UfT/4{[Y0~mhs(`F񻕋 7t/ 槵I8Cy_6A@ghxF a^E틟C;\ྺ3AE-c8yj¥k*C{X`$&(Hu]q{=15d&~ly%;%֛BlL$v,ENٛZsͻ 72 p:cyQհcU)QPdzT6%^SVv/x)g*+,o묂0$նOpOCU V͍Mw0eTΛ}9C*` }Q<-sx$/2˷5Aa9=\<ʤ o._:V[_3[03P`^ k.К ɵZ24ipyVaύKEH xM+ۗ8wucKE0!5q/#Clap˲L 2Ŋs&E#NZZoLD+q i$bkrzC+%.&FdUSlz?.hh eXSJg»YԱnݳh}f̪nbL~J@Z ՌbF@fI5&>ѹ0@e(nGM rcdsso8&)Ew+*B*`q/$ө U^mJV&W~[+t;#TPi&.FR#$V\0Hc&!q>q<ibIɗ\2ky4n7k9tIC>m(UGL`4KN,{' NZy$_Հu9x*VvJC> úb{sz"a7I0,l: n酅`L9I"%"1֜''}FLGx( OvgmO(ֻx".hcxƉCKZ{%F ~Z5rqQqvtYC]pr,\P8dCW-Yovqg 7|սE|LƖdfxg~u|?S e-_I/%U &K|vwvdBWT'TI`k[Ԛ.KLn+zcy5˻`{*xsr?XlݢyY,/Q&|aDQ&=AڑtaEJm"*_:RWQqѺ.,L@-gE`TGEY2Xx=MgsP)lϾʊ]ѯ& M/lq‚ΟS̭DcgG{ Wcb.EaSZ~$aTVVZl(MOԦo.1>lv_o޾B~'E~d ?0U)QbM预dsS1>}ñٴl_iw my 5xpb=p%CŊ.;آk}ך?'S/<$ygcP35.Ub?wg1ɠVͦ9 #2(eid! i{AD6Nl?=y=~BmaS5m$ J#2;ݿPtI$oy5;^gP}B8oLYy%#z\^MG˔S4CQܘz59\S>pgkn2xF}gfs1!3Lԋ`qLk)ˇ TuokFB%v!Ө3>u`̱J)+;6xaqo"U1sNdWe)Fq$>u]{ 3vsss ?؏lP6a%#r~|geEז#Yxe$(\]>UsdxfL'Swwde`y9Ĭei$MOC J]deSO eee/?Αf?<:TkЗjHOEdαciHHYXM)A.}jWhHqz?~:y{\6 !0Rp5D@Ibw۞67] OFm.O*((Ps?0"ث~P,9[Yގ`Z0) 7n,áٔnj$SN^KZJ!xnPCqazbGgy=;&QI)IpEt ؀qN}F9J}DJޞXhZ>|5G4HOSղ2 /3ɾZ5"EUl\|BˈV-4)sSHاK;_B.k~KW5Sf6b#kQeCfd|nAAA%-L1td`ɫp;)iLRvB[G FJ{l[|O_#OU,4|HN5\xj~Y%4"!|`5{ 3<9Г'N͚c#we}̪y v=/}yk$FRz)ǠC1 ;w%L:*‡58AO] FlFC7I^؏a{" ozBXqT{4|M1lW/M*YdtZߺdX\DHT%F_EZ KD\ү݊QcB6&r8g8-So*CMf(A9ӥ#No̺?o4)@i>fVSLyt !24Hm.kӁ K;MLW-%`R%XSLH( o-7|(5OB/.HT4UQ>͖tDYWTBNՑQ}$uֱIVص"O#rRuHK)Dk4L-wc^4YVt-ŋ.h;mwTTU+ogd~\W{Krʹ)0)@&N~7՜ l;\(Ki VKE-nl{f9z6.jo. ##ΦLS5V3vĘT%邷II[9V;;:xw v85Rʍ_:As)͙s\-)wMGR]Jp72C؞"#&Ny:5ɕXPO]03z-#jyOq QtМ7TJ1:/Ut.䰮ΣL:=Wlj0{W:}oүJU} ߱n\!Pp<6𩲹֥JRy XR'5]qgƒwΫt=Lް$NkzO\Qs3%WL[|Wo^NaJg\4׹!30HJXka nq_fuWF_LsL\ٵ!F_̵pr} (dAnOIq\ƳɈVc6Eo_:!!Ac2(VpܹW0I fѬ7nbcg+קL.Yrm<}͏Ʒ O.I!Hh!DbmkdͪT~x1YOxY7a==}uxTRgǻ'+$[@{oi/;NJ(hؚ 峃T|1%U4<P|概y3q_xNǤ},>`9Tѕ6VAOixUՓ3Pv]64uaH}t8H]fꟼ|9#4zŮF`{]`&N"/PA.}Lz8F9EzTʵDd\3NG$"T+%s6)ډy)&h }ūAnM|.FSN a"Wiܐ碾0xAHzzdA^yt-1SXY}Fk7E.%^r=P dlh--Snt  7_O9cÜ1kd@ODreޖ07&DAFՊe+KK&'7],ůy%,3ݟ׿f]6Ҏơ;(w fld$fb8z *'$۾ TI?ڐ U>jz 8sv|YtUGeK]fV+=C][T{H2 ^v=`7擐#8\.N#\b+CϢ.;.r_fyk% +sWeS#wS wgs%Z+RSBبQtG<]Y- R:#.oe4MӣSkVˉGGnLRg:<6y-g$O^j]dB;JS.u^:I@Y&DB}BUdŘOɗ\{2j8V}x2pwڢvG/rDuE}DOX .Adтzɸr<-չUDʋ_Ө)r F P6mrCRvJsmK 5sxmŬA"T>J(UC sxxZ^C -vΫq2X*ȴjRT\Rl}\i54 m'fwOw"G&g/6[s80-hH|sAho8*Mr~vuS7ʄRXn=hb6#_w+uww62u!ß XSDhBSyqS{ eidC>KhHދٵ \+FOwX3O]$!rR.-bs_zxxpƜwLJHRF-8~TJ |Cf ;}@*N6ˠFϓj \MlC? `;\uٶ?Tdqw4vm9'j缝<{9`cIڗęe٫Aսs2]/̚a Ԩhi &6F\sʄLf 2@Lʭ ?It MV\iմ84)q%/ݡQ1s~g.GҌnk\^G4p\ |L2)C  ;Swy]rĐz!1^֏z\Aҋs%V74_21hz=Ub[ {W-6,3\=6gO|1?] 3Y'u%p(:/ƿqY74tnB쨪?wyQ|!t1=>?vOK=?cVB3D2\3Ͼ>w&Oڞ9R:[gǩ[݅y?| +VNmNEv^',J`xeֺu>'Π~bJ0˿5xNuVy/Be5Y*{YE@mj*nJ _,JYh(%ζ[C巉"mz uW`_J].4{f["Ƚ8 $; ݻꭥq21fGTtͼ~-H0MoIEg gU#yfDdi" T.w`,'K]Ї SO](^jAR諭ԥV0[R~xV~trlp9;N{qnf-sckb Ԟ`*-u-VQJ+c15@.|i"ؕ%czSɮ55C,=q$^S !6LCld=&3n|<"i+zIgr]-C~clh3br# wS}˝}|܂Nܫry|f!xlG*)wE1PO^-;L"75cLt&2d^eprK޹W{zT-N5 은눻RR|xGO;GX(~MۤbTٲτ=rW=#7m(6S0BX%vadU- O 0#WcYl5Y҇fmde.a䋂got\ܧbmW*&DC}ЎϰI\j}.nzmL2Z-ٮGÞA+Qw|WssWx5ݓO,,*@ػi# $t&757y9S??Z]ʽj+!4gDZW5{rGkQi_Dν0DOAq K_W<&U<&fW{qC>!CH~#GBI=VE)%56>/כ 0,ݟb +f憸H:5Ԩ-:HQ &m ?PE*[]_*#X{\;74x6V7 U[\_}s_ XQ@lSĀ %C$VQNP+w" NRO׷? <9cgl!#Byޟ `<DyH.r9t=>bߙv§NnnnnII$T1yuQB HI!61bU8]ii5w4UEQ+}[*z%rrrN6lpEX7dYL E8I sQq BMbDI>{&^Arď򗌇7rܞYʺHՇb86{zza>\,3deD3~p-|TA LSB'!JXZѽG Y%A!!!+2`YxCE+:{N(iwXSCCC Dgr"=#6oa$nk(1.kp ~:y8CvdE9o6̅,xfga6]3[  5%Zױ+9Q)"3OE(4_oО~|L@S`nii;d4¦ $޻yl`gmnO bGxw$7|^"sVv'&JlG,2mFmtz_-v22%瑋Gw[ΞE`$ni=RFְ@%\À;W7Ⱥ{B3wɠ896^hFGdw;bhaS76mh0t̛$];3k|s\|b q. zL'&~-n$.ݽ5HNmzKslF] BӤos3kpTDmai_αш(yjiÃx۷oVVWoTyE9g b$_ a̪O&:8$ P|MFW ?$(i0.pU$UeܸU3p {Q[OO*@F Kxzx(v|b'DŽw>MH4U]śMF:5[$I$&Kf)w08rmFڞєSݳn6PUzBhKZnG71l;y0wܓcL n(Hv+mrԅuGEmnK*ڣ#YS{>qXT2cMTiRFX(q"`c0jCI =|nZu){5;lux$d>PЗ]>gAn۴^T׳,vp"A+G3 k1?Xަ:63hy_r=Fru)ssaq>;m?x'&Voeyͥ]NbW3yE?\RV[(:Az]TdW l"5pEyưc{U[=y]?JGkE| W!7X76^k/p=Es[⤭"Ï$N+Qcxx)hTUI0Y߅4?Q8)&;/qf)ng-gf:Vf(ל*W ^7κ,UB:J<=~Rr5N5YWנ"v5F b;Jd@emNk HSD=&hQcC3VaYV {K+,;'riHey:-MTg{NiUCe,yu' -'5@R̮v@YiW0yEFN?򽉝 Q<(р-?:F IyQX*t 8H*>pl~+fA 4CQxiW؞vcnK{J5N%pgHvϐAvDduu{^q {76/ue8͆īp_ !^"4xh'ܴ<ÿ{RM9v'8&ݞyu=a X_Bl!?oBz-1 Y+0jy4T/d;˽Ui>a]L9e_-)PrKgXnE,ṿ}zwwA,‡ْmUN_ce ԤN(L#7244/I߫zAv{DHt^] ?O;7t% f{kFKwu=#c+EII:$vt( UHTnruph´t-N+/COF0UrpGLGU3zi>mSP?Ti'uV0HtXiIUvK `@!&s@H3|ִ\͵v}\ ŭ o;_l$xX!wcPo)9Ϧ2-OLW`@ sm>3ʦ!LWb'5999k[be2m&` 7,׾d9~M5 =#,9~YRȢD( bgg_ުߙT&|v/Й'j?G>NXsΆ2F}Fa նni hjM\#7HTb6~&XvQ͚rY]ݹ_+NOِ> p  Qo{R:<34 4{NӱK7x[Թ8 '^z 0ht W Mupp\O6;mJ*駥dTrQ({DzG?YՍBOR0zL}*%SʥZL`ýoyO+e>z*%؏fK;(Z> ߵs]I7 49 *uZ1~;/դ߂ɐ\+y &qɘwgO~D]-h(-JCz5xa/f g2_3UŮ3Z-n SsLCe s3,N?g/((s#oxy1HLp/0Pb?R^[2)K0. .f\ڣRXmѢL5ݝ7+6Mn8$h qkv[@BLͮa\=ne\i {ˠ>3 NBqKRܭww/S\[xq(@q >}?>'Llʹ)&u*JKKt lr}K^& zYBJ NZcB.HzV'Jl%#ӫ=ל;_aa4֦Ws6ΗD£(L8aA = >xgc//w w1ˠX$$ Z8EsO rg))ll]VE:Lģtlk4(.'[?NqE;1oj"lq9Sp=hQu/w %u?r>f`cpoor cE,Y, {pe>{OWk8;g7u,u}_]n]~a\T8j,wȒGʹH==' :QZT&i~V}^[2yw[ăD)!;;{o<v JWذQga#biz U}$4nt *#@Ե7RPSV;1x]Ԃ|"RX+f,' SECӃsQJmEr}",-S-.bĊRp`($U@4oArknD2`a %B>*z0 F!7Ь9X8r@jA:Rd~gȿ6V2v 9o\:DǛOuFnK\Ѧi9o/]c$(G%wA03)tzDY=a^7^9%slګ;ޡ{U3qȬԾ9cԘm_s, gUI^pQfMT }tA/)w0>!WVĨ@,&M D Q %h"r+Lua2j+,?)3 9E[V@Gd[by\mVI⡧D7Bp֙:[.XjzKژs[|,} 3xpOfLn: #Yn 0*&[ џW 5e&/x'ӑ [j(mLm2vs)ķ32 hjC!Hki̻TWzսa LNi&C xBÃUC$`11@ څַvMI#s6W!˺VU @OgΩ܎Otv;Ǖ YSL0fϖdz@l_e aT v wbL0Km 1lͼbm3@Ss `֌Y 1R'O7 p8o/d#/ݨ:V+=nOފjwkԛiXl+UW&X:d}sh6jVI21ΛR!/ԭ{jpgpi3jRKh?Xk.WrND$ݪ_ ˝xaXФ\e>8u߿O@\dqGu1^B Thu5"=eB2g詞c+J-D{^^hC/mJ`"bW/bjx&7۬n>9vA<9uJVe{xw?6aTdh9 -Cu3V]FA7 O 0 F#۱l?uݹ]p%cELSLdL\Fzk 8F7O|@iesv#snmUܖ*˿T;dZB<&@(mЗJPylMۄz _Ύ}P=A I8|w/H{uqTi6R¥o.8qxssCt%j Pۇj0<c GX Jв)+ `4O#GyOwh mU^p7hr#+4*AEv>(Viַ_ޛK=<5X kgvo9Wխc@1e4 .B 02.UJ7h #<_i90C}h vITOgb%ڏ3<~LLL9 n)ԑ BĜU!;DN}"[D/HHsoYO0줛}EH't-*K!r@QU |)BKNl+caWY{*scv)Y̜]۲CG23d' /mSjH3E)bEDoTU+1d&WhSh/hc6L<y],m)9_A`fЁ[ܨ Ng1"uzZy rswxVZ*>`A*N;gx,l^l C}HU ̬PL0ۓ"`r`F|@ ,cVS9q;?|B*aTP2B`#ʤ|hW&NT& ֗fu7@yʪԔO/v=:h|:k 氾ڐ_Lb-NV.v0wgÖ,Aǩ܃{zAHd.T؃Fq_-Vn7N=EMяjfů}x<*d]:ti]/@ʚY5Y&@?bbU:!#73<*ri~)[e Esv[ą×.5Rᥟo=4ίW_ffY>tɶأaFQC- U0Uc7SX(єg2|<krD=7ޚ[sKf%sUd HBgW~{@&;]iQ[/, hnƹE8w 4Y?a3ЧkIPo=]k`t۩}v *?^BrpU {/ˍ9= >dIy5UCJ^dbjJ%=یLN-aM2u4%)cofq@VBFʡ8†P*oH+VB*S&2G{kx<[2-F˓ݵK~uz?=W:sJiKmֲ4I_B&fAk B4G+m=:+oy`RJX6ߍ0N 9'C9TVH9 xR5{'f6 ver먖|,%%Bͯhw82sֆq G;k#9(xcQ]~&ѺzwbQmTkhپ'ݞ?N.y:¸a8r,j\bƶi{? 6pѶMݰr>O?vl(;ϨJK%JSr@h)|T.ogKk(Ԡ:םjZ\+ZF'ڻp_TIuie#Q8GF`=R;IrY0;k㬇yburHy;fp ].$cui^B?MkZƿXF]{bk% ̱ љowaZmr@ԣ}0K}R>3sAQGwi2`T\ggb` 2Ɗ`VH\ُD^"-xx>:T:Ա"[cE ꨨX25Q.oZWzۼ) tR%~$V sv!*{g-8Oߨy$[dƟU:@νRƎ)|_EffJ*19vAtx-8o6w]J{"&_GGFw%cCͻa,i)BX?t@$ XVQ3N D5X_>cDeAɪ&䁙֦!j/N0߀K4ytZ:cr84K _lI2Ȏq wj ,e-L=sMTXb =xںapa"'/"v&~X}GWrn EN|+ύ/-54}1²:gf婭úvefmv`oubmVp$:6cK}"[1x}~= 1aKa)1@6`6\?ԫoSV\ZF8&8„MB'bJHRsGJt7:?Zm$=i?J_.,ICHd.劏ej@9M9"(<8,< !gw/A:_s4ZD:m>X^?BhC"}'pss4S^4D-$ަ/j/C*Zՙ1l~1D8o0SE䞈vs#{jh o.)T)5gr=JKG y?_RywSڧdnl} *vY'e%&ҍ+ [-F+.há="\2)?\[9 ~h+>T@1z'wJQ@ ~VH*M݈ODQnFwoڷ'aǐ+QIj@GquB}'ָ _*׺A/m0@D։Cwj[B/X~$d۸4RQj]LV}[ @ H;[G# 0ZfZQ7ş^?/LlдvN;jMrnYj/sD>-ՋG-NdS+ e('9/c$;oY'<͆ LD6U䁶Ѩo dbY 5<ڍ/Œn\zT4fe52w럕Pp{TSǫ6Q5wJӶ:.{q2#MhF63 u/qd}򄓳@.X'0Z|-)W:OJdz47}`cl; q% k.FS=6tbv$:QZG=s$I,u r~l`Ee2~ڈQY'7>ށ0 6 @)1xH6Mt+ ;N)wءiU=z7WY𠞣v cɈM\%9R",c7n#z/VFKIƪY\ `554= {Er./'tqkbdYIPz^qMhSgv$+o vz֠fӶCxQU#d; (ׇxF^`\*h3?I[%eH웄ȃxtAyl s];Isxa2Z޹UshE1ҁGH%gCB J4ڲC̾}-k2係}$Ҁӭdw\?V0OMq$29>zDh ť'ȳ\\G%.7Um&(̨?l Ur_%! 2b)Sc'd*딩ao6\I6zL'V:̌0)+9ߠ"lD WW^6kcmh⫦|{:T \+(]}:_.ϳl 7LrHVfmgTy[B‘){0p68wݐfAo@i̋ܫ|ޚW@Ewy1xCH  O!7nS{76id5h_]e'䶙p:Qb~8pPoW ?k!@3L\hW{tݯE%~M:iRɶ1?W ֲ#lN9G|$^<יj&wj3xT#+}b Bntnhp}:60 \ՓY_veN*^Nyl{r=9Fb+ܪ.q(8rgk@,@|<=_H-!kvZƧ ʦ\76'0NBMv^=FoTxg# 8F㼧qk]2G8ݓTqP1cwn`{];!~leB6Ɩ48o7b-;e/s02,dGUzMӎKv?S?A!SuG[qvfs K7.bcOxFTX0vUʊC(2Qw5G>9Mckohkܽ[_5I>`loz[%aH$4ۤ6 .F ?]a6cX5P$ɀ-g˪E#xB\ΞZG8gb¿Sa@HF:x}jC)Ȼ[p܆8J(q -W\y6*UǬԹ[D^YsV+wX@wUhp$zb ĕ`SOSI8ӏw[-< lŕ2q'(Fw5bB_ B{J&A1pld0>/Ocim&W#M{dHAKU$~4{UVPE3lɤƝӷؙ S8WW~&-7IU$.) 4buAi̳w&BALD>׉EW9ftY,nıCHHx'@ҷ(-1 * [&i(5/4Cŷ+WpߧLJM& Ќ'6g3x3nk>ᡋ{0rolLszc'q`RC9Y;E@JaKoD`0-&:1bؚb@بH k2򰿄nv\S7̧Et?&~9i :(pΩpհ BFOa3|%q4(lr0~ac& 3<' J* .''w(+DDž]y4'?3ʦfDŽ=K<vtm_VVUK"Gs Z#楃.` 'i]Z>V,U\kY=[WyLPA(yx i4Ů\g~NsvL=dYOX5X/;_fp4Ufi溣3οs#*nKճ7((h㡬:i]:02XX`*(" ep5&=τ0rOr[]5$.U%Ԙ^.5+|;ԁ)LNd3>G$iG s~P>+G 7-mfN*ニsn{bXA[Uòȗ7Cqw.̀4u#<. iW{̝{pFbKUj{b`OG(2|u PJKAԙ-& 6reEIWxX ;x:a@C""_\m#>j͛Pч7|-Dkfi]8xg!eg0@Y9oP>!m sϳ$- wyp>t=$NKK2x3e}XȘ)V+nFh([VmY1]8Yӄ)eIʒ&CAlFi8?oₚp'TMG.^_e^<]n' ]h@֟hO#Yf2D !w#McA(ri9"XO)..@=( is5=jɴT0/ o\C+^Xg?/}(jjU-l> xg/sv{gtK^<3QӖËϥo)O$h -c5R֦zm^G Vro$m kxMO &snnOGK 󫞃"Ȑbr.8"|<ٛdIw*eܚ̂@=ɾe?H l:Wj`^] qġ/wX1Jm]w~05|{>Y?ʣN*8O;LJlB#>rp]=nnk@9lbR>DZz8r %Wz:cxJEAƳεLS/:Wy7*$FgWRYoL4 o2q NS1l%b.e#!l֓4ʷډg ?ur "-c9 e_J"OQqxiz<} |c  `#jq96b#F!AIMI,ֱj5m<-$V\7 Br5/|M`\lӑðMׇd)myR؊Y0-iJAlM^Ŭ+`^r0N'\#%`r&Y..uGbeR3_1qʻN;%2SCaxi$k[jn{tz!98C*>RxT:"$"{GIU3#f;SP( 3UwZPGR'臨IC6ŧ 71t4rb9ޤ bDyBR03ȯR8oh_,rW $6 h2ҭI!g0s"7GTA4Fa3e QCLo_zz}fYa8}ц L oGHhU#L:.>+hR7Qjhzd(H9اjݦpsjgj]V[wEPecrkKmHUcYԳ?B+7؅_'w [([%|vJJ&]b :=eEΙ0̙=޹WNSߗfgC^wA-{T5j%[8?Gw/8X&)69"5Ʊt ZcM!vՄp@ASMҪ;}||D }batX 5OK}1 /pcOs}yGwi !¸a SXu:e1Ǚɜ**Nq\PW=3`w./;҅u_]?.w\ͳs7Z"ۓ#LȜp[*irdљZ(ImJ,JS d3.'mof9xUfj2Q3NZϖ RƆ@m H'&_8*3U8ƕ 䙞&)FTGM:='CECN] }i`o%MǡU+."-\YRr^pupJ/gz7F.NOÜ*9F۫$Q&-A T Ӣ\sj 54%D.3Dq)W;h-?u,8sT/mFXFDUwT'Ӳ_ 򽟕pשޞm J&q,! %g4^aʫOaNU8BҊWapQZVxȮozaEOcg.w [hmֲL SC㩡@N iZq>UUkδMG-W +۹N͓7tZL?sx({g~+PJp;2bE77wqX[̣ ַݒ,U_ bkV7w~gdƳR*J Tl\N`5Ȕ$(LɅ(C%csxH?2Sg|3Kg3%>Aa@O9b3ub`ʬGn< ˜ECa^ל&%mcqm4)Yfa̓ Jfc;Oˠj쉇]M) ]ok9hɸIp${3Vb4ϩ:[yءs0 EƇ K}bKJk!hũXrF[ms2a>Z!a2<^S}IZb4E.GdH$^ L.la蓿QPH8ˇ,*%Y% ?2N2{*Ōk xfr%4*XVkm=D2'wRTD.]v۝f?wtI0CGEVCa/ge]F;T^~-l\F͉4:G=qϣ~Bu6* fG'MD>^xgL1M:| kAz8Yڌ&.j=y#ox,rT_4,,BEؼYh -IG9%1~͆]XGnBX4ſh!2WwʄpM](7&M N 8ʟ\> &<~qr+Gtf~ b%GLHxǦ`F,7dS6K1!.pًg:}<_`PQ+}}~yIQ.?BGurzy.˳ɶlapcѫ:XT$emȥU٠%~q׸'̷EQsؒO34aK܃/b:F-RPQkE5;&Nr2 ?OETb$Tn ]`Dx[TU oB@^NS訒 >=0GHeVmTߺgY#qw!IyOBݦ*iG,ұ25/>v6PRP|^>n=͸[&NLi&}W4jމR'R_ ~}z*%t( ƯNe:d}H[צ$jPȟB/^I*I%(ڤu)Hny/⹼j~aT֗m7Ψ{af#ZR8/GY>+n3j`?yޜBE+i1f7[ԲtD8c;q 6A"1CAkG9&++Xf{g#(=y"O!#w?UȺ@j vkX ӃSFV"_l<^cWDVn'I*[Q} ǘb_wzjGsbpKccpc)U41ÝY/5$Q.kh{NB\(#/ާ#§9 _}]NzϷa']h2}"2꣆]˒ ] H~*ոR,l_؟Sf7#Ve9|Wȇ=N:/˜xH^x'|EU.Vhy adaMcga딴H/a2qR1 ,NWnBԢ ׮]b E%rv²K] /2P>AT]"[kx_{ˠ8w$a%ww \d x  \ vsν隽gךig$¹Gۢ]-h#:XCd L0"|BMI'/I+l!5B!FcgbOX5*[bA'Hc"X4PW!"Q0x'D 顈>ڒ[^a!Fj~, J]ȯ($QRR 99e 9gԪJYύD7ev-dDUEhY"`f$<){q)=H'_aΙ7ŊݮI]ڡ"Bb2h0 X*xJɼ^{ryD aL{I_Gi;)08yeH3Dkx ;t=b~6nqIW$LCl0i.],c&}1zVi:xrPB.[\6BOGSmv~ãf*DL)m-Q]ei\QSUs&[^=TW,5$07U\E 6ulOfPi:AegZx*>X5'YC|zᇎícG`ԩ$d~zΔU\AFdkwɕ?B, Jp~C\HZ=M˰(9z;.- f x7|,飶Awڅl.c3ICQt 48JFRjL9+;i_S\8>ap곷 兓"t{(I3+Txc YAcM1:_8Foú f&RΌԬ^|ĂVoPv/q78طJFbLH+F *kP6,E/\|wʄ!l,C>}h,fSDOsS3z2ᬞ^<M;&"JWJ V1PǮo7 qA.V_ecEkE)W{Rgp:Jk1E{^M.) wSRD]*7f9їn䂉gE60WC>Ј@Dr9@*׽_\> d 8_M{*xxnq$P0ݸ Rj;9踣~džX5@E,8-'3^ظ-"pd67%Ƈ'oG&QD>aU ?5GHhy$`4;f(`j&d&¯QѦ`A5<' qOO8R;JI`f,*0`鮷mTNpbfXZ Ǘ0m+ z{D((J4}oE;TG|#(g:OXHsasC\Rǖ=^; Dˠs7:x~9}5\MNhHwVڐ>7QߴbSN [l&_\ʸ]K&G! SBq[R0؜ܝF>ۋ< МpIBKz@9AH[o+fL,ľX.Q4^nh!XnߑYi)hֆsٴp &+{C 4^s_L%B?!eY5AGpbg'πYg ?%nae>oFd<{GVb QqUJh '&ᙢ[U βf Xقt<#H q F XaB,ݱ]+X/=ΚUמ2MZ9v8?u|c-R@($EP'11hZ X/` a2aJoȊHnQyo}NCyu߷u/9W:ZKo \可;yIJ ^0ǮDix y͹"8Yʦ5snm!%AGS}-(xRmxXc̤K,9H] bKMBo"M+M9h[w2/ ;xYقҠgK=.fcSq;znM?̛<#7w*jGd_lUmA!`Bb"B&bpzuć}Wp#)Xwggns{G^ Hg/rG߿ƮGA ڶ 8um2fOQ~%+-I7EX!0_~j`R0IhHf;: Q1b́([cO: _5J<.|G@ rXxj$-9wsi u]$>m8ɫCͱJNGtogjO"VU %O:BLo:˶r"tO!xɭH絞O$ys<>:i:kn)T~LԬeA/T9y${ILqݓ#18 vigiT3b9U#JBMֹLM/J%w'1k3:s/ޜOyg/8ֳב-u}& ">?EBkElXRjtlc۹,xtѧḰ3?L~k\_XwSX'AdG>{dfc4[Hŷ:ladҮ;e$fe2nbdvm}^ RoC/g㢹 WLRfm".>HxXw2QKX%F ,uʖP!{C jA* pR6"5M>|ا[?d yq"@ L@Gn.P.ɩH)oc@EG/V(.Vv9ILrB2NR&Oڔo4|!6$yn!J$!?Ÿo6>EbX !dM0,pD)~yu-puf@j4H%Zۋ8e̐Ɨ@*ڤ]'~"wp:2<"!A0EDw 1PTG@}F|Q!^9 Flê!~"l+̛*pZ<Q)\4LaI xRm{s7 G̎4d2֧dXI4?*@%Q1cb Lx7g/Ue*7kom%5*)Φ,%5w\j=Ai@c#B0vLşIҌ[d$r(BBzrWmGy.w^N/R3'80i MiLn "uJtP$x*9ku֎Wdn&&sMK(I$Jxvq|\vO'o3Iym]J $HU܁oVjʃmۓ`f(X4H歞 /xǷn˳ qG]' 8m1`MX9TtQ;Oݚ }OA3R (t ؞!^wm-79`} op|Z+lPpNzRQeQ(=w['s p2hy{t5wP.Иa!M{6ۋ:)Kw`XYܧxE@KËr]ϞWGT Bغ5:>Њ:+)&w8fFlIczy 4Hu?Pwr֑=I)oMHF״V< C*WAfW3^G=UPQ٩1Lz 5iSx SR e4>Չ4l<0d Dϡ7~%%N{Re 嵶f7+I78hE:tzFƎ[B3{GROVDǀNm#fwA"a^"6g V~8!a14PWpG.Ω)^lAb@9ͥzBDUrq;&payP F{j[񧤶>B9`>zyrǥW퓉`IV{VB(H27gLqaİӿ'1cpľlPu4g3=G+5rXp PGM @lcq=yKAwg_@MTw^efU4϶jGi@.٨*3b / a wy.UCH VOkP\޺7B H_~zs窝$MMHrz])OǼa8RO(_s9HI>gY)MF6KH+͗G-A }ص:hVŕ⭯v3y,aY<ZmO9)El`HEHIw;zD\djM\qbZM.*3+>f-;rHpNE !Nz̐wX|e xkP"$ }4Bqdk&Yv$AaR!a8|4&몦59=Duչ$uv>@jJ͊G^wUI8l/ &_W/zy}9Tc̢s׬#C?&=4EЛ7kjؚG"@Q1=  p hNmO#, H]@Иo8]Z $HD8j!ɍEGttF=m7bl s44NtHD"tc^=(!XRgl—TJk ,ģPQ*Il2:SVFt'`+eO?l0~-l1*b[BzXQ.atIDqiQ8:B烙N[|Ӽ$^jGH _3k +xژJg7kf)g\6ߔ&C|*Qy[/"9X ;O[t>}(5y"GZL74U'ܑkds"OA!AvP!N%9U,izՌQ}B$6r ?# mGkV#y!|GO_^vG” -vYbVrLvQ eO6MlLӸA-퉱n}2($n+,n-Mc<"]4Hv |3~h!0T& 2K$&M똄rǴX VҋFiǞׁ 69y$f .Fm=^Pp~|Azd&mrK}q9B ‹UϨf3 bO#36Z5t#''1ːsl(q0W/DQYۏIB6sir5v~YSWA2ޘXXbr^!j/5zM,}/d5ǿݥIZb:ujB6 fz DY?@ aC.W-:׷c{ɲQ=Q:;묤Iu!b2kޤH&ǖ<0N%_ x3Hغzt}r׽D I8ޯn UX~b;0"+k U"B6PV|]5ewKKpoV:lFRA5ɟn?{,SkrAJjyV* WwN..֓ZuM#Ly`^8!_V^t>~Wgn2­kѠ]d%0lbGPi>\^l=<64R*ipQ8"wY?T+q;jnȶX!ϿռOI}B_^l{x|kd z!nm#0m,Vd+J,oMIsS>z6oQ߮o{/t1:ZhFufn1hMO}R3zXS;w?vi'OT*zi=*Dn4xjx6,5dO^~;C$s(; _ai>ho?^lX˧wP7n;hUWح* CE7ݐBDh(S9RwQ('^Lh*#|a V cstDC,iKE|?a =RDwY`=&K[v?l2źq`B0vct9qîмF͕g2 x(G `#/ؿ[54Oy@ !Lk wq2rM͖_s_QFuo/WXćo;v$N%æ}rɹ? Ake$j^c09Rs?*.0H뚆ʨmEDi?P4hD\qsl9dCtyd1;WOK΁7pNjg?v9|χA YqbB|e(G^zvar6>{SJ]vRݒ`,T\YVJa~Sqz8tx="= ^.0+'f}%o'm2}?98J7O@uyl&k52wG9L怦_ن @g?KO'@1~Wx#Ge9f #6>(?0r43*z|n(p,Թ>#3[DQۄzYZ\xۑv=6x=,Wfϙ弡#f1?OY{]|< qVd׉dL/TTYL Hb\x5DMKQ*TJ/N ۜA:|}FwN挊Pp|y<; d}6ꦕˍ1Xqe39b=?"?0aQ޵6U4)As ύ&nBMM? >񋳶:XT?3ymi( K^+K$y7}XVtL]z3&*fĐ1Y?je4ٔGflFp$\[ǻ_!)*_2wo8 ;1t.?t\0\5;} >sFO;mֵ.SHh~y'&zoBwǯ̀^qhÜ_͑ԉG AxС!3Ӝz"0ցj#ޕbPF:ߨۿĪ"~%`(D3-SXN[]bsJ0?I~<_|{U+}AcLYG=(!qUI(nK7{V$M<7SN8$i@D!我|(1EO H/tiix5xfp.SXdBAjGT `3MwII1} _Ge*:{M%% r1ë^,\n"7mڀfogmI(`XS5ė삗6J(w""2k+,WXʿ¢ crNXwm\M⟕us_LD(59%e, $mlgljR܄7G:z$y<篭cETC 6*#((=Ra4Vf(ɂD"a7F)MsD-UV!D'+J6QC/MOR9P-,q埲 A>Bx1ۤeQ0pGd”T^p'F|w4 Q,I\+ W}ac6WGuV%+[7ױ)M2T-t-o|]\Yi' PsįJciz?yU˟ݝ\ /nn|^٢C{p5]ZCð_K#; !Xp݉,^Q;oYbGpټy~HTzB|x)q A]/">9ŬyMVP^1'kb0C.N[Իo5xed##=|cي$y51vn=Kx0Wh[^^*k7RD㞓Ʃ'f4+R``kfrXds.tVY}CdVMgQRXϵ hDBCm#ث+lD}YpOu|C:-(4ܺ;G#ܡwc|rC۬}#RwN:T!p7n!X<*>/{J9Y+E6TLehx]+^99iKLEf'Mm1`x eG3Lœ旻xz4ewsZD p P *S[ 6.%aIyHi=#A_`vt.dq!a,jP9I>xz$}Doq iK!sn^Ϩ4VAOZ 'Wb*cކ1~|Us$ &j/${՟H11U%7E­*h']G2?(B!86ұ! 1"%Y~u 7oh٫ 6:?>'}#RT֚qYt΍,+P40|JUf~xs E2aXNWa[yFG]RjAy{*V"~$*OuU YJ4:eee8_NhvL _y1TQ@g&nV7+9NxP: 7 *@x˯&WF?A>a4bGWFL1u{벴o+X<ڽ9al)|F2VxޯwHl{G*P ^<1Nh8ٌ\htm.DdC=^!w*lGcqӂ_f^BI>t GAQLխ$JRAp"0^!q'Y21V[eGfa66 EebÛ۔2mji$huZص.IqRG.ǗV< 0AqD]$ %k %Xp'@|g V?\pp!*SbB#hrӡ;V 憯QKNJA*0\Vfszq Ze_YE q%+0P*lU-<<6Ks'm@a}>uYHqC? ܸĄ[0QuV-w}"%#ߓ?ceYn>v+Nͳ|F]/L1*}4VȚbQOz GKiKlO&Nr^\@xh@xB'KK Rڷ^S iNuy}m;Z6! NoϢ-q{pHVTBҊ0d"ZX<Ѕ+1~*Z@CP#|XKVR;`x]ʂY&3cGGIn4ymJ;W.vexK|©=X2.Fb%@R T؇QB..N|"2ZgB: IIX긹&50򍜫Ě VT߇Sc\iLR Rhu34""c`"U%^:яL+zؒږc@XX?ҸDhp eԊ27VB@"c4V7}e,(/FO|4DpR}-bA-TE Jalo bh3*dqZ'+r#B8Nȭi'UEj3yTR_%`m!lp2w{aE>&rC`(J JfKÈCA$J"3Vsmy.7mt_ɔڃKļ2@i`o5WYjaD=9,(6"KYw7gVg,5*.HEgV}lÿh [\`2ra4t8_R~.q]x Hk-T^xs:HaX艢$XF`2? gay! R[gFl'Ox3AbeĆx]KGL|qZD ҏ(F*Rh[3'8mw ıL bv_*IB fL3 Y.PȑYD{^`r_hϦ^AS^ߞ֯^m\M@ ~mWX߼ѾSu:! c ]fSw\Z?h\PнA!TN1e.@1e@FJ:E<943#M[@OhO!a/)mzu;֣pmut2W"񝄹(B 65PMqӪ84jbBu3wȅEͣ !xa}#~b>΋Q|\2D=S%IX \F* %Sx0M :d[Yy\]pM|}hU*]l`(ɍ(\3ù\HFEO^ق1CFX"0>|?:# eo-2/aNTH>"5#ahlJUUL,qڜ`2E7+N[/8v*KqVVuGZ~x$w'r+kdO|S;`bpij2\Jl,=/v1V\w$Ap$diAaАhwn?beЬ,lMxx9MYs!/'d9!BSp+U=*k3\LFlؚ ;C٩W<_@W+3b\ZRk7 n8?IrXmy͟Y>V.h>w_?Nԑ {׈GyfV.v( 1FMp4p""¢ےNuޯjT,"; >a}\g}9,>5ӰPǧ7Jfw K .4i_ -$##}WO=2㝹 t*X@ٔLМclW!57~'lň+TƇ%9rSM[#R7gN@Zr7<\  opܼpZ;/);2:d m{5DTdDEb&k,f!.1$~Nޓ$n'vuu#isM( -HrI?2qsO"KcˋI*:F wpĴ92ŵA3].7PrI;P:JHJJ|IcI/3K$˞;u17d_Aw\'QT*Ec0 [en5s<>UI/sUrP9[biH"O]R ss'H)`EznjܹC@eTdGgAe9wNMz0j?Q\[q_cfb"zRFcQcBYfMصS2R_oxeY3DYNΟ1<4k'0#`*n/v*内iT ~\?] FA?Djh kQ}w9YqʮKa vc>vd!gJ\hVE ] (MȂZmx))ݖB~˗fZD1H}>g6AM0J2  ы5p^M3'u^XUZ_,`nDNc12HL~<ݑ}1R$I]p$OD=FhP!Pvx68>Ylh%M }3:O[8&#5rcKEn"DhэwNIrjdcONY?ؒ*UQα dyCF,َ/İ2-x҆ C*;A)$7? R*#gϣޟ@/CCvѐfGU?B+Ca+H֑wDiX|;`Szd<=(ӈՏVHUu`u2?GbFPYL÷*MSXf}< U˝ %-Q nre?L5ֵ6k2o1f~|g%?\(}pMZ#:BqU 7UǙ_l0bPVf ў X^x[g"TtM#mV3Ni#Һԉ}p":l_b 1'pح *ilQewF!.ܗ+AgʏxG&ȺTʐ1N"M+׳3xM͵S{>ro<꒔?N`P@B#I }ݒRd*Ev"'B +H+܃ PҗfMF|j^egXqmJd BUʼ v;Qֵw^&.U%+ z}~}ng%k3,#k &5 I1h=X=kմa.MY *K)Q=;ᇮ5cC' 6MMvL)K Qʘ; PX 4Gy^>_ }Y<ټ<^]uUo<#cmmgnT0֞rv sy]eq}T0Q$1׹=]{k7E^KPfѝ}ĨQfkc5b䕖&'ԢSmT-wf[z !4G&DIs~(LBkt`#;sf:Ug+EtǥTQFH7w`9E-Osm_JA5eJIP:+RY-( N.sG;ZIJiV2].CifVk3F(  t?8 1$-t[g}aAƶ٭m9q)ڐ=`ki ]//ՇUI^{k)ݭ󗇛08w^hʵ~APܸ>S#B+݊ #+z˝,1:\) 2מD+ }ikӾ "9PmSߠevIF\R5 dAJ+b}}>HajRΔRLN(j@; [Y LŜGKַe˜vM I EV/UlS^`ai~o-@$}rEvr0Jx־|t󅜲皛bi<!t:[M!.6}P3^*-}uM~ ϻ>_a8dx_WD@ >?Wa;N;55n̯qE`ĩN8]f{ŭ@ct+ĸ?4L&6pk$9$2fzV1FEE_v^^nN{*+]>P+-M{ň%rZ#1<, /3p$4ŌDKw`ݣU B{О@z<=bM*VcRF q~|,o!^]'򮣔gW?2i=zW5>^X glpM@ z;;M"_Me 2}tl$Ǎx>?!'lc1w?\/EٶLjC>m[NzMU?̣ڈpw; >(ԣDgf~SI)~3Ĺ_*_ C_3 Ga ((L=0룱7aւm&f>G\4/\Of<]mqN<K>Ѩ3a=wGʿ6+t(3+bPxwkfgeK%)qrSFu4/Y2[rj̗!Q~<kvVB^Uy ͉pi'N9m%p^Xk%3 XQ93L+^vq̗͊Ƙ5k+L+?ؖ?Ȩu-`,@'.F3|DSBƕZm{RAYY"碆@-۹JcaxLòCt{c;foKp%I}EWtJ},T#x[cU RqmG̝ HQk=3k`Nbb!Ϸ^  ̞Se'O._Ti#:+MY\h>"0JgQՙ5vόjf seϭiPIa_8>iHOf>(H㌨%A{rG뺬|= >םhu @NКɂ-gp`"D42HDp n>runTL\ꔛl<CrtVȐJw 5++ dźQ) EȞa1dke,K\ jÕ+tF lM=2hز*ҕ<Լ畫8e*#~uB=ex'sכ*m})PMz OMʲ`'8?ګkl"ǝ3d'Sc|'8!}*n;ֆMIeN-j7B5L6}MY+ղi7;Zӝpn7ꄆU8=h-Xuu2Giqӵ+JEo(\z(FGLX"nݼzxPF$>&)Y,GO鞵 +>_z-#Ix0H`nܘTK=o406*DT?\AP`WNl~hb {\>1I&~Utavi «WG/=x]^r8x޶2o_?*'#iXec61#ɷRo«W ^O[o#^/_x«ǿ篘߄,[ϨeUao{%#L],Jiuuur}N xtw]?UrM C_5~Md  8kTQ>J^^֝ש΢E]4ЗDЂֈDpUv}{?T0ԁCb㞭7\\IG%E{i-{iĂPm#NkdgnLCWaնz'!tAv4)k9,]dnJ&GX\PA!ݍ.]jA $@z%!ESA.Jo紓L쥹eds2IB]Pp;B6n3\ `a R`Gug~,ꭧ=BELyp:;pp ܉7^3ߐ(MӡrҰj+[ӡmv!G[X9FU8JH`Ĭɵ)ہW@0vEuK]Kp^:PjTm `_K5QfIуNkv9CSl9rg ! !9Y;=]w)wqcI+Rspwlewnƌ+֟VfW^̹Gzf9FB!Kte,K+*V냂.\+hIa]5N/dWd ce0 LyGD<%+[rUp<Ty2q97#98<<}dGp"U 8$P KJe0y_Km (z)6#_] _ggL4 e T\^;֎×iv%U'Gi9fuVNʥ/HMJs̚*^; |&tKFBܬe Q |{6 rjI#m0۬;ϧ|u1?H 8=zޮmj,PVg>梤2=#.i0>'ءg  ?u9|@BhN? Ծ`k(,zytcE$nb`e˥>qB Zg3둉}Il*] Mٜqk *L|pjځCb=9X\Vtϑ%Olau.]v^ w,LN|}(繅$ƭL䝱1N5$E%,T @ULE*'AU7k: m)GS-` #nFk[P't7ٯ5aٿ4!u/cO x^J2f\>.AKߡN(ŵ'(-8R_O ¬Cbf@_BjӚN2$yor?H+ZTGڔlͪ<~zs+SGE㱷SȨ^L_kiFj¤}]I%0w~sׄzӪNÃ0%"rS%\T]}څq`ε 0&gL$og;nfXHKݾ #l8dw-OZG9l\n A[x?E} ߢ(JVXHc.i[UW IO9qf} Pw fvk(ӽ#0ؐ@stT)=!Aŧ]mN=W(_'*E-չQC?nK9 ?EOӫ7'wuCA]_,h=Z*fVg&?NkГU:OKN,)>sLp #1s#|=igr$,FNG/n/E>B-Xfg:5is4ڌPPgْ6]w ,q5k ::|YL9][j.;N|k -K0Z-Ťn0/5 ~cG798qś _5w̩V^ sZ*Yv@(w&^ R8vCcX#6`}h چpW$[-4MW@Dj :GPvz(ta\Ct# Wkf?QPօU5l"%yeߤO&VY.m!a&46 F6w)hF6wʚ|N[c{ݦk=V)\;v-- h5(ȠAH2Ȝ~%=?"2aj[ʑ;;6JR` k(39~eUsoʱQrs+!uLH"2P]'hinb$oJ[+& zTϬv"ʔ]v8,ڄ ghd<ēُʎg7.5ʫWФgۋ~[¥"׵jcc΋$siʠu/CgUtd Ե- r3v&&GR\+%=,Xn[4H k%]CyA0F獼eT7 T oIE7}T e6*Grj/‰ʞ eIVuZ~KV=!UZ8_.2$Na[F LqMBgufnyy?R-IlZ.v|sj ϧA{-ن ϛ6dnnΥ==}KUdfe}ݪ#]$v2\Qv*N#1.`qQ1ggpw%ۙJZkbvx%[aH/-5wޠ ~?i,XSA}\* o!-ҪT0ȱ?? {_;miɆQAsyCL 7߼09)rxubK6h*\:=`Db=.t} } Olmy=T(9?dp(CXqH:cT٨MT3n=?)Dct+0$Ozr4ly(b y42 u_m81āG lY dB'-<"d>HUqÖG\E~AAaO7ցtn.8eUyF Yup6̽3~w} i lȑF.Z278QŸ/WQ^ ?Ε:#H"/hMfOxyմB=$4[EmDG^>kH.>n^ieDiR!lV$$+V꤮<@CGA<40{υNhŎ+~<1(CgS՚F=X@l"GwyЖ%5ҎQS EF6VGq(@vܒ'ŀHI 2s3. sy̴Jo~9CDQjXrk_KRc:hC 1*/NeW{ aE\AǠ[%7b,> n!e/lgie7O7nCImG;]<h trZ YO<<Ò 666 yyzH!X2EϞwSvֲ!T0,-'B N˭ud}KӥOYKLρ;g9vx9-t#uKm4-$m |,mNnGR%ARP!|+s꿰mP&/"%z)h-gxOf5J/AduO?([J1Z49͒e<vc3|n|^A¤&Q;Bz%3] Zǔ^gܛx"mN8ͧ٩x Pxj>S|Ŧ .tp=q}̿IN; +hIm#A峁{7 pZTdeeUTЕ}3Dtp$\4|{0+I? H>>TWHV̏ԄKz؜X?$X2]-[h0JR0GlkM Jij0)"֯Gcƽ1uSJ^Uq WtW^c?p/Gz3(mJ<,X\{n1D.-}r #P[|1=YB[ܝ-IJk}DvWiy&2iX71HJխx.~6-YDx( BFBz>SeD^XNӼ9FpUn"!{ﷰyy>^a>yl ϵ(Nj9fUV~܃;<0<"T/(LV$ߕ& D9}ZV"|[8WYRfY~q$(@XU*4f|[h}I?)O6~3P'T06b#`>_ţxɓ2];(qcu 3B1jZi]OaRkmlllocz,*ׇZ0f.w@V~h|o6Rlv`Ks:6K_uaŝu2ٵ0:7&7DW!WFz6V{ycaEH.,xy62_#O7R9qW)=a.!rUE`zg&h_rkQ- /#n#V]k~$:.Y6Hv+a(,_{6^#A(\%k1~Hp9S?2sF9(ƾ*I 8`=iU0]SMal?>]LqYm<4@ $yDdKkG}nw٪mm}PkPG[bz\*?FeEGZ`L۩" yY?7ΓP+MAWoEɒ>0,zv\52^YrPhg+B^baVGbѝ1Y=% 6k{j# j] FP9 KW|4vM瘣_BJڋkĽe+ґ \x._d+xn:Jnm;VbyTm~%2=*(-z-.,jS^$p̪^uvKb{0E Q9txl>vU[:s\M(<>nI3@vk~M~1;ϴݴ2%鎂DdcK%(mA.Hv;qD i\U-uNBCc/Tj詀I^bO=0+ƆBF3SbB$`rUMBzzzF5>bCne콑 uKpb,LWK ~K-l(!a\^`4tl7Ha~:e 7ǒy1v?-;gcJ=Y r]ޘdwqN"aテz*$ $Q,B}^(+KD"^JAE'fE=Q7]r}wy\qfs|9g%q5K64 x! |jEҩ5H 98@j"c3yzfxmFp`aAi.#@RE!So7uHy(} QO߄[^R!ƣ{=911mqkylLʸz9GpuD[R<]O@c̭`HO۶ ΍~I d,sJ P2x8xr-B2y:!P5~`ABtT4( +fVYVv\YMǺ|{^C[v'%|]A,߰`l (}%e`zuי ?Ck9t"c=9po&luEM4(xOLm6זg޾g 7H3듫i[w%W*gNȄ]0PU\}qkg.&}݅l orT] r 1L.qh=%GafK%oVR6jCRjYf͚,= &C9rRg-bTD',kT@ Q~fR<&_&BZ LEF_z/B_8ZHĿ(u3B@^C «̸"9NjuQT-|rcpWl#H}՚jC=&s"+F[-Z6&?a?&IK$^}׌ѸEӹ2BݫSO)St<};ϳYd́fMP}N4l64ڂ׽G=*mU ~ȭ3j+##'' K֭:dnUgSnrש8E@yna$vnwc"MJ92-pL*Z3wMov &5eC/xOثz2p]x<^p^{"_:leK![0'ItMͳ} GOCH{$}}:J6A'A}2Wti VogGEQ-\H]6Y QdɈorᠪD5ԣT-Çj2jL9 ihxd#i{9N[zG̩#=ͤ-20N8` <@+2qGqGX g;!QϮ:7Z72{6ORWu1𖋳 ͮR`XF(ZTXFwӹE5X*c MXsI,FK=JX]_42b e&,Mh< -/y{^(33> 5;ًeh?-ӟ0pr A ":ECaO|kV=xTB %|uφ͉h'Or֛MʴM:[gvE3B8\D\ ޔG{MSk!́6`&QkcSd itiP~X[XVb$ƕ/#X>oOFsO75[=U߯Hy Qjֱ&5e,'( }F!o&D,;gͿ]o?j CT}ayʑiteיkq9E~̝/`tB<9"}4uEw2J1\u@mrf*A Bgx;nzȆ=% Ue1\ŭdOɻ2i[:NgvIMpBZ l9]t [S6`#eƶY2O'H+WMlM@>G4)qv7f7R{NիHXt3CPslE,ʃIX4zz 7 h oYXT7}$g}:Du==]OmreoV۾  I-s_> uCϒ t3N ~TT4]J[wj 59@2m3U:$9VdCg)@OjE`RC4z3RYBFn =m|ρ90wLr-s`~ρ90?Y,r 0;]G=0?C,Oo1hms\^^o{֛K`?!" <>yր~qj;VHwe$6#>"m=ا(PL=p#b%G0 {4uU8-m}xoJ+ {Wxvm(T$)D'aa  T ,I/!؛LKɩ.3qnaM H -A l\- F"v$1ƙZk!Ek%803Cj6q?Űhq1ǧ`PܲWr6mNʿN^U#as)">}v&%GP^Ci+~(K;kA!y %IdGצ=lb{1OAg~6o+ oҦ ṗ$7Ït 9|Mտ=PiѠEڻ.,}h챤DtΎx qb>l QOԒV$8h۸=zudd$νcH>$1.J `Ѿ{s/vl@.`Oj9IL=b7PYXAΡн#i)V_ tuPޓ"4_Pէ)޹ #*6=E'5@i_`b "܅fB7$NR+zKI R7ѝnM+EԞ13 2=LDbg^j7=6Ar^EаSJƉ'_KЅB]"0X%gӄ嬆=./1@_E)Xq;2 Jbf%2IC3(5{4RN/DFtJ)ٝ4oI-v ɞ,[oޒ9<Y(J>Ճx&Suřl*N" en-$X9_&89kxz)x~ 4Lc ]d],]LQɪ͏iޱrSAňOH< oT=Ȉ1Q%}Rk饦e}هl:DJqvkwe9~oam 8|^. (}z4267Bd_ E2~cu&ЋfZ (f{o{&8 @ -P]KqZ][KZ)ES+;{gv}̙s~>gޏ<%Q q ܎؆Y%:n!ˊ hi[qYݳz7Ll=јE:(!Ҿ 6_$9ەkSObRJ~Dt"TQuRB=2~R2_v<;$dW/FsL+0lL1+ιlc-Xӊ)xB?x^@ic^ B(%AI˻Lδ>0EO蠭w?.U_<y템`Y<<'dO~Rǥ|$c3/N}X5q.{=A2PBX!|,X}?0A`Rm1nO,&c~e8p~ FUuM\fcR#鼫⓬3u "d(ա7|~d@ķ3_(t=@sgnՏyx>}(ZPjVgzT9>gWjsOiA>o5oq{OAdB\'wɍo @&jeAIfn8\y9+ ;[M y9QHWBw}~+ZVz:y>nQwZD`.6eiZ5 'z*å"D;68P=IV*9&ԭuQmA-7pGmx VPtڒ=S|-C.8Vx|ĘyeDQJ'9 | H Z0Y^*U4f$dcV 7^s0Zdʞ[I6ƨM_mD/~ &!+jZ0?w8 % F"l2T iGz.UNh~3eC"+$7&˝wNI rlի<Ͱn/oIg#*X˶a<|*fL,P&fT)uyz*fXlcl5ICN6tvS8adӋ Pt+4Yxgͭ%+C1@٦6ф_ >y>O㙚6C4p*M_21;ؤiQďy5$ Vgii ?:fNdҬS7zݰ&.RFP,a;9Lt!s!f(/M] O+?v?(dZʩՊ=bVMOpv1t׷t.$`vVG_5k8eb&3n[!jnYv,5`oWKD'^um^9;E23/ݞ>0$NLo<2&J#۹Ԉ`Fg%|6O5 J*nN1 -lxH%@ˈf˂MfmW_2'&j&4%%(/H9WqzӽtV.[axˣy*u!!Ҕq7yt1 e TS-}TSa OE:x42Z)!f-]}/R_ovv́US$X"L?(Xeڬ*Vhe'cT3{]đEL6y-=o9L!_#4.:/:ȱ?V( c 8E$K*)k>,RomyjsI3pbX8ǽ)/8Qn-Y:?iѸad EEK3 K0R^x&n؃="0;pFHWK&9-SLEZo sL3ȏ,c0kkƅ;ouxXY)I=,SRQsrP 1a?V䭺uJcA,('оY#j:Z "Qf  6}E/볋f\Y $Ǘp9߭dMV  (K<gzH~v`w5n-'". N h  $A0?dgJbkR*a(sW0ׇL8@)/6mB!uě [ EtCzwe!s#Xv%Pa -|\?jZ;d[#$Đ5|2<ͳCF) T?ۙPM*p~ Sc*+,s\O=}:KCWjpZ'KUoOF)l,JOXbf?{NRKgd '3!]uo&!/ejq1 _xdH&~g|]l"cPEBgW|m" 1 W??S=kElyQ~'Se5U2v$ p‰\yG;T[Qt28g6؆ʺѶ?L1QA!]W YOتPSz֋-LblifK$l;m=|"TeUQĔǖq63ipT*xp!͎G1F j2g-`zy)B'_9xlAfi81.cR3=39BA.ϘE1նpf.@XsuGOOɎd.;}A=%ݗیBݞ:6B 8iI# *_Z;쪣鈢:Brm5ޏpvO-_pbA^S(GIl{ mU A0sm1g-rla?fXbsLP#}>bdwjq6e\D%-?M`~3kE Il>gvv&{@Ӣ{neaqueEXn+8kbAoR!7!hW;ײ2%aCoQR-4ru?t]*o`r"l7ߖvE̖իǫ| #I O0ϡ&ed <7;]M~]QUgRwl{2k"ű7,ɴޠEm C1'KtTy4yeۤ67ffqgb~OKm5(f1Ӯ)b:VJ| :xũPKXh#v5c;OJ} OE/SR&!)5_ _H`P|{pEvˊQQhh@qc-pw͗:$13+JMMCgט27  sL{}bngOdǝWj{e;w@M5o&sY[XX.ek3&dqyƐT|DE3#>}fktBD Y^ &a$'rjIr.;)0]2̨zʘ~J'}E.˲+fOJQK>vOj@k ]Ƅvisl˱؟SAg8n(=s` \,vޏN7ZY$_1x(|v(%~%EvFar"'m곜 !&VǻfX261d&], [a4՜Wo-u at'!LZ`|c "J6> KC)Xz-gggƼ8S9΂~yYqm(Gd8KZBL,Ca9[\w5OIGuP@NX0#Z_;t^. ٟP{T>R/#|5X{ |7" *Yfw:skSSU`!.0>u?33C IsLRy訳qd6A܋rc!$W˽' %_mΖu/~`D1Ĕo5MET=eyUz136@A}}Eol\5v2ڸ5 yLG-menx4᷋$:5?+wKdp/Hz}7W;XƢgdW6N-QWI$3Ico{,=vB>=@{^d[0j[΀OuqCvsnݴHO#O~⓹̟B2^R閝KTDT3 s=EE98zP~;}RZ!ݤoKO76X-=9m{=Z+dzо?h8Ymdk0uAREoQsju4MNk6X"Vїm(.ojݟYނrFcvҸ#[w+՛iT+:qXftj&kX6vNe?9 oU:cͬɺ@3ʑc׍woKǗ;~޵J*ҴG=/zQ\]fptfuFv ñ=l+q?"sbBaQw?.vd1 ׽oov$,W;VK@YC&.gm7\:xM1Xɴ`VYC!Bo85mxw6Dϫl2J7uY@>Sb'Dcm:ץy!v[ R[So]{.{ i/ ХFc_|\T8$u>Ӌ<z,$qXgujj#`UlX1~V;XD Ud򢨑UCײMd*;4]oڛ:vqgf>P;*j*KW֭3ߍN7poF9?CNRzuᯆ]!m6uAwMj^2{K%i^q ?ΘqD rKz^_ɁUo}^p.5T==5! So;b^J q0A{"|ֈZ7 ??Y "=J@̵i'߳9-@F-HnaD9\Mv}w[(${0 @m[6k=/T $Bnw\[Ic/t~/ @ἃ6*A3u<^KE| ͳt9Yl.,/Hđ`!~w- xPK[{_|d2}4anW!7W wo+쳍*t&WP}!-;ݸҧȩl׶>\^{${1qczl5j2+:z1 WXk ~{ T1o~ J~![YvlW(wmQ\%Ni􊲓`0|]q7Bwh%iXJ)ErL #{/zcxkm,xoO[(an8);i'OACJô_AϲRw?ox+ Lo<) ͋Z%B~2 "3oda†u0OS=Eht*ԡCNL_/a4Zë<؆1/;֯4meԸ@Wm(6H7qyT)(#)tsIjIS?s哎BTkTSb 2ʌD^\l<1XMS)LeCb&lVu5TV:n]R3*ɑh]h;djchY 3o~*yYƴd諪Q12ʛf+&&Hρzbʬ3vroXxX_WjP6?Gk(wƺPʴv]Fb{N~}O&>Anshe.֕Et%4֮Z=%PQfL1>WWU)sgy,O,ӓՒlm}k`tP2Rq=YToM%fb%[cͅN ؝ Z묗,_mPɿ[ßSw{PX镥?7mW9GQ~I\c#o'h֛my\\Z>Qnl$uGMYO`XYQi9>ylL7Gm0BNvaC*clb/%[&Ʀt#la)YYҘ'B _.mH}m̕2s36Ӗ9 _| u89̗!z!S$"vQO\CKqAjFc<葹,6 *5hkT%R{NZ_RXh@ =kwe2$ /BilNjoVh\FI⼜}} K_#)#gBSs-6GhfvRm8}e׽KNf/b4R}ĺ&j|#㗨~픸Dk{*L:6{2'!hihigI 'g\뇡ٴ[( nU?J GQOIy'*"ab PV%%m~"%yxyp7&dwouD'kO9f{~'Zb¡phj6p.9ʆ Yn6S*6K+<[*A-uʩqꝒ!TK$&_Q)fNDSVrdCٞYIuqSN# KXu{ *F ADtš ȬP 5} _='uS:$y;Z-3*BnIҸ:CzUwPm*fdlU[!m =+jbJrK齬! U ~Z..4ҟ˿Mx@>:_Y V?qxXx9y}=ރM,0mth4XVVIq+P)C@ קw@_\kK.YrkL,L+%C%ui? mM4Dgn [!TBc㩊c$4煡 @]^(nDA^Q04@d.T4,KP:gCӞFBxp:58f;n|MD;^ßlz9-Y;d=a Cs&Tϡzr)=db(v\V^zoex>ht2+57-AR‚6&/aMblX4Ee-cZ3܈R[- PYPA:/)ۄJsW]wYHz'u!-a98hد`-λOnC6ΟEd|0N&_GzEkW%A^I[p "!2 8>wd?t[qylnQ+F3tAo_[2RF3Y&JW9DAm<Ha}O [Dz5VjAK=R+b3)b A#OfݖRY[^c{npN=ڸ1O0F.xkZS#IܪEp(+ŝF>D9򤼹hQp_HZCГj^}M8.Rjs^K֭P^54}֭5| b+4HCDnV󪒳@T-} PB% y]P,L 7nUiY myL{_1aI0{f߯> O1ufeM:d̡C d}/Ӽvr i-p59IQ\#xRG H1#\.gWRtu6Pdևg;Q卿qe.!BQ 53dTĪ9pb+P6~ g7Z)3.|Nb}캂0*[&#Ї<۞: !Ii?V0`K9g/ݲ-l\O;/|l]b4}[2MW'?7J{/~fGZRrOnUWF-NJz_d *-R5z3/; ƇO[ e읳ɡ]%Mq!!yB!-Bd4A@1H;ZSs~4֞,om1yf޵w2|JvuxBOTBke H#ĢU1ʞQqQ,ðKz926tw(Vf:#bу/,)+E[> I;/Бl؈Ճo@XLW:`⃻r93d1Te89D$ z12f24e]lu%~U+@j'tTcFkI6Ͼq sP!i" ^gEL ,)3=SӡX@hgr9Cv-{ m@:aWp&p;}w̽ptisj:r6 e,ІT?D_԰=&1cAA#훱B$" q;Ĥ9}3>ϧ+/X7 %)_?-\!feUu+} (eߓk\hNiv@VXMzuZAv,w/R$)B@ ǚ9C,>f=B+Ͼgl+&'+VC >1ҧUشHGX);}B 93aC Ϥ<Ε ,r|on 5h`TpӻrgnLd{ϹwKŠjV1c^)) ~"8i]9^,|ʴ/ozA?8{,"¡ڿAA h2?LfEPS\'g}~ID/;K]`3qEb L+/qX3C\u$ͮJ@>3?rGJr IΈ\`#x%Qm+l8 ,A .h #D?vgFR- B7dWe167FvO꽲q2tz-YQ h32J1Xe,W$k=:^ O4߆/w9~4g5^tJ-ڢ9!!%&qݓHrC]zk՗ =I5q̶a3Ӎ}Si;&SysRrSj.ԉoI\2|+m +'[]:D5vQ.S `^aM!7󀍼5dž|ODLC|UXaݦǙB@ű ,5eLW=KXdYO14hV+r0k|H7Sk֚.P***HdFOK*{D--qBfH/9_]`QHVN  |K$MU5Xyfm8zC aۄ&奟42/Y]=^^/3=Kǁ&^^SXS+:MP:2lm ֗[+QA'?evJU{OLFg ̳՞Ek hEg ?ٯe wvtz dΫ>; 0 #muc 3dt6yN* 遐QH/ʹ'z529X/dGv'v'}aMaZk14gn7Oozkׄq[ I"لgTquxq𸣨miSU|]ya@A;b/{8DiwtփhvcNJlȆ*S.G"[GZH{I66iʅ(%~t2EqYƃ N#$Jv.muQ+$RN[neo2z~(^pU4q 4Gή΢|j,k"PJerjX#Kމ !%r w3U(EȻ_bّ[FQ+M.hG.TιyI uxblU64=NߛcOE0PxQ٧|yl4RFW=*UKTlN,,MWƻBQAB\rסI~8d`&NĽSž%drhX)NcTvGa= 5Wd1V gjtTC9}7%ߝ`PZIcw[6&`}PߎW 4yT<ޔJK}C .GX$&@F\@+j?=ܧcښlMd#o=| !m^6at6äaՠNf9WI͊^JX`=H"ɫ5sG4`Z]+@F)-n$Co*r=1;\(7 զk}O^we1 ƴSG{7İRVF澹'+vo8xd7h#q%(*8a<5>+*6xmT3@kf^J6qV x `h[&leGB7dL^ xecE)[2@`%:0b}u:xAGUWCIif$#<\F%dracΜffi!/~ C=u\ 3O[l %σ;[q}&Ռ@W/MY=Hqrb>vkERMF{z-O_e~b;S֟C=dWI,lҷ1:9"[u/L{Z9wpTpOL 1ܝIzݠY_|= |4z׽4֌ە_ uM{].C>'w'ZRZY_$ ص rws<.@wVxDF|eb#1QTqe\S{U% b@u|PD_P[+S%a4Z=3f6Y,VeX-zd|( Rf#RTq6Z*Yx~" ?ڤr`JrӤQt6^ݿ }h/u N) DZ0@Tđet?c;| N1qx/suyMƁ;;edN*~xHN2\AWWtso$$^cj+̉ڨ,|k%%X/L5/ƓMHרtg=*R\y@{K 񸿇~{xV[nqۆ,[dߒvlIDK=LP;!'x91qB]w3+YYZi;m"-=$>߁j_Q=^],X;;Xoih! Gnz Rk:I05" nRbzzX=ڽR 7$0Mtd'gg#[;Q"}kVHuU) VҲRHR-Bz>r+fwV+\FJ_| ~nK˓>$msssii\0R3y[e.[L(\'{3bXʹr3}s4е4[?`nS"zhM 0QMrK/Wh)4| 4GxVqV&Kd9ʘG޹KDZh,+U$ݼvX&]O 8w4H5pg}N8eg[OĭZ,w )C#N K&7 \#!' 5Fkl 8;=9ڛ%hHH.Gcn;$MUa)^E+<4b'XXKq-%G,Ձ%Ú޵Ϫa@)fccsF LZ)LC\>jC¨rҧ},ꊬ':G?CG./M:Ьw*@_ Ȫ^Z5eeSPsg0=W]0;"v{KUX +Aa}"jV- v*\%o|SUf. Ho%TYʌrtTߺ}łj}qzYSu"^C45$VKy-&&@WXLi:H= R߇.BgIlQͣuN6˸@ BhA(<>TG<%[sWNNN55dIeYKiݻ 9k2Lú9Fjؕ)aRM_:x"J(.v-֫a/ԯ*+KoV hf>.ҁ]!'޽ fLjGY譛~r$Gs tܬySŃ$NM=$O: 'm!neo_}zToRByK+XC9^"ǀ٪t3WYnD{ۈUi/{#'b*T=ڽENDv/Abvzb{܀{/+G%ґ$Fi*I;ݵ Q Nj^6|6Jk"3ߠ2E&@U=S.6 o//Yܥ 'WOO(š_gW/`_-3+>У2w7R9mmDWMN2Y~/1z`˄"]m@e9%yH+<ޓ~FF_KKHmřiW7mȑځ/b-KB'2*mTJwLd԰s楆eI-$fk)Ea&7铼k˛ =?uteQ"5֎:H I#kj*u e41jky E`e2҈Y <VMP,)-+*i )g% p<;-EPeZ/4 ʫq|vE'i-Kr, z)´m'Nk)Yfi!/F!=zj$.qfJD,Qx`Ŭ1xU߻j'kA뒣'XXn&94lwS5 p×)Ms1*LxO]3dOL+{J`ЁMg đژI)k6:,̦hgCwXERJ8C~ F! sUq+e w&3~ґ Wiڀ5mAx>>f8uSH3͊,O'|u5h?/*<ѻw% "|[sְWv܏$Wa")xx0tG$=VYYE _6^7w;)V!,M4Rl wʹ3 6̈́um7??KuˎzݸŴ.g 2K]V?:ϭ&p$'(͵=Z">;/}Yk: MB4örbBx`z%7~AW{j%Mꑌk7xt Q(:O~)jMxJ"Yvlx`hdPD_*])KYʣW2ԬRiny3c| oPrCxA1d (ÊRDu6 Ke[Ô 7Ch~'(v<nRf3>%B?/.=$gfao㵋ڱ7LV풘=FM/UQ/Q}C th!c]Ùnc<=%f)jD*@4n7.%$IF!DOfx `m 0x4kLt\v8;|Mbx+0`#_tʔJǞWvT־cp/:EYTشm!VVC܉ze Mv\ }%VS- '|[j*wKi}塥@-Oפy q.L.$T0*5iL͘B6~uD?$pz?~!M zķMm|UGyBۛ𬱆pU>)#d3ZaTIz-G#lX㣍b8ssHMoZZpH8:.VH FE%^G՘ YV^m 8)+M|ikL.hr z{{{zʾ]5',+aa&E2@h03qIcmv?ȅ)k#vLDz] [EHI^1`*J{]PvsX޻1Sg{DOO3y4-Nt31ea$7맬Jiѫh|F >Vɰnlb;~ _o;zVR&N{Qqimw3!$tvne*87՗^(Xn&Оb%|&$B6E%EJ5}'Z_ 6O6vZ{'f6)Ĥ/ugAF$`k&@^z5އzTM?A%Oh.A.yȴ;{;ԝg#oJ X k78Lg>rR(iO&zHKA&aQ:Yqn6:kD(7Pء" dܲ`F&ґ #O 8@8^=;<>ؘ'tdZM6˹}f~qqa4|`A(rSm^ ,4H_K4KM)gyh5aP9SAAuw2cy<#+^~ @h$Om_Bnߣ\{_ITVq${~l{:064'RZi9Jf_wߖ/~!#(`ާIG5e7p0j-v,=:},r=y+zK汹ծRqǣ˃.C(Iy 7Wl/y9#.O[o^~FdAQ@KK, [&i9N8Eb(/kFN߆Ċå$Jđ rѡ"Ug܉'Ԏ5Ll&$͏_p s̴J=ļP庭zb(j` DV~ո_c4ڲJ#w6 9P ~mİcG)HɪwO V:11M ̫KK%C_U#,شaR㸆wEޯozz'-5P:Xl^a7bfJ>~qB{S5:hM9EqƂ<2mtIQ&~9&a][Kܵ|8}Sd*~dz9Rۇ4qrR[%4pʼ2Eвm#E \G!scPj*ۍsw@h!߈D`u*{>e阦R-.eŞӞ?=?)XKRZ gX4JxFsE$le_sϨ9unܪ?Hd*9zXŧ9*3ޖFa!lh&J8^{&`?c- J/&9,e{[(jjn?A&U3t ^2KPM]&v6_}D0OeG"y]36 RL{*لggfr&[꒓`bnd5+?am&Ψ5%Y>~8Z!걈0v Bˎ;llh}̢Z+ag 3tcoTe^hjq ;w{ج.,]?ЛWE+  suF}B+|*HyU\̬K6#jgĒ`ϰ R8Z@nA7ea7AiEbaxBttek:*Y-o&/rsw*[5 _0?&.m FyJX7_$c|!LZ"jpaD F[,w=ZxYdʉ՗X y RC6QgU~(M}GLn ,Vcx7n__VZ0gmŘ-$ۛϦKj;sPw1+1Jʂb\x WШ+ES(Kbv1NhOa#{qE-o!au4VXjCɯo7daƭK$LŤbXY4Q8${K'enH鯻nIΈB\27,('_RX{&I9{%iaii٩aS p+v-^4 PNML*%2MG|"@ElEGpZ޾F1~6;[lr{{#'].վy$]i'9hbg+yvP`ʒ$&7) a;k?kЕ4ﮮ{ǀ?CBC Ñ1amAPj~RUu(V_鞃hϲpOLhy[*^ߕ>=qgyS8Jf:\ HuQ :)XkLgxB8ljCc~0]9BFU2UKoP҇dt,f w GGrq9lPp^2qXdD_ {Y '3!lE֙WC|(ߤfyPWgg{M7%%x4$g WH+.̏8%|ͱ"{ W2k~|V1y*%ʺRu>A9P'o_l~EG{zmZ[KE"0gb| hZZw0}F1,e  $JD].Dv,XO&9SiČ5Hʊ );մV>18ؓ={Gv`'䶰]|,Oyf@|C1rSUΕ HF|HzRE(ף٠(nWqmI(FRBu'չfĸʼݎ=1{B.^CH5`l(Ĥ-i:APDVF (4b)dp;2v3 wf+`|2/ҹ- 9\$Iev|ڴ-6^݁/+h N*\U@ċM5OOv}.'10wQo0#hu8t@1XFVHRIc4X_f]VI\~`( >qMV{@0*~`RgT\{r0V-XNnNq19cqSb0m1K6UwNx҅bĠBR o8DS) &Ρ 6ZܞjDl|#ƚ5g ,3zT8~_+lӹXtwiLl,|>KEq?hإY^1>Zy ]5^Vk) <gSmsk^х6˛ɮmWb:, 1Ӛ窖܍=;ƎfI_9h\AÄ'Hџ&bNZN-E+mFgIqJm Re?Jdѧy3ZZ+u B |U̴Wqi:]XG0< Mre8+wf>;3$2+mlY n7O\ .iנYn||:z=m`h_B/nbu=4PYϲNVOT1 _h ^$\EgܷUW[N]|:7bw3 . ˨)#Xx F ͷ* [^|XI,gXASW"/}%G%"bpAd{T;M<.. Ҭn{A?GA Թ8E/* b(9_T„&ήw&-iqF$v_l U]K騛UJ3 3c kƈt)qiVXKˊ A25Bph'-!w^N?)1t5}u=֛ ?+G_ʟޡ)79>qP9a]VRR0`} >;-b}7z0-Qn"xHkj 2dvn-99܇oF5E3ߏT {N F>fwnuNc,Uq3V'ڧ'|Y: I6塍&zOk< -3+J#s@Dw!+"/#,8EDdrM!x/^['I@7p>)gsI%ߝ+` Hy9/`/r}<m^' *Gs睮")?NB_ U~k4o)\0i}OY@|~_g9WM %h20 u?Hxۜ:/`]doXVa(e4]4۠yЅp_8υkp;Ȃ{i.)$g^p / +hA ntn/1D~68q%DM7Jxiw\f` @tW@9?>ǘп_\LƠm.:5ƿ.cKjW?ZX b{vY^gw1 XzpDbaюh Xa1-.X6Y~c_Ε2X {" mȑ9`{a/䜫N]Lb|1ٹ1NeJ w1uNq`vX's]Xۅ&(_1]_üh-g<r/'ſM_̿ډE|z}S ϨC?Zy08 3 r.q[g8_]>YSÁMmh18\YK\@J.<S>@,6-.²/}.rwayAp;3?M|] saL.ˠՅ(.Zd|Abu ?f3ÿmuٿzg{nL?Z\h[;Olv/Dn[WSs_M'/z5¼`&Nn ߅B<=O~ly9\f\~*JLQ]~N8/pʿq I?mt?νJ"6Vs*.pb!0e?hy]Ai5 Njܹ6܁g<T|s.M[D{>z1_MW&.=)t2g`B1ncr_r$&9O8¶HWYq=Yz,(R= z54STL$RRQidd>,K6'}(]($bV\ an]CQXf;Fb jm8_,wycvhnLrXFieY':PϵoꈮeeU BvmUΗ1]b'ǣ.rks [*okI>(EQq\sB0Hi>WD*S˞U _GQ6A)Ђ 1-lglT>r{.2q3hC]B+^Ir>&8` W5g]ݏxߺCW/K0kH I-==]bRQo8ތۇ=Œԇvzzn󲂐 Y} ·b!usJ6JP'~Wlm2fY-xYW?f Vhn?UG{k1(AzX?\qR?l|E[Of׬%\X=_q_ "9vFW8Msߊ=_@/ճ=T_٩?WM߼0{b dS0_&ka%갲g]7yJYe--;K._?OOdϕJTTi)#_Qv;GE{ ~YUU6]>Uu bMmn0iC"d77͇'GfOK,հGo|shA,㗒' /I( q!HuC JP4m-jN ~DrS#^0xJيq1;yU񩬫a{]izVՉ+wWau9WxK̥qm-riDNr?{X.e܁Zݮ'Imd38=٢~fe4_k.ݩXO ^t6|쳭ZZ3|cl*d`fd>98ͩ>_5&l^ t1;xZCl|:v M8Yv5ӟa_oTHח޿fI#1ȊE|u*3/ ^nz ,4!׏P/xB+72[m_kx9{cξ^]َT&#%EVlzKH@3qmkeU]| PFZ4#iU&:"bZr;OR-҆TZ+E:m.,+ڂ]$7Aaw ^}06/@㜶r=PJ IH5Z _oЯ(--e0e:KiodeQyoo38 3BÓ`kUYD?Dm4qA~rac*o ʍZ;_>K]nqu,$z>?q޵OoUI S* )@ԱqXZǁ9tp]q3I݇$Yqw;H<NJvղ(yݑt3[CQK+zvrm^J45. Lj7îT9MZS $! t@oSl&7 tr׮QzZ1נv'M+jMpS>~h" U_ZڱՒYU/,Rw讧Ck?ӕ1]`%+&ZϑZf.%L 4!40Is =J0bV3 m r~6chuWX~-6y_c3=B-qmh32(eـXy`r bwTEG30Qf ]6,R+};~oj#l2)l+D9,z|~M覕i4n'mwMRUq utaM2XF{e)Lo,#5"dl>?*y$2܇1?*kQEΈw IhR4h_ZU闰lPGĽkLF| w7D_WF 0DKVY2۸tAXGkX(ZқGZ~mO4kdB/ʩ]9ȈOU:xf$IY)Mo3 1)us-赑)y]Ns}&]^b(kt\R 8ӗVGD쩗''Bh׬s̱-TMU&jնʊm^iX#5m%ky *2U&(B-4ϿA1rahN3AUwr&3GM/ 1QiCccc ;Ԥ@ ̭"S]$ Gs#lnndK3 =,Re-i! LԲ+Zq‘ǡk'AS'vFw4e&0gդ?o2@C4c,#H-ɵXUYITYB8jV5M-:Ne AAp5I'uq׭'|es`(Wim]?Tұbi悭yt*@2;E*rPBKMpfLP8ӓW-57'T!߸KI'1ZM:ˤMb1 hVa甅V|1P'Mz-Y!uv5W(残vboN_=ߧjZ$׽b!y1cP,иCs΃vp>ĩTXz YR%ƲW|Wkι}MEe?L^w聚G I8 vbkJQ'9hsB`zH쌸{_~I0'\Vpg D 1T+2T[Exv\{l6Y/`. hb MN T=.EQ< m-~!49SH1Bm攬8uuP44R_\.lal蘢1մE~V+%w3 13No'{-%EX7 [K,hn:i¬ε9#BZZZS|b{S"n.4PCX. }8DW a*!X\mѣmsc3<>'/($w(u[߈gn>_~m'G$6g:VeZLzFLIB6E3CXU" 3`X(CQC\)fMaHB\ݻ7IG&܄A@XGgE6J'3M \5\<tl'X =~[;(҅Ngi*(0ijwLpIfyrT'wf? T\B[ v<BdgbtLiNc]GAvhC~\ǡ-6i,|!kг5Ψ'.38s A]b}+7*>όSGRU޲I܃lI46z+7Z64e7aӭu7"tqusp  |:O򀏍up]eػxg.\*2˚aM}+jj7JhF)jmKK+-+dŸu*tE9ϰ2o,;ϹRYEszQI5sWPbI,e?Ym vQ%w$˭ϯ&aGG9^׽0=ג\e@R-Yʥ!q%!dƯT<ƨ@}"ux)ƺ]ҵT2(2%USۮKSo6>$>_][:m3Kb>tƪ5 ?槏e͘>a-׊󭥥u/<ÛuS5=Kʽn|5#Ev,۶uV Vҥ.F ;c͖&JKjXjXy5,_ IYx0]O "5[V]*l>z'>Pr0]|'[|5,?O*X0U,bo T@ T@ T|*"%B'X'cW_ P!JRҟbRwğMGˇ}]ħѿ2;ggjdB` j]mW;f< &_-`a/YgU|I=9'''a8Im'''}b[I$D$뵌i{IdQ$*Z.>oNG48 8W'pp6$I]h!q1 8O ~%)l&' ;``}Dp۽%$$$$$agp) ;t+q,HC6}c| tyW|KC3B&f䡢cHc]U(BISGMgN( & ME(|~4hj<T))lhiJнQyM]'"5X-:J cuVlGhh:L 44Op۽%)))))UNISƈ(BIIikx▰QPZMI Q*PPRJ$$lh)Iн Y.Ohg'R $ Td]W ( ( (I)IESPPPPPPҗCID+ޑQ`)I _$:m`%*DCP0)QD$^ԓ@I@IR{%٠ͰFa`UF'ѱЅp$a1 ( ( (I)IPt)vo ( ( ( ( ( (K$7t(I0ܔmIFy$mQ$c%)%% JJ†{($AU76QGxd6D/6*mDF)vo ( ( ( ( ( (ip)i16tLthH{X?6J:Z*m`#*DGP0&^ԓLL{io&OC5G74[a޶(ILQjDژ4b#&W&&&Q(Jm`ɻWǵKa.H-0 0E(|~鉀I W06$Lhmtf xN#d/LLL"L*(xL{KLLLLLL_0}\L(Bz"9i-B&.I W06$L4t7+뛢4T0QR O[TDCuLV{p 8&&&JL{KLLLLLL_0XF.#` CO"*d`}SXXQLL'&A_`B`j &du1.o2Ei$i"jDQ]$FNJ"S3FIQ$[ZZZ%)%% JJ†{Oh:qTt8'QPQd5*&[4&$$$$UML{K@I@I@I@I@I@I_%}6I0ܔDץG}S߾O?FE"2{'9$Ykk"7C,2T v;]vx"eg`;-XvKDaL-Qn4M:.SdNNV}}MF[?`/q5܆IbaҔS,GCƓ\Uv,KP8'ڀXFLݣ%Wk4(8%o3ЦdIG|ھɚ7ņ%2 C;~S`ϖ}EA|D˻h^tz|V.|CfNQ\V|Ka];Ix#;Ŏd7efsڦ+vN(h2?=Ub5Gusi-vu\dL m( +v$;u❍B mbGjuVֿr^PROckoZ,s\1odnqMIڒUuSݢXL{th]g@GGf]xvK%r6NĜ;kYvn.[Ϲ[raxLxD"rXfJo1/1WnSifr=Ţ#ue%W+ ܹkޫ<+^|5燄Ov6>Ë45aKܹ(KM55W:tڗY=Ďp.EnTuNo}\u gߔn\?}E/~QvQ ;j:hs} g^VNzIgSkNthXA'ǒsحD.~q};wճc)𠝿,EN %-Sd$UqjgR=C}y8'9lV.lʕLEf٧g]˙`EW(iYj)w_2f%öJn6 astuFgXw2_/gq8_u"v<>T{W1=gt[ߜ"TӞؑQ|ZƌkdRAEŞ eE6Nܠ]_IE-u9vWyv ̴;?=yj{OН˹ Ta- dnm/.c>D/1cAKq >_K<)y5EMMbh Q{M Qss;6^b}N7O ~GKRUWTIY?ҼR +D.K,oK[-L7q5.)-/g]\%/mqiuG<^o+uw2WEQ>@&eL?Rn؁4zˆi-s=pЄUڨ~f-ۏc1ˢ;,T ZG1W>#+|ٽWZ4v#)zݲT̜tk_mKc:4w67*?}[s%?[Ȟ4G /D;FZ}E?Ma>$l̿Iέ7oomͯp37䲂oy_I_\鿪yVR?>jX=kܼHr:Uzlv ?"x ގ>p]v :1d$1Frmӭ{XӃv.Ҝ|hQ41KGA\j%$C7y>b5v޽mzWڶQjCMp:WZgh AO6y6mApDEIDż Ԩ &UGe{ګyVSTT&_]n`o[]\co^[HWiuڬWߤw :W1}ܹf pKoh| 8[du᦭ue&%Jr O=pU920*U>o#~MLcKj(g,jS;d x+"@Az1kk]a"lKNp8e`G{R::iĹcWAj1o/}}jv Gg⊉*5 w7(Ǎ)cD]bv=XDMU_9-ⵟ -[25.,yQT7FD.)󜗻y呌 EГf듟=s/E/څIrZ> kT0#՞*ʶ[0ciiNAJESTCJaiNss~^}ッg\^̞ d_Ÿm8BC{4K4m0/xj2gՐXl6(?W'8D'B"W4¹zk4â9) D&99RHˇb1FԷ [o?vrMUnKR8+HLE 0ׇ=&ܟaYFF^ N LgFz!|)0\Wұ1*ўqϙԃSuf:cIw?@* [i9^ @>:\J@sE@~B:1xbPGo*fXCHGU|-(h\QoQ= A xlQ3(:ϕhEX.qtѳr'^Wp˛6Z!!}});#rʽVkNœEc!ji>Y,q("Z&"1nnBG4T"ps!Sη6[{g|YC)H1AA 5ֳ97#dmF.U0&kߤ{_D_mDuY%h6vS-gPOuƪ| 6huBW~Mp J$>xq@lfr- )YbUaTwdɕ75$hJ~cjwOD=+I})ܯT]_SzQekVo=tH76$9GW%hxrs [Vs 856ac+s7iP5C ~_KO 5V}wx0 K=TVMW躌oLq.vqk?AL RWv PGFG87nq̲4w{H24>c:y )R~JՌk~4 yfNqAʥniL+<ϐ”Py'yZz&>*mQ>[|Rb'JgF_#a! c^8v ,r-:5X+,l: ,o/GǏNhē[+ rt2tLen\?J ;*p2^b=)_A!iC&[t@c]{l DFP5O~q**W=?0N> T_hk-0Qp:n­ Cvp5qۧ`gwP" [I ANZ* yDe TʍIYW@(}XF5IWe+7 ?b`?b E,gY%c׭wGi7KpQZ^j#I#`p|!Nk jXQRǴYoox- Jaj}vLlj}Ґ>n9 #~%D'پg+ᆫfݸ*! hp$8 D=52bQ0>f?J%8VF"6K(>3[Mf QIk{"V&[t];{8^IdV5F׵CP[B|3CǿȷPmrhh2Ε|>YY(CinUH -oqw{1I\p@&t= [+F%-dw4ؚ,D7ϜQ->?Hj NNJ& AJJ,WoӨ+/oC)?g17Z樫԰Y}S, b Wbny-|E.6ZWnbvye?9_}U< `yZ.9!ylJ8PY~|Mۀ%a^ 4P9&/K% 1<[*>0wĪ! #ݔ*^nq5.&1~HZh&h { MŽ*[@fI:fI bc#$@\HЧ !hQWYNHm4%[nk sm"_'* a(Tv57j٘ =q"ڼK^?@ h J$maWT%ݍ:z\CF%\ \fI⸌,.RZ%s[UI R;Da+SmaU/j=+s%oʅ륗xw$ f^ ȽU^!@}V*o9i&9CǑR/QKB(CВ2?;6U]wû;%Xԝd?Gnb^m]+.]N8,es*.W@sᾟc;\0#cK”FXEyp ctʎ~dO =lU[IBdVy UX$MM(q}~ =fVbɮ|^)!Dq< v9)F 2^A֠j69જ A[xKVd˖ގnrG3uEr+W#VR@">cSNN;m>IH?)"4/pLv 3ur?c3OdBKR!]|">jÞS^yŹ0?'"8)UO$3!fwC U2Xm,Ѐ1xʸg`"IV.0: mu)Z8y抳d_( h͡"B@ J |2fq8KoR۳2X< k= {>( M0̺ZzjN!ʶE|9mV+q`.,cD}WI#* Gshh>VӔԛI7O׋"5铚EG#E͹W\U3¡_lK$ KD' yC1e;ZƏP,x*<ԍlN3| MK'u |Hςɩ ]4!v8MԞKY~#uHkVWuѡK FpƁ Z!@1"}z3aJ/83ZA[&NQmڤOǏ)qpӢM#ENy$c<gߟD NNPϞ6̐ ͹Owt[δܥS؁qJX*hT| MJV𘮾%p(>43e\m5\^J12Lesmk38@XO(w\XJUrr TЏj_wڸZ%EK?ųutFB ve;7g4;j,$_ "Dp;@?5uCklh*ypC$t"Lh}d=NlbP"΅Cj^ 2[17ҍw]Eyx1}8e[2(WUbWnA F,[oK$U.w2-3_L X/ckrfZ8&EPNDrn8tFJuQǽ}{1rE0YoDqw o1g֫Y?3U(hR̅kIhDqlIIb) 9N8ԏ|lӆ 4osXkeC u cf #vb dwAl>&}*ʷ6!bӈOɺg-Y8}ezrH<㨇\Qt33Colt=ig$"±gpvDuy;rm ׄg`ۂo}bkprRv\t _k'|%Gc5^zCpRLt~s\|BH# z'7+ emw@DbmPșwo ](i>ǐ^•B0b*ә/)E%?wQ,+^B]u,QJ^Q$aRnvAN:Nˢ"K /4yv`0zE>#MVj;YDM~sG>$^֮#*;pkVLP@vA |q ~"u|(AyڭNNUӱF ҧiݏ"IP|v:vME~Sͦ{zu6ؾf  չz:O0@#įrS*~r!cdN9Xb^.t ﺛMc| SDzZ Z!lqZ<}2;y~MOxmd! )tqC k[:}S0)~o8pq-U&\Ql--ܩK]ש"51< ܳkav{ |;ʕɘz5Aa|:T+UmϷ֡/2+%_? kvcJ"36xh(4k9fImpZ_?Zx/R!5^Ixx~i+pqb|l6cEoN?RnM2FD[$'tIe|EgP2+hdd()hN>څl*h)$!iؗ_}+n#_錙Ex~r8(AV&Օ6fU\rդÔ#.(w;BtM04G/?z/[Jza+1;\M^P_@ Ih@rڈ~PDlXqܱ]shn WSzXм蔔Có Il^^g'|N9:֟{ wٲŝEoa&%_Ѷts̲QJuK1wf=RY)6 v=EEGŲ;4M 4=3y],?~t?)MΙt8[,Vtɪc]>"8R1aZW|-ȪV7oh/NV,JXr 2A}]`o `5 g$=oAz_sw}OMX(Iw{@U{$h 4$H) ;fdh>0$!ZڕWe 4o=e4 B'fs &#} (f 7AdKaߜR%LӧgЍ^'_}ءb2K R6n;j3(*1 !ѽ9+"zs_ճO;IF|AoJxqt~m?Ԋ͚9 S8{ʲz4#W ]ՠO#g/EBKRG :C (Y:z' o]*}6?=HT.(m@."onI0S;gAOa(Nrx)nhPyqNسayxob^-lѶWUB vNO:{z p(sȾ rkFsCUZ'-e/|gZXX %FX:&&'.1 rz|_ R"|{T9н oVNRE_t 4YcSqUh>k$s "K>F8MvbNf鉚 HѻF(R8p,\z7Qx_%Z$7@UK8(~e D[N#EAM_֗ 5\YC٠G9wvJ>d`[zaerHgt1RAT%KA@`>ĔoIyEړzjGE2>Ggs!+ZeG&RK=UTZ" =h s osǞx]K(g'^=8t0.arJrks!vW6 =d@hL$C4v;؍0_Êu~wKSYՉq%d#Q'oErNkJNW+DmB… ISM9CNV^֠6d9F'We}ֳ|Tg݇@k"heSP,ѳE:C2d)zk.$ȋ\号'YP'uJUUQRv(ZA''(}OHS6sR};aFAz sRj3AƠ ~YmӑT=adn*_m7v(NO=iNGCΎz|bK6(2][,0q씵fj>'|5^tFZ4=i^^>͌>yQ4䡝/:IϔG&䛜'ΐbfɇ (c#*T8޶8:͟,(?bvlhOwV]pU9"2%ht9Q[s-8~=J,[(.-|i%4= -<-XN_}Ԑ1Gd{@jDVm Å<&sy G׭H!'РVJpg7ngxb.}3]DnOC/'{ҩuZ #85Q$¤kcej_ o}LW`9\ M Z+E~[15%.5Uy_e94]AQSɛµh8oL+-Rl ۺɠ}㕸#m-D$##n»4JE f][{jEʫd,DT"/˵ Ajn_SȒ|p Z)2S&{!^94Zj=WN1,P-1=O@Nk6D>UK5sXMekE߹ h Il|*2؍/u<>>0;2Z EJ ۀZw lmffo drq 7 >Mܸk~'ɔr5 Ѐ#OA6ZuZ͒v:^\hxKI@N{}֘%޴nְJȔYNc++63rv4qIZ H :Y?C{Q;>vd"\3pخG^3ĒqlժJH#.p'(,·yaϛ74d/hnaÜ^T^ҭW|JY:=' i4 Z1jX'>%xcc۾v6Rc5~K kt53n;xh)rhLWwwԭ1]=wRլkwf=":>k:DCFJ ܝ\L\@#۶5[gk8N9+Hޭ$UoCfY1*N•aKyluuwؽ3*nw e2H!効] Ɵ8qKU?ԍQϤUhAUIߦxEXg#̲WbpK؟>,UM?;׻>9-ŧ7 mbY=gcjTȲMؚ) fY%^]5e-/^)ׯ̊AۜjqJ 6H9;R'h++MwD vɺ\v9&' m^ǎ7[YjYAl6?ioǼUb4O[^$&}&fhz(!ɐФm~GOF 1X;iF׿]nlMh m==چXgZa0\l*̀Е3/eb8~V(ȁҢ%PHI!hdil~W.6>„o4Wi*~:G$U_{(,>QE@kjKjT%z 6 ‡]o\YnM@3+ (.S$?±#! \aٯ^1DbGD lL p;G|EB _SFl௓ U 'ՀhʯҴ%U_ʊyDDrDC_3ݻlҋ&$lcdTl&/^(C/~[Cڷ ٺy7vBݟcV xwǛSLi|^;ߜj>Ww8W\h^iܻ6͟K+ˋӂ_b԰DCZ14<[Wt=P[uLihh`OR;F`zԘyyuvgmۿ0]~;n7ؿF6w{+|O"R?/~??g=٧_?7nTa5Õ6d^cLNBߟ@w7 } *w~_z^ѿٍ[#3OßRy*'|wg|!V禮8;?[o~qiXiӹݟ(8u[üb{;Yn-$c$}ͿXA~1颱žv771HWw7G;~776oo(oe0OFí RiB7rmyowy?p.35ymzϯyy^7`;<;S88nMwzf÷V.wz^lj38!6$;s6X7U: ~~P!Dq I$wYg1h?JJ}D~bO_Mc>3`n.77ڰ?KgǾ̧ڡ&uO1_]kY7?~՟?L{~? gAƵ o*6}xˉf*j|ܑ׶CT?'>?=ze#IBoϼoz%m|zy[$sYc_,}t3$MxuOM=sSn&z;O}t$]y'>zSnkM4%O'-ؤ?%ҪB^R%Z2TKf]x@`r =R(JMҮy ~'_(ImJҶy DjP%=`(``OAǒ/AT(sK4:XRW:@y^qTʔ>:HB HB.T %שC&i:ʡ$mۡD`9 lm⩄׏ρ{.sک&-%x7%{2%dF))Ul:oJVߩw;YYiDOx'DzP"=@(./A Kw K4l7Q4%:6d(%\?h$Jph PJp-ؐPLK4:~*~PK4:~\@m=k%苗HlڸHhK^"uxBIj;D-mg쫴FSlZK$ZKFH7`( Ѩ/E\\\(x5/xsiԕȁJRJ4SB%%6ӇԇPwDLDѼOZ\J<9jŷJt3=sm $t4Lsb`6iՀWjo 7MD+)/٣TjI yƁlYz3^yC0Y۬*lsD@sD?D&P"P"P"-RiQ'/i$/ѰIJѢN^aK4h: %5$Pqv(I h" ^iGx †=l!( %B 4r })V9UjJt:XR쑨[,mJRyT(I塒T*I塒eQI*)`IkcP%Eca:-hQt06lTc\jjj T*Ca,PtJ:T%UKVVVV{$*tG7쑨 HTC֞C%+큪oǛKJ?Δ]濥ZvjpOMb`9{x=捥~TХ7_32q-7O`W,?׋G sBդϜgff*{`eW=nQۿfts)Z>ϫz9hN)4':76'ydCcn/pc)OZ?t馎 OژlS~̏9u׾+ͯ18]i8plx9 ـA&kz盚:0ty|`| wFvfjq-m$vtHbrcX `9/k0hi}[++RN7\ZE\Ks1l`CYPw tEuI!>1LJb&qL ҇&xmk+'9\7ok}+Z0ưqDnއ)Fg "]p; n$%ǽŷ;Z/¾H㰦JPʥRS~*=\C)'P)v41NEuwoZVs&V-VJ_΢zW&b6~XBctDcs҂9;XF>ir"!KJ7ꖨS%:FjXzn}1xl`CKc-[#߂cuuǭ{D]'=Q}Oپ-Ī,_7 ;n.S4P>$G,vd  O>etf]9:'|b/ qXY&gюs wXRH7,~5ععEI|}֦35-0ӌ}_^XE{ϯ;P0e`v[%*aO;`:c@ާ6 *&}/Y{3>%]3tiJ`TPmIi}i\/gI@I3@ƣDk>KG5!L1Z[-l/Z-<)`̘oM{4 /)h,V.W-d}qu"=Q!zCm}t{vJF|Gq&IKKX4&׳2)Yo_ (!әjN ^wƫ%[?1֊jKIT͜ \9?#oźMрN&WAO}Q(Iz #&0QgyNf!ZYj%bX `6!`vOiKgErڎ&}q~ |u/q=T [~Yeyx rx|Crk#cX `60nO *#nWY,͕r0)G Ͼ6;"~^=B c챝94V?i;Ay{%^ W {Ƽ4m_Dvx3QK{+~}ֲ뗣b|ץ+M6 GTr>TY=rSNʴkm|xҎ߯4zz^>ԏUw4Wٟ:SnljӞ5E=5Yy?Â0sy9 p [ af-=f;w 0 +`U;*簴+ hr[%l; ޝe99zzŃz0ۗ"{Y\5I>QzM"s^ /w^*̲`_]x=cb82T 1E+~VW 舴\;gmɂDy>R|ܟ͋Xvқd.O5m_rFvۓh=xnF1d VCݗՇ"5΢hG/>n%ZSSvTVb3Yor1:e9"1ydZc>.O=WEF5||K~E#pme+rFo4[f-.= ܐU{i-K5&96!xw|{.Z<׍uH_uܿn߮ܿ.nM_os7/[}##bV+>¿-/g4 VX `C*7 HG%2gKyIC%@~%&Kiu!fd&3ӷ'LJ6[n;bkTFii̼9穦mS@mVuOpy{ʼou_ߎ=yoyyyyUy|4AouPkJ[gthb=ns K[naLizU3_ͥ̉v4e|͇oP29O6q';X':DqcY1<2}Atٹ>@ =E9 ߫!6@ch iK272L{Xw4oii>͍mFh(Ok|7w]|l|̊`9P+ Wfm jUj]96iۋQ)-S|śc+ȗqNp2_)֦^SP磇7lp;}V՟~˳;sƻ5_\0K*}/λ dW(dۮږnjμ)c_k#s;ΝectCftlٝFcf)t bhijɜ/Naaۖ`s׏Y3Ϳ2q[aîioVS &c hȶl~M}ytZ~;?V3b>oiԥ3Ԍ,w*3Sz]X֧|%YJ9sy3y%V-9 bl%۹-S8MC.X_l)Foz,җ`[5`QNqOLv![gڐIbz%Y0w\+Bpʫ:Qc #ӕRތצ=W6^Mp,[:fM{g kCzceq˺s2^sU]X]c2:3MqY흟ݧ)K& jX`:23kg'r]G|eDt"N 8df9'rl |G?8GVRHBf#DUg#tx)όvO9o3/ #iaYV$+`=@iղ4n%:euwZɣ PAu}>exS %x]\ _鄰nk3F?'ϵkH&[ <(~.,+wj}*O}?u*kl]'CU_N|ᩌ=-OI'}3XWų|:oIg}Aw,EV* u`J2'Ӡs5bX `6!ubxQ,Y5X@WJ _ +# i 'NDU@ V* [dlUϱ0EmvhǼbuI `%UV3{;~E$z _e͂/! ~_,P3jȇh'"RDŰ6i kC,Hlt|w]$lIϳ*oW1fbL+j|o7ߛߛߛߛK{$|7}̎ 9ץq ka>JkOPmK`oluJԪ^erߪ6ݙGyB:sUpdZ@ks0w<<ykϷcg~*^"GG?|<02iu0:BM\|$\!ۓ&=g3&ۇfQF3uDkRiNZO%CcֲEuDkGNijl}4V\?HUMA*pWtYѬ^7o-fccp[WC.MDbNZm$JɜjN=vF9jg^bzVX)1*\nDμwQ-{ TD g"V:^1i ,/OD+@8+}k]Z{t5_<;J[N*1&YYu5)nHGE>Z. q^Sʼn7^GWIr>$|Ԡvd?#ܼ9]w1c:eer|yXW?X軽$iX` >!xsU<hz3p͈tN[vG_E6¢ަrK魭N@W*bqewkYc]WݫH1c]>S~8/^9k[FcYh-5^a07 evlSܿs{}uq,atkjRu&pK44B˝Ƶ&)0jN> /#OH\tsB]YL |ojd:0maۗ6vk%;tŷŒtfX^8„t19o a7\N)9uk_|,4)nOsb˳ߞlܴړ яەBOiɂG:t.\{f*V)O%g:7+/Tm\ y@`]YE+'"S]z Nr'6kn7#-ucVX `Z 19f5V0{)]\N1ܷ,~vD2Knx\r֦NRaOT}}McZ3de=W}A58@ V@r͌}FlڡK'fiw `%UV`FJǮJg|󙬝Yag;(kC袴FFC+zл3CQ=*aإvуpά>7Tv+cۓ4VXRW65$sQ_G7C*[-L bwEN)h5 ~޴#LMao@8ī?uڐ#^&$w3NxH=Z[/]Ӯ׌S*]\3)]ǎ( uۧWtS~OOurhfi ٙ?^dd[9r\ Oe4RR'Weo]7>)#:eDFᩎf#޿$=='-UAqPETi= )ZEksM屎x#:U20?ntG7yԔA bq1ipI{43nu)Ϧs0٤{cX `XYn[\I}wg⟱AmCr,n5O]/{#6F"q?+YN6%7@GbX `4;Rzyk#I>a%UV6 `3 ;{WI&UưJpTҷ-ns#sŒZjz}]GV p&|ARI`, W|tNOG"?iw$gr4MDcrtw?O# jl-,9ʹٝ&+%@z:nk 9#B0Z&#[FOH?$o ٥=-/VX `KPԮHhNmZ%(F)Feg[>__zůՒ;)ݛBVFS?Cѭ~qގX.YU?_3 w,fZ2N؎N[&iLYTPnh{2::^) s^z8K\.;b\Z2Dee1:x7 ;0nPf3aG9 $d ΅6y®wY"S1s-Ǘ 3*%c ZhJ˹M4y>1RV!pp{NT%$vd8xDXS@tR@{Ѯ[wFh?j5.a 3: jw@jOj6 tqi%.Sg~؎܎YHO6I ='A"k}93k|ΫYgnu]0CovIrdTwvιNIFnH3Rm(2TL7qa<̀6~Ҽ@X)v^hgt91g%D]R=c ܣ7ͯA+ot鴉zF9S+d΁`\nW"^-S䪕UF[MW;LY8Mt+ѽ0+~ecZM^OjFrwu?Ņ9"i45V< o jV}Z][5;oWVo]ˬqm؍j\fG4B >Yc6>k=-0]ㅱM gGt͚9ƻ]og}kR$KcLJWEП".lȎs@'ӄyrՏT8;[{kzBX[=ULA\NUn,E׬2%6#}z)G*gRNAW eMh8,?th}.799cl2N&aiu*#gI d]iψ6RX1%B(ц_sxO"+Vq K$BiOtj{G'5qmsj&/hè 05)ڽ lϜÉlO&ɓ}4+PX^Mb9M"/%}vlt̲smIKVd] :=KϹkŅv M;{C+t] l}9RSVl'5.hqxt$񚔙\ FO+&I@9 XVҞ#>dIRr7ruYzZ|!3(Ivf  Q乔^@Q3& Ǩ:Mru+ }8C,"&{垴EZ0 g2i;HXxrB娵dE]Q[3l(ە4h|4d`q}R֎nH*. {"(ў2?mzί _f4f?v&JA'൱.5^' yN #jӍ')rx#ƒ'=9KbɟF޵2O/Ӓ=+,cm Cb,:vi];Wh;t i$CqQ[NM$z&<}wbL?ޝ8 }+{8_W'>p~㕤$f|خ9F]O֏p {1wnqtFUѓ)+ӶYp3 tF;krK^nNc{"GE$Qq+}E$ú{ TA0\Ǔhk/>&h'AR\N/Uu5iݭrJ\Lҗ1vJ-xZcھCf(j5H7E'zouf]ًv'i_#48bǪ<_1ߐzB^WF:*CߝwmF :=/A6UC>R>`b NhmNS;us#p=Pw)Kxh 3x!2&]Z|^ˤvg5yE1 ^te{twJcg^+Fћl#s>ᬀ'gb>gU:F,OfT/MSo.CRA +:orhcTEO-{Z. .89=ZeDzHq.iЉANcX `6!M  q~)퇕w(kD!ڍaR!Gä>J(>hΠd{U9\WWvE V I WjMɈ"\s!tp: 8g,RΪRn)-t[Bt+6d,x"oKY NJ&=Kd#@H)vlk/SHF>gPqR΋Yj3)MLc\II46%^vˍhSE_Ut)sP3Tϑu;ڕ:>\p}B;?9>1'6̫^,}Tt!wF`>)8VG㐵T3ziWٙ nQ[i?C#񮈖-҈68a&0S&.0[8^tN UЋsh6s2+.o^+ɹJ2Uw粍?܅)qSW^+sxP+[S'+oG} 9k =<217BU\EZ  M^ƚeGQ$%B}*HS1q3e5 tX4Kpv@f 9Z4xehdOiDFgDeg1YP[|]NkfzZkha"~ݽ<!ӷpM;X `{iuj-W琷Dz(J1e4N½d%'Zm,J:N(dcEC4"#5.Q6Sk(S$+S2>Mݻuo5?ʹ+?VyQij{ӊ5̜l8)IX?sM0ZrV⚸N8X0/]oM@9eMrrq+vt#],=yuh ~ kO-(vrO9[]?ó3mWzA )[;%}LAdf`$n60i2%]jfܺpNG_Ng;XCu8{ջ6CKvJxMA[8hU/7f|jU;cJ~3=Lx**zAwZӗo`2S tfOz@Q3 (NJwHk7J n6L'M$O%< O{~LjuWNUxmN6+T)vV-D#yj O 䩁<5'yä*#6Zn= 3< TV>=8i,` H}[ #+cq_eFft᜶>'}{뱊{ 񾇟~D{[= ~,E"} NㅻǍK|+*>E۳bJ%T}bt@9iH tBZ|, 3>Y rk.>b3w4#G/wn'|Hr>LTr(9>1eυ)-( %Sl9,%,w'^ig?igiԛemsm=[ *<^,l0<彝̴a9MGz"Eq۹ֺܜv<0-hr8tnv&ix+Y]O; 0Ck)G":-ioOd(v)뎿R.\d#ttEX"b7WMQ|o9]wJy8PZHtͼÁ'ȳDWoc6ZoW(di[iӜS~jXw yN[NQ>b>GGh|4żeNFţe[=>ʈ2⃲SiiqEbٺW}YZ*⮊"hkxFO}9q{z~0xXcб:⿎1XbWxXllYHYN Dda,`'XwE5uPsHVX-+UC8o}F1._`"T@ Hl`C:'byl6`Gg#6Iy_V$c@SyDIYra;MrC0)l=r'"X,çYpZbAg,B{k1I1F Iij M 46 `3$&bs"C 0:sA¤@Ci4jRG)Ca"33m&9a{eJF06rE*i Gw')Mxi9a8$XI8.xMs8r&s>7ح 㱐tY:%r[-rpfg\S|Tf(0M;W R :Mi` yyŌsߧ G=^ 30bT8MQ^+ɲY|^8>@wuF{o%2kUu8-[[A&u #n} <[Xpa<;E-»]{WcDۜv]-EtKX 3"2+J"ŇBO\J;ř1CvvY.gwTZe}j^(Zf<ۙ|#g8fÙ"oYSg+0Sp C̖;.*:dsdVS=ݍAWCgȽy.N[2N!.4vҔi>džu҆9mX#m͆u҆93^9cNm5-FrD)m1F7^e&qo<ϲ]6qQstQ߲-r&xzm,8`,wY,r=;{bc6zam6k9]>#n?MH'Uj"AAy^iKt]b~N2vpXl3}I;v㑖-Ew;/NSS=;vZlWt3 wzłq/:qwa*ʿ3TZ;w:Hړsj;,7r˭H)6)tܲ}Im)mh-|16crIC>y=RSǎ;MpѤngz>&3:ߴ35>߮՜TNܬ,^(8ާT9rɹ\"Wº)3&44:KsiT刎`Dk4=:Ni2#{ut:ԝÚZZ-/4 inj]+Y$ǒzj]xƣgqK BA4: ƽ~G397n2*Lbc+g<^wX3Ӓ1izBfE9Q==F.݈S2*tʢt~tm962Ǻ-ªӱU?u> m:)~ ,>OO%┎6(R^(^-e/w(^k ޫ}a|C&NcqW_;iPq( %A?ah\\)J5z'~_'J}K5!*'36ǜD57aqrnBs͘3 mǦ~y~ ?y Ƿ=;Ck2hQ=hj$ƫ]fhLF/n,W|ﺢgRώ-1_b O4߳򳇚Oч'1Ȧ=1^/SφgkX=bFboo ]%kjW{KW6aǼѣ6w'W{Ͼh~5 kE%e $LNm Ot }~&tg t PR$$((UwR *]ED@T4!C/* U4xEOAQ(Qfw'ۻ{>;;}Mf]lFu0) 8 b(HIH $) )\) ))I$B*@ ɐJʐ*k!U! !5 5! !u AԅԃR aH#G! ACz@zBzAB< y 4ȳ iA!!C!  LH(hX8xD$Hd2d d*dd:dEK!3! @^̃̇,,,,,,YYY ydd5MZ:zF[lȻ6vȇ ;!!B| 5} C~ 9 r$;$ /YHXQ A C"p) )))DAJB!1XH4 $r ,<$I$C*B*A*C@TTTԀԆԁiiii i r qAn44rN]!@ZAZCy aH#G! ACz@zBzAB< y dYs4@ `P0H:d8d$$22 22222222   yeL,+W!!s s! ! ! K !+ +!CVAVCބlly$. Ɂ| GF?y"*j"U|"Hw͜Y\ ~˦-E5*\Օ6kHvٳRlG'kl.y6\́e(ߡc( W֗t>EPEu1e]\YP֑ژC]GIFRMBr*Z}Uȫ7K,[q;?ʺnN,w,ܚlϲ"%B?# Z&(0qGR{Zs鋗uynsμݻԭf]8hJ7-Z>yp"Sڪ8h8uSr:mEAKm!w@r5^H}! ! ! !@@<I < I d@F{Vk_X9Fk'>;{^ ,Q1RnZ1A˨\Ɲ^܎@W7 xW#QRMcM(f"WPÛr\{C&@&B&AWL^V{Eut]Y{.G}+zp%em&!b_H8t[Ê}5P*^=DY|e|uߗ>2" }Qֱ6¦QrX)e]ZY ODa(ʺ!^&v &]B `!L0,I&BT0U,Bg@rǞTCX[(3^"db0VK?1K%Z2Ud2bf2'Vm&SWJ.fW'u% L T2v`%p82 22"%ːW!!s s! ! !K K! A@AC6@6Bނl y y@ރlll!d#N.ǐݐO { B| 5[>~w!?@@B~r (8Wo\? '! BNC@ q_ !E $RR RRR B !e k ! DH}HxTkd1E '*6ve-#䣧 ټSEԭCd¸_o$(]&\ nhi ii I  iiii iZOiu[8 `Ρ[NSͻ.vf 1.c_BP-! ! !B|9jr?d8[dԗߨaN;:9#X\a=| Yg~Z:wkagӭq!Ƃ%hܗM'~ř3:FŘL4ÞX1E=5'9K;gbjn7Ҟqi/t,q@ڡ=2kG|0,省]Q |χQ"^k&'k4[+8e4&&VDR=ݯ}1[^DdjU>V& f`ʛaj?~jH5Yajn\qxw%XuedfLkIEM;6t].WjvfK̓vDBra/֯V#G! ACzxrC{CK|oyyvtYپn=ٽ!^7^tS& i^۲Ӷ;ly rk̰YFkb)x*L4ROO{ΚE747tF27 "MvPFhfevYLat׮fvq. L.ojgϮrnz.E9QV]V"P " 7.нA }zto\ى?j{oސ>T'! !OA!93k⦬Hq M絨a2l6MϋzB6Z=by96K(3Zܘ`Uf!)5ll䚍:&1q*)RyqGN0OWм3L+&ʝmxuezg@xgK;oҔԶV9v{Ź(_2w<ү'z`3ZN1b/ú3׽{zq-Es8͙mL u;WYeD~"35lYbKuΑlCLad9bPq6,G}JiXm\՞螥cdjdeLoi_A=}ɤ'RuΈP (mw*#YF'2L[|{yXZjT05 *.Ҡ?pi0FwPzvBJB [tDq&Ҭzc1DdN`WZxU,0YZ~Ubx1œ~5L>;3)D)3K攙U3{(Ysʢ|m+&9eA T2k?E$j3L ^-22 22222222    YYY YY YYy  yrrr rRnrHeHHCH{k&}0LzJkks@;ujɕ"xx"u6WruЇ_QhoĸoDo bMˡiQFD1x[D[)o bCH} +(p(%+UT֕uE}LĊ: bŸ;]hS9U额Cp5Z8Xdrv"ibrp ,2X" ^5#@-L- aj[SB,BԳ an0 ,i(6rV~z6#u?85Xra?rNFA0A UPk0_ zb~FAVK\OL Aڣbm cd6DXo'bXmf,yC􏴙iFM"2&]kIbWzb~b{M=R'1~:6nzYc o`~}`ʜ],cڙa: il,2_; WE& 46濱q ccK.,V,LB_5?zb !1&8Kڣbf~X-i ^ccc#m8Όlb nm9%` ph ϭNf8z^y,y0'; @5 pm֎KQfukgUw.ʙtQxlU ||wJ /2mi{chVm]` G\>nXDY|:BTȓ~ OC < y y22 ɀɄLLLdA&C@BACf@AC@BAC@BA^,y &d d-dd=dd#-&ېw ِ͐w!nH=V6 Bv@vA>|s/!_AB [>~w!?@@B~r (8Wo!@NBNA9 99r "~W !vHH8ɂLLLLL̀y 2d&dȫِ9yŐ%e !+ +!Cހ YY YYy 6H6d3]y >d;ȇ ;! CvC>| 99rga/#c_!AN@r!C 9 9 rrrrr7DLX bC텝Ŕ;_~+DK%s#s~4|vٵEjB6o^ty ]mg6v7е6\کIo;x_UwaӆMpą74c_͉8nz6˟r9Oֿw)w[oy9G踤HElɪ|>⢕ fF Zmm,/EY0"CٕfWz:/ƮovΔqȹ:F{qe]BYG*k ΦQ~EiY˟:b&:kDص^j+dF(h̏)SpLǔW)b8&!11E TxLrLTTѷ~hQݪcrɗɮpX-1Q#DuNZy$I'^%} rݯ:%&:6ܐ%,7/%L(HHVTh61]Kˡ &Qd V+H"@&1B+{6|' #̷=5' m%:c6lLXRc(2ZDbɾ%1G _!cqH*2IC& ooIdd 2LGf"d.2,@"5ZdـlB6#"[o6Od;ىBv#{>od?MdHN$ɃE!HAR)EbHq$R )A"H"R 9 TA"ՐH &R E!HC99i4E!"!#' '"͑HK$99 999iFBF "m vȅE%H{R2r9r  tF 7#]n-ȭHw6vN.r7܃FECG  "}GGǐǑ~H I)iY9d<"2y  F o"Cwwa'ȧpd2F>G@ _"_!cqH*2LDAE&!)Td2|Df!9\d=2Y,D~@~D!%RdYD~F~AV!5ZdـlD(BHaRIF!őHIR)C#H%(2RTC#5H-6RC# H#1r4r i4CECGN@NDNB#'#-)H r*rr:rr& iAAEG.@!"!# KːHGJ*jZ:zF&܌tE! "ݑېۑ;;HOr<~ yyyyy yG@DBFAEC #/ /"WWאב7Md(6.>!#cd )2|DF!ϑ/1ȗD2LEf !3Yld2,D~@~D!%RdYBV#k:d=ў =?yyy y BG>@>D! "ÑgHd2||EF!x$ |LB&#S4d:2Bf#s<{d>Y,B#?!K2d9YBV#k:d=وlB6#"[o6Od;ىBv#{>od?%ɅF y|H~R)F EdR)TF UjHuRF uzH}i4A"͐cH %r Dz! {>ȃH_!aQ1qyyy yyyy< D^B!/# "!#o !țP-m]=}C?G0Sd82 BF##_ c/8$!7ȷ$d22LC#3,d62|G Eb'd Y,GV +_Ud-Yl@6"ȯd+; َ@v"d/ُ^Qr 9\Hn$ɇG BHaRIF!őHIR)E! HErZH999iFBF "m vȅE%H{R2r9r  tF 7#].,5.0 +_7"ޝ;vuM ҷS7 .7->9QCרN'PL{sނP0, â09 Ńa`X2 r lx[~o]2q Xju9F߿f[khʀ{ϦܲuG#;\勺Os)o 8Y-t:zlvYL."]ל`z1^|.v}&Ki7k=Mr6k1tl6 :Wi4dڴx'tRf'^|q ]Rb_e$=ztZߴ+tH%Ckɻ4|fD]>KGgWq1JUS-8S#85S+83j1zH\V wwŽ Za6F^lYVȌk8eV3?`Ͳь|8% nloAgN ,@"? ?"Od) Y@V"?# d-Yl@6"ȯd+; َ@v"d/ُ^Ʒ|Y3)qqfCGMmkTI]# gMygA)MGEaГ.?^)@^zrL'ei.7\8`t`0, 'e6zk[#_jR(  ~h0LŒ2uz|S"8%S*8S&8eS.8QskmjЃgt#ز5zk*tY3Lb%,xʄ$Z[dBlFw&g>Oc[2%4/:;{OdJwQ;zD} mBLah Oբ|h^7Ozd>;|oMkvz?~ tOIƣ\FPFxJn":yeJOdzg)Z㬋H@,_Z&>}IwJ鱼rbu Ǵz4'}tF]uIovu;I/)sL/t7ȸş s[dzY:2)XDqQw^ϼn<ψ^^Gd^7Ѿ5[O1jŌ_/fc#3Fu%uSf)ӯLFwpd/w9+#uIKY_֣p+,u5Kw]!#4b ~t\5UoA$VZYiH*mUp}4o Zk􉻫$Ȥ![8W#6z+m5%[wT*%Qԯ RG{c]^Rk}\m]WC)ӈG{҄_ ޓf$ks->ړ],=0]nM?gag̟-;o SrI)#l]"[qY%"f)gŇcVw=]o޲퍏O_[񰶵wb8ձ?V׍ghψv7VVcVǼX1/hŘo݊iݰN)3uӴcaZ7u-L駅i40f,L릙7 Ӻi´nu0f-LkԞO,L?0Oi44ߚ}daZ;Ȇ,kZY͊XX݊\3[+kabX ߰bKV,|ϊZm+{ޱb2cCf,o"VX-V,be"YV,bk"V[V,Y;XkXܛX Y{O\orUL_b*WmG)* =N+L-/c|98UwKU~os$r/㸭ky~RCk`8R/'KkP]zG5TE#Li4f*Winh\H:jEɚ66qMR>)j1>G{:v>1& Oxh.snRm4bRscR}4i|dRsc;QYS'YƦe͵Rp>CI9E3'4Sp~OLm54sn~YtYSf-㧹F:I{_5iV's::4-kIGL}dshPMKu>M_u :=\7ұ&$kbN&lĨ4?Ly!7>#9IQG)f?k:WX"|)L+u4q,<}aPM^~SO4heЌˠ=j&nԸ)×7T6hfO>kZcAc "pvOiv_kjU#NH!ХKBaCTbjP*Y$ՀV5BdTJIua@dv>JJ͡_6RIKt.ls(A[öRIG=l;(t@;vR:ϑ$^Mr:KY3/!%BgúA$ 6J% ,h~|P*)(΄x( 0JK3ET2] ;J%TP*$M R (*BA'%Qxi4;tRҰT(C–RI ):J%bP?X(xKE>ŠTRH*-wiJJy#aG@$4 :6J\%hvaP*qN.P*AA J%ػ!1P*, mH@(4B6RI}i4!JjKa@ZJ¥0h~P*% RIU2TJ% [w1c`CQk<3F ~ #F!12']3{jfj`PK`콁؉-@1w-S#AM1gر@_`a65l6nYl}>4PTZa.fxbEPxĒڠڈ)@ 0ajj` j"-E$U臸dĪA _ajX0DPSOD^ =֧^obTo@(+C XYkW;h ֲc%PEg% X ثA7cWǃb*:4hvoiă $ ąRؿ%Ƃb?E `"`G#MS4;bP,hx,"h"hPqш\@|@E|AވwE@^EĎyA3""Bȃ<h2;'(HNaو'ճ_#껂MWD3" N GD'+@؁tNDH{{!j?;,G|mͿ7[i˟mbkڏn+>؊''?&~>6ila0gsla0g9la0g 0|g Ç9 0|[Ü?[>YÜ?[>YÜ?[>+aŸ- cla0g75zZ_[`l-϶~lG[~l[qu>3[[oyR]͏Rߦ}6QeemYSt}+H|!(g6kv?^V΃u^qP_7 SvU8R[*|p&c?TKu۷W;R/=؀3NpY`u+rpE룜m,Du jFtWOuDbANI(LcDZGO)O-y[; wWh1b~8Le8oP@.Ll]cPkko|~oZ>Fco1>CLuiN5sbTib~8 SbOF; bO1r#1!9$YA%b'`[b[1Ϝ.օʉi~_=b3.x5b֬ gq]|ϛi\bŜpsA!%q]?Oi]:~˙"L> .恳3͏%3\g8 m941Gigx߄(ѬYGGE 1͉X_>g}!#_kiRXwPR}b?T{;"p V⧺_D<1D1ԘlRc/hOQ}T,k_]ms<͕G(Ʈר?&},bI 75ToMߊy38cR\̹YcE1~",bIbfAq2/.|,){wsivt l֠t'tt5*N|픖.] %`H ﻤxm!tZ*;2ۡ;`BC+nnn  Zv=t>e\]] Zv5t 4vt5tJ*h)Rwx9hh9v)tl"E 籋02:[*[\'G0’NP4^;y)v 4A dAQ ͅM9LlYD|O%⵩D)?33`=~rfa@gBOshN̒N΂͇HNNN NpЉ Lw|x8ر"cac`@c9h(عt\~T̅zz`i"4\0h ,, ;@. FT@RoB{C:COC{sPԢ{O{A{&/ -:ODI( P,|Tu*v9`aNCàtRC $ʊSeوP:CJDK`Cmapq^ Y <T_-Փ"t,[[=B26FHM*&t ,% J(NXް#ﮊwI?B' E[JYsz'zIZYtƢ?Rc)P: B-C[5iLE8zO)͡yɊrs\R6)*f Щ6PZʰtv ZD6:iWt,4AtF&Q(Xl F B󳜵R| D  J,A@w{@ SH<.aBt'ڨ!..-SPb1t#7țRҹ(1bk`4m GsE# /k (c7zS^)tW?5ꁶчX\ :W`b4?Ŋ71=V9Nwq?Ȏv:4;WѢn?"ɻNڜ*[ObYyj?{bF#o=+e]n,s 5g\ y]SsQ$z:^>\44m0!\O>ѐZhQRS[e4?P6T6m65Zke *׾j.ՄR.U7?{V4JQTWonHKg>kϮ !׊nlȱ3Jpw6T]7doh}pp4Q@{}N9uӯ{VIkSЫT}uF^='}u +f _=sǃozKʜBgY88<ͅw,$%v <56<5;<>'D'b=][a'wO>/[<`S#[*I.69^$W;,~yWx-֭>NלcnȉK~gzp[|YX;5`k_fl y6j8hv.l00:P{ ruX&^8NfMզe%;)%V[~!?${p;4Oz=Yu&L7(IQL 7]V߯l^^u{ xߜʞwrl#w˱Oy+)o~'Rڟ}+~:[߃f/\t.| !wǭ<ܧgkarO6 WœTy!l+BʽbY Bx,]?}݂|J{\uOROw~!ewe޵r5pU*ggcS}(OE *w/O[ւ[׭/>JA~xYnlfc#_Ρ\%] > ٔmo઼j_TXYWW8%+(' 6 \QN  <*1ɋ+˂_3{9F9=|ع;;ڡ > %0* . ^E2wKB"S<'!'_iݬx_ 6nxl;]-_S~FdS~>S||q `ϋ\ڏm!'/ W>p})9$=*_2wUo/]D5sݔe6ݚdS`z*S~>2o>F9Bxs7|*8t;QNBCaX=[{ya]ld ~ s*;:F9L[W_ְ+ɯo͏kW7ɏ ~ .QN>\D̰d {8/Z!')x ӑ&r~cZ䱂/ !rr'zpEpD,>g0Jވgq n)6tFʔ_ {*&x'x̬ɬrR@pōG؏l"AN^Ep#SqrsX6r`#)쯟G3crKS7ם2O .:F"'o&x4y ~0QN.>5h7kݗQN~@B;z~\}^ñ|"h++||0f#ّQN 8l7.M]ц)k&p~5q|`wi9;Z F9yaIpxkELw>|38D,1d'7n3 c7Sm4ӱ DN \mΣ,+ Lyw#GtV*('^)Y|rr-G;5dȏÑS~.y %ߘV7[{_k9M]\؄Geϧǃ)?fw_޴{L9K a2_ >xlL9AÏ )' .(xÙ's`l.JT~69yxyge/ 5_98"'?p ,Nk{W p{5[/L9yMp[-qP_͆#'?փW|kXn Q)7d'_SS>Ny9ZܜrɉS>Ny9*㑏B^Nlp0甏@^N9ySN9_ C^N9SאS^N9u0ꔏS^N9y `7㔗SNLz0 'S^| r{$U_%@ 9{3"#PĀ$"Y 2 ( wÐAAg$;䜃zv [*j(SUֽUrUϭ\&nJs9|Oy>r0Ս`rp, r|? >ߨ<.ѽ8LAM`cmt(Q&>ߦ<U.=<~V|^YwnyOו˷)O=\7qqp9<{nuU& V<>P2y-toW.OQ&EtߣlFL6 2yn:x\*|>Ay|rxeϹ]Qy|r5u+R.}R7X<F/L^(;Ϋ{n幕3t](V&My|r9OMw)Lޡ^Uy\&_w`u VR.L~|Py\~D9\&cO 67s)Wt~QӺ!qpy2y yu՛+U.Lڗo(7V&V/<.n|K/<>EL~n:Xr0+^x3r|?n|?/nz`?<.rەɇ|~82yuOWy|r9w ^ㅔu><>T|>Xs`ٺOp`kqPwytG`t09wN1|sdr98>><.L6@Eeu9/ѯ( jp\S&H7x]tKGq<.iN_^W>?<.qpy%erpV+7Q[>R78|2yutq0zer9|<\@eu|?OR.LNUqpZe[uE)ӏu`R_\M$KuOӍ)~M7xrAeO+to=t_ Vk)|Wyry298sf\|u<.L><FIӕ7+WR&Q7x\&Oug*R&o{/uRL~E#{p[฀km>|%Z{MtqZeIwrKL~\FKീ/sDŽ&Xs]UrjMvɫ-%Y฀ɓ|Q],X7\ /y#}f|n.p]ඬ]32qW~?½|  Or_;ۃ&Ϋ˔\m}Z>ީ~ }O|q] ;ݭQx-`򮺋ro[[&? w͟ീ+noIhޜϏm kG7|u:32 W:ҽOm&X+R)yy]盇M~>P&ߪ \re{RQ7|C^ܮLB]E78.pZqyG¹|x-ɹ^^Ln.p]k=E7|x-~ 7ܓg=x-` ob1|3ߩKIMd{Zn.p]ߒ͖3u߯]=e|Ẅ8ef ޳^ݖ/\/uwmiQ>qgU+c|7ė|8.;eP.|UbvWoˇײY7w'W3meuwYtN^˽>Ȯ ^!\nf^Fw?]roNL җBZm.ÇגL^DQݍճ8YZ>? |Aʠ0yT*ڞ/Ln.` T&tGu\ N}i^suOCL>KykX/ey׶ɷ꾤˷+xZQ&RW彸@]eӺ  <$>&^{4:YM>{|w 2Y_|%=р'&FGGF>k۽A(`z$>7 'ӈL>\CV%%0#&` pWM&/;`! t+t?M>XoL~^wr5;3tI9E&DC ywVvW]|''uu~ߒB!peуue2S=I>ߩ;;$>wW)N>/.aL䙺?/]v?%Y=niY^ A7R~p.\\V0 ~k:|n&6XԓgdCVr?ߡ:\GdރLt|n&[|n|70޾|AVv?H7t|?&&n:?g72j7`r)܀ᴼS2isf)f\܀b n:3&`IVo~lQwj;27ٺ?LN[LLw&s4M)ߘd,pXk&cꍾm'7]`YLnz$&`=?_5|K&N7X}| Wbࠃ V3&]>kࠇ|n>Q&`Voէ&`r1cަI?0y *t%gDVW&7`^q>7V UUyL]wG87{Mϗި`&ɱ2ok|b[u?@>w[(II[_i;>?'ӫ3u&O4(K>4|l g꾘碻%|vb4݃|KϋꆃA:tA^\&l%`r?tN{`u%n0yi}ww)`q>/[E&;`9:b>D"֝J>_2(0b4?P7t޻iϱO0pcKVu&>P7Xg]5`r醃|*ݿrsـ~}E-p 96t燛3`ru៏Ys/ϽO=n &>E7t|?}An:e09꺟"xA~R7X8{I|&n8wg.膃{ l`uge/ꆃ3=_l>[oɯizI~-}]'RrI~x[ow!x[y-Cu?GvS N4ݹ?3}鴜ݏ{o,IeuYԥu)i);p]*I8-`?_M:|b[{H i);]UJʊ"GC:]ыWtZ{R !8P෬8<uK]t~n8~>/pZ>ֽ{M<8w~KnKo4i }BmopTboi{/?- ySN ʺ?w/:7-A[~˃qEz8--f,8`rl8ϫ/ptAz<9A4]?8-`rl8ߕiL˪ $pZ?闲Nۺ?ϱWuSbӂ =go-~lIϱ~K }8~$-~p5~$- >o4lX7t5 ܧ;p]v.t]n p؟oqX*i>g>>Hl~VݿoرN vt:--tu +᠃ՋyUࠃK\RE:I=K/ t0y A?߳ ݺsӲNw).f uKE3cL'ܧ X<N N?UA;[.XM^rA7~Meo3~Ku>As} ƿ[.KeEf8?2gTsN b礝kQ3ӈN v8ᷘ$~K㡱[MesCS,=~˵Co;3᷄e}[ΞO跤~ WlNK߸b7}o/pc~Kܾin8/h ᠃ϻ:7uu~"^ജ. tZ|݌~KN v+i-/ = 놃ԅyp^@?zuΟuAo[ii w:s |n8|i~Z7t>N?uA~~ജgoi"]_8U~~g:??1M? imf tP:~`gqA>U7qE7--!p ժ:t-~<3W2qp߇I~pbpg膃^>~'݇IބvN~f>n|?o{s7t}L4 =} Cn4oB?}[y\v&tݼU&R7u[J~&p+ tŋռ -{w܃,oB [巽"+܇wM轺 [Lp:Kwp+4[weއRMpSx<.>tC4)pៗ܊|Ant緗́n8C8uyP:s"UwP'0796t.v?T7t|K?5:7'u୨A yWEބ  t[=;N tVt㲍7uA8{h>T"?,'ex ߨGPt_t<ʛPti­<.i N8f TO܇J}$݇w]/pVTy\&y+Z/mMhy+:jeAӂ}yEMx+<.pC}؛y<.x.Wx+<.piy+<.p]{͗ nEo^?WNUR \7t|KR)ʛPtkzI/ބ. y: ݏ߇ t|?%sL -{oEaބ܊* t#u}AkAst>(syl.;@>Up{CPIڼ .y[8ބ=ryk>t:+inqPtС'xU7syzB} Ck^;MhDw}I5}޵MNއb}dFhCC yž {v5yn$C8 }܇*;pcңr]zp([LVw?ߪ:sq렃[nPq:stJ>ԁ&~AAIoA>U7tt[uAu??}܇&USr;po _s9pO AAᮜttA+~oބ^݃V>TГ- ttA<.po A>C7.P렃ɱpo8=p+Kpg>~B?_:sqp{C>[a/%Wbvl*݄{kN wľil*n})_J8do #uf_UT:w!KtK(AS1yQ]d,ufkqdduodkqs"%g Ζl*>;;/y;T}Euߗ+Kڕk=lXTwWMncSܝJw9eP7t|?>pkæAp៟ٙ]cSGWxBD_$MW,R)EʱX\wy>&pGuoekn8ϋ>T΁.p%WtX\7tbS:gUp?Jsl->MY7}JMEWZ,V9Ǧb1Zvw膃{>d)tAO%(A_q³-d usw<+X^&XSD_Q`S52A_R K}EMqd_qW,ξ⽺Gxh}% b_zž"D_с:Uq?džtpoRفOp_Oe:s?P 6.J>|>c렃SUt??:YZ|+-`Sq(w8ϟ ݬpweS-p~p2t놃|]JA ,^J;pw yK9p pI:5?o렳'xU7tm8ϳtA5n:?N96_ W8pO '}87ÁYp_V؁l-~Ӿct-?qs:uA+Z=ϣI|Mh{I|>?ᠳAg܇s,wwer8I|e܃(tϣ5p?7w#er8 t:sa\6pV&nLsAg\࠳.p?8I|n?j:::Q8GWs?Ls:t=8{p?澬Ls:t=8I|JsAg\࠳nt8;p?wH𹼛sa܁9\?w࠳Ag܁}^ vAg܁s:t8;p?wOaܙM>7|n?w࠳Ag܁s:t8;p?w࠳Ag\࠳.pNa\࠳&7I|n?x)fa sAg\&qLsAg\࠳.p?8 tσ]S:sw t:sIɛsAg\࠳.p?8 t:s?8:sw sf\࠳.p?8 2 >7|n?8˫`r8vp?߸& s?8Ag\|s]3! $>n|ss{29t t t tCp?Ag|ހsss=s8;p?w࠳Ag܁w;p?w࠳Ag܁y:`r8|.xܻLs:Ag܃so17:txs?w࠳Ag܁s렳Ag܁s:sf܁s'in09t8;p?w࠳Ag܁s >c܁s:t8;p?w࠳Assz%->ttZ$O[<}8pГs:tϣp?8o1쟛i}8?>*p?8 tsAg\࠳.p?8 t:=o:bxNaaNK裄b< &࠳Ag܃s:K࠳Ag܃9\(:m-8 tsu?w࠳Ao[dLo~nw8᷈$a܁w;p?w࠳;g";gnv.p?8 s>[ss&a\࠳.?s8-9\a\n7^o$E?8i$EI[sAg\࠳.p?x9an:s>>ȸ" t9v.?sAgN.-Ag\࠳.p?8 t:sAg\࠳.p?" t:pZs q/4sAg\࠳.p?8 t EH--?wR࠳.p?8K n8-p?KtZ p] sw~a݉9n-&o188i %y:!8I~Kt t o9a~M-9a~E?s:p]tẄ?";p?:ImqE?w࠳ntf܃w"/'a܁s8-9\a܁s8-}o?q6%s:t8;p?";p?"[s,7s:JosAg\࠳.p?:s9i[sAg\࠳.pл&(PsI܇I>t=8~}tuMtAg܃b8/>P8tG;7Ag7. :s܊ s)]Vy:st*888쟛Y7}a7Qϣk[oB==8{p?࠳Ps܊z{p?rᠳy:!8&T?7p?8 t:Ag:[}S7qK܇:]&q급Psw t:s~1q*Ag\࠳.p?ǭ.?sAz}Pa\n7s܊ s܊ PIf7t*It* t: :s;gnq* tq*2!q*9nBs܊ : :eq8VT?M.p?8VT?8 t:s܇ v.p?8&T?ܼ : :s܊ s܇ s+q*'Cs܄ r{8t::::q*VT?7p?7p?Maܜ}aΡ<s}I5쟇n7!8V4y9v'݇?Ag<s܊q.p?MC>au?M tq+QoB:u?9nB:Ag܃9nB=q+PM>a\࠳[QsAg7sX=q)Ag\࠳.p?8 tq+.p?ǭu?tAg7R+q* t: : :?wOWAg74q* t: z}W^R_K+I}E?+Ag;=d=:tT?6r_7y:h-z/9ZQCp?Gk$%+{l>1p?7p?7p?GkQ?7p?GkQ?GSQ?7q/2Ag<}-T t t n+C1na9h-z쟣.p?AgEs4=Z?7p?GkaAgEsss4Zt?7p?Gka܃ss t t tZt?GSaEs4W?࠳n࠳֢9::h-:쟣nO9Z::h*:쟣n࠳֢?W''''' ;gnn;绻T0go쟇'<Da77ۍId?z >[=)xu;d_o zfM"a[]!^m2y[Esi?z{yo  {|sDϣ (tϣ_Ief? =A&coy쟇࠳7$g醃&cꍾO&o:YD9*H}"ɛxH?%H?&oH?࠳su[E=xH?&H?&^-&&&~lO+<[w':$^s/`WuWH?V_=ӽID7L s 2yD9$V |R.ȰhKu?M>Ȱ{ѭLݻ#˒G.M>( >_ܜ|.[gW+J>O=|~OM"s:>t}8M"s?ǛDxa܇9*r?_0yi}w$r:&'r?L~#VsU77I|n>?:Dt=8"sI=EV?sUyb%;SL[Lmv;gߍb"I~ \4~y~Poyݥ'贠x*x2MwwƼtZǽ7Nv݁dA9.tץ貺~ץrN >t}8T-_NKiݹ躬P_[o!:^ .)~E/Sy4[]NѮF1݁򟾟>[^ s8-^Ƚ :g-- M[}w0 uRy~K {鷠XNK/p?ᴰAg܇s~ >i?eڊs:[s렳ntϭu?:Ag:[s?pZᠳntϭu?:Ag:[s렳ntϭu?:Ag:[s?o:Ag:[$O[f:[s렳.u?:Ag:[s렳ntuA[1[~Ŏi\Wߵ:Ag:">:--tu?pZ膃s?p]JNKqݓt-s=]ӟᠳAgts_N:ݥ躠 uKtpW=?A>p]?ᴰAg܇-_Nn8iA[1[ (~Ku>u^:-5t>/=8-{SMŽ[] _'[̟Ꝥӂ}&xsε׈N v8xI~-3Goɣ{4oAgqkGrUwfo~6跜=):~)ݟoI[?sN voaᠳ~Kܾs:oAg:>t}.쟛i9;p]SׅsӜ~ v3-ջ V)oa=Ys렳ntϭu?:Ag:쟛ii w}8[s렳ntϭu?:Ag\?~SE.Agᠳntϭu?:Ag\;{hݯ|8[s렳~cgXs렳ntϭ~3*P܇bAg\C%]^:sIPIe&Cf܌}hݣyz9 nB~4q{@Biބ~7#ɛͺwV7u/{Dy:[g>t}8yZT*ܹeyZXwuފ.e>C;WǛ{uAg nBgnEtϽ>mMZkQKބ݁c֬5xn88쟛K5x:Wz Z]TӃ7xqއn}h&3}8Gp?ᠳy :18࠳yoEsc}脹ycp?Ag<tcyzR ފm"8[s렳ntϭu?:Ag:[s렳ntϭu?:AgnBNtϭu?:~}u?:A}t'݇w]otϭu?:Ag:[s렳ntϭu?:~pxoBNފ="8[s렳n nEoއxoB? s(oBNѽ]3śeᠳAg܇s/އ1_ϛWV=̛й[QGsCtks:\ބmn|}諺ᠳAgOk&mMhoݣx+*AgAg?͍.>]}>S݃y&ىP/{D/oB#$CP/ӻx:ٹ]PSJPKhps8CNѕ}u?Ag<tcp?x:>TzAg<yއ}AgܾW9ÛPStAgܾWiЖ>AgTI܇ZXpz_|18࠳y :18࠳y̾W>4y:࠳y :18࠳y :r7x\>Tz&{D?Г-Ys렳ntϭu?:r7G7Gp?:~pg>~:[s렳nt%=V$MR_$%(A_1Z{yMcpoIfK$7Ok.Tܨ8wSF.%Xbư8Rh.TMŹs>5dSqnIͨ.X6bT{#[k:p?Pv_MŇ3gT|Rww_T?}ŝ+p?KKڕk=ucSܛ>;Ʀ;כkJw9nW\: uAg\cSGW5{W<{o%XR_}˳1:V[/VMᠳy :l* !6ᠳy9l :18ǂ"+l-O+;Ǧb1ZvX :18ǚKw3zgl?֢==WAg<[Ag<tcp?Ag<tcp?M`S1{[k7߰:Ag:[s렳}ŵZs렳ntϭu?:Ag:[s렳ntϭu?:Ag:I}E렳ntϭu?X~Mt7ck7p?ᠳeS{[_\Ag_b+&l*ݒp?fkko>ž-l*b} T[aSl-+Zl-[?#t [`S Z|8?h*&*sp?_b_l*>{>l* s?} ϶𗰯8Yw:w;%Xޟ̾bMݣ}E 6]./+]*W"D_˦ǸwTmd_qW,7}{uf_r+^%-J"v}O9,$Ag<tcp?Ag<tcp?Ag<h 6.JAg<ssMwy :&}ůtd_qTMUmϗ:18࠳y,ʦ[ᠳy :18࠳.cT\:Ag<tcp?Ag<tcp?Q$%+^ s렳y :18ʱn8࠳$:Ag<tc[Z}utcp?Ag\ࠃ[ʑqp⍴giӛiȟ1o-n[i9Ϩ*qlB/w@s~`Ɛ9yBt5g_2ƿnL9oqr`9o./hSX8`lμ\s /yUwB\s_+ѹoH69{P;n,ncNYS0dLۼTrZf7.2uŴ1)|kJSiؗE촟߽̩1-r1c_ڪ/,\HRҲ[6;crL iǗ eiÆ짖c"V.H1`ͲᑿOK!b#& c޲]U?uFyg,B}lo"M|9C]o2rha/{ulJd]U~ٱFF~Z>ɞ͖:B\/۴Hafwʲ[EƄ~=n_unrjݷ{f&\OvG2NmJwaؚ~&ؗ2km{Cg?7Xzy]PSOy8}9' w'.7{h7t;׺kjg;Ʀ wS+=2lɎۧ6,Ĕg-6v|p{pNJ=?^O>o!ӟhRn7dznf޻?=)uH7C~Z%_M_]Mm5"u}{Up$ucM/>Zҋ+f}?wx7v)~yK_UO-}vԉcڦQ=!Bgӟy#;js;}:SņR'Tzs'͘6' W"un] ,=>v-dzNK=$5?M>N/('7/|e7B'3 S m H'_Xg)/JJ)NJbOVHԟJEVB)/m~`jVx? S9*}.4L|UzCN*}Д S*}pӬvJ?;+|!uOX0uVf?ԟ٢>NV S7mo~ά4Lm>TfxwJt23ioh:dG'OdǭiZFo S*}p% S[oi~s}f?__w Sw^޻aCӵ SK&3\'05_grnqaj?]KGUۺsjd/ozaoǺdΙI ~3GJ8~Kl^w[ S]@w S7?+=/=.ܙ߭6G5ܫ6=6{ {4?r0U+_{\[;m325 XzkeaǣROo޻ yM{*1n 9gVH{\iq=ܡ)`/!أ{gjoiױpڏ  iC?`<7gCs%ˮ= g$gS,H 5UsdT `7tq{x[{~{ȝ1_Vx~1+<}+RVֵW!+uCm{\/;q.GVِ{Q@fǡcf+z_f`{֝9{Y1,HzDl٘7{S7&(_E$Zvhi}ZY"rGأւ"= *üU"k=^*e!rE,{;shn٣e}G1ǦYxi2w=V~r?eg{4}oo 1c.أcnRU\G"}=.}m=9 Zuw[Ԯ]=tn:7uѱqqhewK²ǡOreѤFMi!=ު)۲GFn u_nLz|)whqνm =bev_}q]WˇCZY, sACaGZr ~_z²Gz.;-{<@N7\e7'/msf[xᶯLQᕩ-{-z2|4GcI{I='R cԧc̿j?f.R4HJ*QNO"7W. .rQdRtiR(JT3uBk߯}oeZ:xz>_n=&J<ʍ>-ݘ{13p5g|ܣ&[c\z;q\+o GnsǤ>n\=zm ܣ{-7Wגcq*+3#u%WèĔ #1g{ZvTKkJ paYӽ[rݭ=z6ǁ{,ߌs<Cwp\@pHM=㾒a|=vnj [{~"\=&} gـ{茩!7ߐ{G ss!tsO/鐷?yF W{<: q-cǽD{^<瞻DT{d&Rǂ{T$ۮtS28x8{v5r:< cα R#)*Y"ǢWɀC!O'{+-'C){lď){hIKd{Ss J3U0 cKs'd'T08 _o3:y{DėyQbEcr)(c{K\ytIn{nMp)~~Jǂ{XKlCGyǕ۾#ܣF`աahp? k>[N82Op{0rH`p`ypOo{0K~s]=cOf*>YoW p9{03܃q%==7nx8pm8.h}`߸܃=ŀ{2܃qMa4v=;4^rpvV =/`3܃qtp}={8ܵ={끵M=;d`<17܃{=[܃5m{0>%Z؁{0 6`lq~#s Oހ{0~6/{0ޔ[xap3S=y`+nppK=P`{9^c1~>sEjsJsߊ0sB=c1! HR(VbQts&{${D0x>`k`nA0𾹁`Q\C05`*`~i#qǫ)r1F;]=iyP=><$=˹zP{Jɹuɓs|9XpJ=B]#osrpF=n ;/W-$e9䊜{'.p}r;09\l*騟;#ܹ,!J>\"xw.[ s95Pܹޥs?Gqbu#Ÿ,ebL8ŝо(\9;WVw.֝(\#sq&xܹTnqb2ǝN<\Q;E}/w.MK;--Jܹ,*Vw.'[ܹ$sp$s lAp碈&su'sa <eD}8KE;꧛ \| s %b/KE;琼sʖw.'˖ByrdiybQ"\.;WeΥL޹5坋(\I;ſ(\J; si&; Q޹8Q޹+;6ys%ƝK Q޹(Ey(\n ۹Kn;@gpܹ̫K7#efb^soٹkv.8iv.'4;-gefӹi?{ vHn==‘O94}mPe}:sm)u=ƴۨ` =B*T}a/qp^} bYnN流}H&Cu"GF 4JQ{>m~#FpC'`g=;-'}C({ãH"o=nBf§8(xm7p=/N!;};YGG${G'=vO^LgrmpCԽDL=\&j7ѩO!Npcj$p#YbY=JK-#ޡ [$5C=Dm{̴I{If{hI`{$D$N=dE{dKweUч7 fșg p% b&00CHF$H4dI*ܽ٫9r!'#ؽ.oS ީ<Ԯo8cҵC7-:uC/01Cxߗ9qC/m<#Co41ѡߓ644Ț>xqpL|QtW {Xpԁ|pǕ|&L kimX=ӆ=O:0|###=ܣܣ#c1Ș{d=2saa{aa{aa{aa{aa{aa{aa{aa{aa{aa{a1Ș{d=2sG#c1Ș{d=2sGܣܣܣܣܣܣܣܣܣܣܣܣܣܣܣܣܣGs>}={1a#a0H{$= sG#a0H{$=-----------------{ b1 ##=ݾG}}}}}þaða0{= }þaða0{= }þaða0{= }þaða0{d{d{d{d{d{d{d{d{d{d{d{d{d{d{d{d{d{d{taߣþG}=:{tǾG}{þG/C>a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#a#aߣžG}-=Z{hbߣžG;1ݹtsɸsɸs1ܹ\ w.;Ýpbs1ܹ\ w.;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;Ýpbs1ܹ\ w.;Ýpbs1ܹ\2\2\2\2\2\2\2\2\2\2\2\2\2\2\2\2\2\2\:ܹtspΥÝK;w.\sΥ;\ǧw.=ܹpÝKw.=ܹpÝKw.=ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹ$ܹsiqΥŝK;w.-\Zܹsy=2=2=2= |C!Ða0{= |CGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA!Ða0{= |C!Ða0{= =:{t!ߣCG|}{CGC-{!ߣ|=z!ߣ|=zHHHHHHHHHHHHHHHh"ߣEG|-=Z{h11!v5555rM \SC!Ԑkj55rM \ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\ӂ\SC!Ԑkj55rM \SC!Ԑkj55rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM3rM;v5k!״Ci\rM5#״\rMǧ=kCi=kCi=&&&&&&&&&&&&&&&䚶5mk"״Ei\-rM[䚶5y\:dddd\ }.>Cbs1\ }.>Cbs)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s)s1\ }.>Cbs1\ }.>C%%%%%%%%%%%%%%%%%%ϥCK>}.\:tsҡϥCK>>\sϥ>\ǧ}.=$$$$$$$$$$$$$$$$$$$$$$$siҢϥEK>}.-\Zsyzl;v5zl =[Cck5zl =[Cck5zl =[Cck5zl =[Cck5zl =[Cck5fffffffffffffffvcۡǶCm=zl;vcۡǶCm=zl;cGm=}cGm==;O{lzlzlzlzlzlzlzlzlzlzlzlzl[ضmcۢǶEm=-zl[ضmcۢǶEm=-zl[v=Dȝ"*ɭ`L=QQҫ=+gu*]l$W]rR*t)WK=Y9{r{]9=F=[9{>r~r ʃ *v/,W.^D\Խ ~_w4{WYPw4{wYX{E4{OYT{4{oY\uWߓ%5{YJ$4{?YZe48=YYN5x@YA<}C܇J<}܇*<}#Gj<}LQdv-k1u&t_{P`ne &w{2E}w_`@ fw4hn5XEP C;p KH G{h OX >~@q| |GݏIr*h1crw?.?'4 >~R~O|gș|HϹ4y9[/_s4E9W/_ker_q"kp{\Wݯʅ|\ݯ|Doߔj-[3 ~[~w/4]DߓK5}\? k?\?$Wi?/rJsM4C^?4?F OF?jM?rN?[4(zZn*w3gҶrf̚*GGir,گ=vg\9{v9sh=^9{.rnzg\{}rQhbtrq:r X%ʥKccqqTe3˺g+s/U.^^\P9=^_\ѽT{%}reJ*UtZUܫkʉF5k[k'fl35MpL재6))\<}.t+4&x`] >DWjՕat&xp] >BWkG M(Q: >ZWoǸ5cu&}u&x8] >^i'Ouu&x$] >Y?Oq4SݧMFM4i:~ >]7ngM3u&#t&x,\<}~ >Gu7[4u&xݪ ^P/r_[76M'Mꗛ??/ܿ%K+MRcS}~ ^\wnWЯ5+WכUMj&xVW&xZN}w_67nMF{׺G7gW}ov߬msNoqߢ4[ݷM6m: u&غ[ݿ &wM&w&ع;= fwփMn]]KU_{}RTD:)E D A lnsq}ܽ|}̚af_C€BLFNx1$ /7c;{+1#՘ZLWt5:A$ ZtmC% zt}°n@7$ӍƄ7c ݔVL7ގtKnE&6t[ȘnG'tGDw&.tWؘFw'tOE&L>t_;1ݏOx7 z0abL&0z8A$LQh1=K0 Sbz=05'x̉wshxW0'̋hx_Z , hPZ$>,hXZ">,OKhT Z&>,ˡh\Z!>V/+hR Z%VhZZ#֌okhVZ'֍h^ l6h8 )4m6"VD[ZVhHl}}4vF[^DAGDT6h8OOmSTRvh8qjA;4vD;iv  % hWkQnh8qfAFg'3&33qvA{F{9s /#q^AC yqAA_@_ "b\XЁ//E}}9.&++qqA_E_KZ\RA蠸ǥ:t(:4.'0tX\^77 W-ooǕ:Wt$:2&(tT\]踆c1qMAǢcZCŵ:}}/n DtbPI褸ǍNATfNAN[: #tG.G~~'I=xVs(K]!t%R ''??%E WW񒤿%]"UIDI ]%I]-^t F t-V tN t=^ tA!FtxSM&񖤛mI[pI[IHI(Iw;hIw;IwXIw8I{xI{I;Gw%=Iz=(&Jz=$&Iz=,ޗzDL(zT| 1Pq1E 1UғI1MS)1]ig3cIϢg'CωO%=3$^Iz(fJz $fIz,> zE̖*zȖzM̕:z]̓zC̗&zS,zK,6z[,zG|!]R{=kI7>DŒFr1$\˂ryPJ~huyM^5z&ZSBkɛhmy+X#ou`=֗ ~!P>6Bɇhc)m"m6f85xIB*E[-VJEAVGGS5ZzEC>>.(LhL2mѶ2OOɔCTGԊv@;4vD;ʴvB;tvF;vA vEʌvCLvG̊>>-(!*)) ̮h/̡ho̩h̥h_̭h?̣2ϡ|G>>/ (: *,苲с//ɢ,) ,諲ɒBR.K+:,(:"*:*): &+蛲ooJ-++:.(:!*:)): %+:-k(:#k*:+k):'k+:/(: *軲ND'ʆNB'F/+:,(l臲S)Sѩi鲕GX>''ΐ+|BљLFY,˶Fg˧ΑΕΓΗ].].].]BvUKKMѯЯdwEFO+ btEKd/EKeoEdEe_EC&9:z]SzCW&zS.PzK.T6z[.RzG~]R{=kE7>DŊFj1$ZP˂jyPJ}ԨV jAZcСNzԫD4QL&Q?I/dh2k09\LPS)Th*g05Z AӨhZ&Mӣպ`4Z̈fTLjc03Ym fAhV% ͦն`4̉T;\jg07[ Ah^'ͧվ`,TB`0ZX AhQu$X -ձ` :,T'Rd4ZZ A˨hYu&X-ˣչ`:VTJb2ZY] VAhUu%X յ` T7Zf6Z[ Ah]u'Xս`l6TFa1XE6AMMUi36GԐ@[G[-ִJMAQVGGӴ5ZyMCS>>hJiJ*mѶ*OOC۩TG۫Ԛv@;4vD;vB;tvF;vA vEvCLvG̚>>hji ʮi/ʡioʩiʥi_ʭi?ʣ\^y  хE__~~iiMAQ=4].V=5V=tRt2trtwwߣ߫g5A=菪+yMW+MBR/h3zQ__@MEU/izY+^OOUjuMנk`MעkMסPMף0M7nD775݄nRoiݬt E t+UtMt;]tCt'StKt7[tGt/WMtO~tzWуjCj}MGdMGC5=WS4=PS5=T4=R5=Viz=>,zV}9Ty5C ыjKjsMWlMWM\M>gho󺀡//B :.j˺↾K.i t.e뺴C!Cѡaoo +dۺẊ##ёQѺc1cѱq񺎡 zn`Dtnh$tndɺ覆~~::[: [:[~Џя~~[)~ ' m O9nklt~9й\y<|ЅBE"//tWCD Jw7kkߠ.F랆~~1t D2t)T6tL1t9\5;;3GG +ѕz?? Yh//z MlC@Я'~U*=jk5zkѵzuzz C7nB7 ݌noݢݪG ݦGݮGݡGݩ ݥݭMmV?a4YL5ktfm0=ެ f@3hF! d63ͦ`4̊f5[lfk0;l @shN# evsͮ`4̋5{|fo0? @ hAs X-d ͡`9,5Gbh8Z @KhIs"X -eNKͩ`9,5grlZ 6@hC mdMdiI)Ė6Cais@[eiK%N i+1>>bgik>>f-}}$ 6h''MrKۢmM KB2)-m3,m7-v0i,v4i-v2,v6-v1,v5-v3,v7-}}dd'd^h/ho>hҾh_~h?ggM^KC3,7-}}t:SMaKMK_B_2E-}}SWWM K_C_3%-2,}}ݔt0:ؔt:Ĕt(:Ԕt:̔ S77MEKB2,}}Tt8:Tt:Tt$:Tt:Tt4:԰t :Դt,:Բt:Զt< jk5fkѵfuff K7͛nB7,݌n6o[b[jFX fFZnFYaF[iX eZmYc[k&Xgޱt?߼ky҃A3C!3aG#fGѣK̇G)@ODOiBO閞FO,=1[z=k>z|jyaҋE3K%3eW+fWѫfkff7f7ћf[ffw; Kw͗C,7_[}`!,46&%Ҡ@]˃ UF>hPcZuvEУޮ &`49Mj &C_` 4=MiBS?vU0 ƮE5th:6Mo3`F4̄fvS0 nfE-lh65ns9`N4̅;vW0E=|h>7o `A=,PZE#bh1{4X-nK%`I=,'T ZƞE3rh9{6X-o+`EVR Z^VE+jh5{5Xnk5`Mֲ7V:Ȗr% KmiGmGClYGCm9GlyG@߰}}Vt--[ѷѷmeGmGG#lUGG#m5GGluGGm GǠclMGǢcm-GǡlmGǣmG'l]GA߱}}w==щDI$mcG'mG?@?M6st :6wt*:նpt:Ͷtt::ݶr##GĶvSS3qG?C?O8:i8: etssls9sѹy  хE__خ~~i9iGA=].=>tRt2trtwwߣg>菶+yGW+GB/83}__@GE/9}+a_uOOUvuGנk`GעkGסPGף0G7nD77݄no9lvt wt+Վpt͎tt;ݎrtÎvt'ӎqtˎut7ێstǎwt/NptϾ~t}уvCv}GGdGGC=S=S===9z=c?v,z~9y; ыvKvsGWlGWG\G>RzmRymR{xz y{2x2z 2y2{4iiO33.^..}>.}Ѿ.~.ϢϺ>>y{<+t+ //žD"z2+++Jz:Jy:+`t+t+Pt+0t+oo*y6pttHt(thttXt8txtt;;x:z: y>kdtkfNANENCNGV~~cc֞~~t:=gg Og3]Ogܓ~~z:t:ǵt.:׵t:ut>:utut!utzMS)i3gѳOϡܧGϻ^@/<^t3=^r<^v{zf{zxz zzyz{zxz zzyz.z}=}ObO#o h_/ TeAJ>]"mǏ>>>I"}}'Mm6>Y"}}'OmѶ>E"} }ʧLv>U"miOH;}D %hg>vA(aߝMqD?B?"{OO^Gt:Û~~mDg3,t'Ft6:'tOѹ\,y>yD}.@]."]SG &__ ʧ>}DA"]3F[[)K%>sDK}.C]."}sFGG++>wDW+}Fgg/oo`DG"/??}BW]"]Gt-֗:t/z_* tD7}nB7݌n"Gt+W6tv_);rDw;}Bwݍ"Gt/׈>t~_+vD}B="z=G(z71oq('qDO'}BO="z=G,zַ9oy* ^D/G#z [G2z?+xDW^m"z oћMTDo|Fo"z;Fzw}%чkDĮQ- hBbhtD*{DT2gDFub$Emb:%G}b&F4 $&E&h24YM&Oh"MbDSF45:񥈦A$ѴhW"MjDӣ_h4'?!pYgY>?ƿkOz+.\վ+o9I"}2+90(]ʝ2ZpkWr2+z/G [ܞd8v\A"D5oO%n | Mǖ5 =~nH<{=u*?翶߮2ۗ3_ Ouu5,vRajL aKa LX_:g0X2 |1߯ҿ}?

ps٠/}02O_s͕fs3rTjOknb˲]暘cޗK/"kݘ'byԆȱ앶a Y_|ki*|sṣG}lbIKm[i8Qcӿܢ|W!1 m Rt hg Ty؍HQ2Pĺ'S&i"jbW2T2W"2"CT~[E̙ﺞu==X+U1uwkⅧ*\S<\fU n0;*5U)j om 1|x`w|`)xSm}MUŏl[?  ςs}U3fAN)X\Oo~/lV~apٳjyK$x;p;̳-MP1( >7T5~bD`w?V< ^3;k~/{#wrM ,LΟT>n.>{Әd))>1횔lVbx'{K'_I"e؛g1{-\.N~MG fW7(Vr=em . z hS/.]>h<2}uSxFrыG o۴}> NpJ`>:X^~ph࿧NF> ~ʍчO׿鋀Ozo[8Xw~#x$8WB}GZm}s,൫1w }>2% o_6){p\mڙ.ïL`|0񣏼i/}Ќ[,|Q|[d`=S7op;'e7a)> *xR mmL\U\yVi;D~e*aK17$+(q[L}hR3;}w %6/@V<+_g?bvN|b<\rQa?\{}bKJ COW O'X9U -9p\pbB)Ӫn6|vor:3{>+v7 -^X_.xe.[_z6\z\vnWpWpzS >2 .yUjNh!_T1.&~qT`kͳ yxsH~mpaqQpaCc]+׀ͭVݺ…y*tk'wkT,i:eepIpo >t|ݷ.^ZhIc~x7z=|!r# [ϴOj?P,>&^p桿* z?hzw?ToQpEL=w4 qC_ .S}4:;}w'*d6Яg/Z/8|eo> TeV |TwG듛Wxa<|p JqgJS~s';Xa}F\%#~[ؼr?ʾ{~lKr/rUglp &?ƭ~$iqf^lŝ5pwp=xm^߲,[gF0y^gߊ-] M18 olXn5U|.`-7yaRp[pmvꖛ<xn ~䇟 7pO>uK{<&}]\}~ \}NfMx]ҶNu>n>۲gs6m.߳޾u݂M6y+[p-0Wwv(6jV&.8CW+̳`-YyM# >۱ d~cMC<vrbM)UYPl;mM^P+ˋߵ1so6ro}R[iF_{36k[5,[[46y-qqE+XnA2k&/>`{g7M|>xU#o׍yr ^>^m=ݦ-M8GV_]ɛm& L۴S{M D|Bml s`n̰ErrgUT&.~Ş+߂q7_6&-n[&*.c]\aM~x9t&N{|r?6{wM | [.sײŰ'ۂ|M;HU[ >#d1]?G|;,x3ywGr3Sg13"oj߈2pۛKKn_d>!`Ĝw'Gg,s¼ `m$}3!}}_}>|}^Uv&'Ozzor5W z\2㼽ZQj6&q6NnYV&76}8}I%lS`k8>6o)w| xõ$m7lWc7.su}H}t@Wudp1y&&nξ2ol]lǾxEΧsZl ζa_^,6ms}? > n}~3#&on!itV`L6"1We& ~ɜi_So_.g0/ll`ވ~]7 v43|ӗmKy^N#5`{o(ΞX5~M~ | ɇ{a{v:6pM_װ/ۃ_}^1ltsnsntn1s_]^{pi08w97y&ssssss0x Cǰ˹sssg1>śǹ˹ɷׂչǹ˹kcss_ V=^ 6y0%E˹ KbgasWs/ۜ|-俁{| v979w$qr~?%>_=]ML{/0z+]~{[l`u Irnb睱ǟ.߀M><}~?8w9y}Z0+cߋMΝ^̭^{MU뿃Wc&5ɹ͹gǹ-6yA1:8wy=lG`.|3˿& ~o+Ǐbs/sss&J\ 4xnrn<`w˳ɿss߆]e1Ek?{=6Wf^D0C$w?x C)bh`w Pig 5 [D:gB>isQmYpr0&e'g+qAG͉1 -%+K+~-jHyI_=u(IODZCMKJ*GvuO%Ngِv1'asۤ)Q:.4|ɶfh@.uphmɃWo+*^ 5&[gXY)d֐լ{2Q51~*d[{_Lwe%\{+rnRb~?o]MΝν |/x/rn)f097:W.>$>.>[˿&V.& ̭{&v97F`nuc_s߉=]!f0z],w9799yۜ|$8w9790:z qr~?onVO`s&Vo=i]~6%0:M^{|4v97yq0:zρ/o]M~=΍翋W`.&_.V{;}{|#6y{`[ǹ˳+s?=>_st˹'c.>ҹ͹ѯ&6F> {}ճ.ߊM^,Nr~3?&.>N^>=m`U9asssss]}W}=!v99w::Eg`Cヱ˹ρ׹ϧbs&6>m]"S`nsns`soUss[;{݂ǹѹπ_.vN_}~{06q_b7.9)8wy?l`uqͰɹ͹ѹ_.Mo0:s.MΝ>[<8w2l<~~{v䙜_]xI㣰`/9x促/[a& ^[8w97Iz197:7y'`nuq1s?];2x8S,wysliAñ?ލ=΍M/a./Mm|;=O_.p'097:^%y1yɅ]5AϫsۺKh7?Rӭ/6[^(֎mmCU3Kv2%}~V}>412w>>/UugZD"x]aq&b,t\3yx^k}>|{E| ]-˖6/okD鶈y,jp麌ڣ_ɛ[D V}jy 799whym^ 7y{p!e?uЩhWXN^ 7y`n'gL=`.~ެ$n]/t_W3Seh V4c/6\`.uM6NmF*`.w:k&/r7n ~?&>x(6g`. kyS0}.2 ~?V?a}~}~ n<^ 7`.t]-~3#]躔D^ 6yU0}~?oӰMn]7l[6:ہg}/oiO`.盗>hp ~T``=[hmMNIKëǛX~3?[3Zϫd%.'pw>hnb-Jo6M`.[q2_}V :.Że'6e?%6CC:PlS>}Nɍ yB}>B;5hOs81rdA(.o_-&J]ƽ2ײU?^ky 0}sZc> .e=K͉oioT٠69:.g&>M7qOsXz-u `$'j`.뼕M/yT36yO0}ne7*M>LcpKðR_4Z& L߅9oU"8M2KU9Fx 8OfRPR{O 0}wgV3Z& ܛ[^ 7 6`.K06bu|6C3l`. o1OM~ Lߥ7n D>OdD>7dssN]bIGj#ϷPƬ&?KtLDG$F&>}^.jxW.wk25.]>wţZ@|8VvkoM.+Kٷui[?_n}W]nmSxۤ}>-Qm }.0t϶6Iϻ~zMV\d;k~=`:~޴nx4&qV|1S]G7y2c7*h_}o`:ϋ韗7VO&/::tZ>%}mry:ϱ}oś)0:낣N||Fjx̭~zm=x;~q?Nu][}=.V>w& }hc;s~?k&o򬍛GOwϫusq{|M>oDy0}<~W=.}kۦM}7yY0:'$]G\Gxm6;o15fz-V[ɞ/]㭎}}N"g60t Osu m&[WV$MN2[~jxoG sm/~~c]>hG+0:0=}Nn}z>w>v`ox]oru&'[Y^.MVSkMV[qwIsoMpx]7㭾d`=wH'v1. .q#tږ\;mx,q9YY|>7+y2 ͵w*;e'ko>WR|0?;}>|:5>+N>~[<79B`:?+N 0t篵Lʹ<79`nu_?̭Nh!M^ CUNM&#~nx_[ȧ9<t$>> T|n&z797tx/MNLg=zAN~E[w񋎛`nu~?o&$:!Gs?}q?'~iGe0t~?)MNLކ'79`nuCeZ&o>韏A::ϻW߳q?~T[}Ϫ}:#`nSdxv9nr=to*Ý&N79`nu'oqOwNs}N'-WϜ[Lht;>;o)[lb?%>_uq3-χyJ~K?[iqa9-;-cŇ]9-,u?![p"%8v]^i&N|s/ߒ]'8\ŭi~/8:~\IˁC'rZ?*2I{oI~?i.3]zcoi + 4t~? \9=LN )g-N|':zm#]~[|1y".0tft~?.[[N\K}"{gA uY7u-?o9ݦr캴:J9 j9䷁?oک! xB}촜AV/?:7yQpT"Qr]{A&^!ץ߸y:~Lei (^\a_XNrMr]̦grZumC?XN Pq:A9-p7w-Oy[0t瓊TtO~٧+ zoiߒC wR_JSv}~[]?[΂oy\7@~Ko;[i!O-.[\srZu~[\d>.%7x9NO2YL|ZH-??<{-ϏcғANnYi::Ӈ$c:yA?0]G*hb8v]vޒtB[ȍThM촐cs#`:tN? N,~=%3\&Nt˧-Ntt韟X5%r_u>A> Lׅηi!񉧃N| zɔ9 R~vt5t韟9/麴O-6[UM߇>L}͸}A=z}͸nB`q:}1?3PCtzIoBM߇>4tMhwa1߬е୺Mh-1ϯku+ZA:stOy% -^,zۗMhpE݊ps~Q>w&8:soB'[QqGg>U ]^*7MunE.]fZ>+:c:ϱ݇&{}j6&t:x]LU݇}+;:G>{߯еOyIp|+=<t:]A^L}hHF>4>#uAN.[Qy}h߇'NLKY!t[!9 =^[QlANN Nt罒";=r㑃^#u3C#t`GC}}ϸ _97V{4rGC}|J^PA&NtnuA6tyt+LX7VR/=tnEM o+ &;׭S|݄~Nэ<t~?o S:}hc ݄/ԭ(C7(N=p݇b{:Wԭ.=t~?Ntwum'[]>?`:]RթPqoM%p q*x+#]݄N߇P߇}6S伺0P݇,sCg>t|Cݹ}h?N{4N#t+t` N7㑃N|=:sqPMt=n?N7,u\7N;=^"N| :s:`:~~H N2:sAL9x?B>M(yxm:sN{7<ÑN;0t㑃N0NP߇{}:9:y5}~?: --tnZ:[t鷬A;:9:y߁ ttй?"A|:8:ݩ|M}Td3?\MŻCZ| RMŷZ\toVSz?AMŇߋs_PS1h7Wtt_}0UuPSAT<%~tSAMeZ1ٯ0t~?߿in0t7o.x|Ic٦at_e]W,X/bpig}z:ϓj->Kްt^*N:0t+T,N=j*?ly:GOxg%C:蟥!ѩb7ϩXdʍI5 wao:oAYn5s8k5Sk1x0+ǥ!sbZc^A&'AWt :s3(wHk?r:_N 9j*WkqK+toK#B}ŇOG>+.x"rйɗ頷I#}^9t]:9䯃˫ֲ}Nqt~?/:;"|!"[8qA>OOn}A>2wms ^֢&rйUk҉}]5m:7<0S}E]ME6'AxZYj*7Uk1_<t~?b5Iہi<丯X~o MM]Nj-6 2j*> e6j*[[6oRSO_\~O ?߬_;u T<^'W}EGasFMŏ~qs??N|ҮfwpfIJG:soT:N|:JI5_Aʒ!t;t_%B:N|Uep5?bHKt響N7tAnѐ:`:[NmF_}`:6tkt韯p}Hz0t͟*RSi0t/A!zT_f-tw5&r?N†!tgZUaoA|!tA+Z:<7Ri!A>ߊMN|:Jlr:'g979t`:tй?WsAWk;t?t?t?t?>w۰頫K&ϝ羂XwꟇt?頫AWwyܩ頫頫頫頫頫頫靫z>w{:{:{zGwy{:{:{:{:%uIs~69tObsϝ޹z頫G+yRsG=c'?wt}N]sw@I:'頫}>OsG]sG]sG=t?頫AWԪn蠫n蠫^u?aAWuoN݄z=ty?S7^sO]sO]sފz=t}!qIq:{:{:^sG]sG]sG]s7I<"uzC MX&n 5:::&Ԩ[Q.yI:'頫ΛP9oE аF>4 ?D>4 ?s#V4T ?XsO]sފ>4yrMhT7Fsފy頫ΛP9oB5>4l ?tϣy䠫9G\AWfMF_dMF_fmW9(9VsJ|&T}Eyl-kAWńI:ꟳ2>+<WO5WE9^E1:ꟳ2N?g_ѩ-=.;I]$tAW|tAWdWwy'靫+Gwyꟳl*ꟳΦb<:ꟳTA+ꟳh?gkѨΦbyl-T4ꟳh?wt?gk1TAWPsG]sG]s6CZ ?wt?gk1TAWAWAW}PsG]sG]sG]sCT ?gk1TMEW}E9[l*;:;:ꟳΦb;W}E9[l*ꟳ蠫b;WLD&}">Qs#Vm>ޤ}2n6[EVd>O|DM"yyԛD }.zȩp}n2-ך7fԛD^sT}k_s6y[E^sC]s\Roy&m}pz'} L]tV?z("kI>M^#VQoϓt?DFdstDD&Y7ճSo:MPsU7BVQM>0VQ9$"G}"yWԛD^sUۦ'syM˦*ꟛxJU?7t?7Volwyꟛz-V[IM"'}"ML]sSWVo0mUnpEmj7|OO'ꟛϵɿHU?7&ozȫn蠫ηy㩷zD^so驷&?+$ꟛx7KI?7VSiMV[]o.&gק$ꟛx/X> ]|D^s3RL]sNj}"9$"y"2`M"yBz'}\|G}"ykqى[k> .}><&QRڧvcs n}>BD?)෵oHIn頫n頫n頫7B#VoPsK]sU^;=[Som'M~)VQAWoM"yS7xwOIn蠫7B t t+SoPsIn蠫k(2&Qy::MPsC]sIηB]>wԛD|(ToꟛGg蠫ηٌ|(TAWܜ&9$ ?[E|(TA~Ȫl[\\ F̞bbGs޹0{~[]캬8[S[rO3iagho12Q|rK=̲i]KrZY]BհSǮKX:-[:[:[ W벸UQ0oC]sSI {iag#1{t?O~?i.s]zoi 9=rt?wo)a~-,2݉w䴼n'SnY' xoL]󨫨y䠫9G瑃ߢ2t-m췼϶<1.l+iQAWAW¶b촐頫nwiyEv\i!AWoQoQAW~)ׅ=E:-uN綇ɉ6otZ?t?ק %b9-w頫ni.[[r-.l+AWR`.[:ua[1[փrM;-uiu2]mt]?;4o_hs`:[:u`[;-E亴/]!ץ߸Y:[:iagxqهma9-7uaO39- p ,šurZnuQiQAWAW~٧+ CN ۊr{B6[2y贼anr]4R T|5tZ?7)nv-oko ~G~ԙc9-i~7kn#@N no1~Շžh-,raހď[΃WDlr䯉2岷[?XsKE?[?ž"tmtNoag疮.vZcׅ=E:[.GQoQs;-)oQ~˳Z:-[:[:[:[:[.[:[:ꟻiin(nuӢӢ~?%3\&Nt?ž"t-t-t-]-t-]}촐׈AWAWAW~};[:[:[:[.oylTW4}P2t}}C>>g܇> }6}hꟻmcOd|z|o>ܧUnBf݄oխ(#oBkQ~݄N_[Ѳ t?t?KtZX-}Co9YMhq0tM|: ߊ=":ꟛ>M2R1#jпt+:t2J]t?wt?wt۠wpUu\NϷl蠫nF>ݯеK]sߊy>K]AW<`:[:u+m1K]snE8d7&0t-tDt?_-aK&L]s߄":{uw݄3C-t-tm}͸+,tm=݊=l݄vߪ[њS٭ Q}o頫n/>AW6ԭ(#CkuN&ӭ(#m[QGD]s[I;̴uJoE/AW^ҭ(#I7t?twVti)nBAWAWAWAWТ9 -^[QGtnB[QGD]s_|綢nEvo頫n頫n&oM}t?t?6݄^wԾWu+@z綺CwAW=;E>3ym/݇ ~[|hnB'CM|Z<[\&nBsCM}CzɩPr^݇~\J}()Е~N\}(L>4߇nn>K߇t?蠫AW#{Dt?蠫9ꟻbGD]瑃kPGD]sW>}AW4 蠫AW',t-tm|?l頫n頫n頫n頫c/u}EWt}EWq_q^5חkǫئ6n*f]!j-Wx]Uj-.[:}_UJN7X=?9~d/Gft_}0UtPSAT<%~tWAMeZ1ۯ0t]35w頫.x|Icۦat_dMW,X-bpig}Z:j->KAWK}d OY{tEwߺ{g8ī@zojx܍ϤOܽ|Fz w_vܩ

N=1/4wկu\s%<٥J3GQeǻ A K{M;ol0pDQS7ìSB3zm5iz3vP/҇TO盷z1_F <ڶዚemf'̶jeVG5R:\mj|܁lfi=ڱ搋Fu˕e6ZP6b84NUDDsw9cNW9L?c8]n8c*:]m}}tljv&TrD68]#E}kw {XN93C|k:v:o9]x*gcmǻLy<\{;^G-GS6ǗcKyY.ṷg2`Z_bJ7?N>1`ӯi8Gȱ|t /֨×:N1jqz3q{4͌\{k6т{dd];s`;ye13YE1أ@9c_8G ]!8G͹)Wq`:;~qq`M{}cr` #V3Op` ";}s`GL+Oq`vfW'r`}-j\?3{=o^t{6l 0*aYtbs{4ansq졕jÁ={y~l66K5c}vC7'Ɓ=B+7Ɂ=6|*lۙ{|=YGCqg\Z3{}R{|ā=jT[Rs`n]1` +c%G[NGDzky5;Nj=DzVx<ݣI أ˧~ ؃S*ǝwG-lUG ! c|Z<228Е22`=Uܶ19X"ן{6!/=9f8ձ(_]7"챻{>?OGML1|{,۶`U y`V}=ͮy{x1Ö+A']T+k76clf_z)_|G<ٷ=.FY3أ_k&2%Ċ8`tϳX8NJ9 ϐ]<廾"#:"-%#b=r &$V&{Lb=Odg挏(!^5cpDK,DtX`( FIdu& 9c]{sS Ǒ;>6c GzQ}{>c-;m GK~ c)`Ǧ2c=z{P&'#:hv GHKVx4Ǻ{u1'XUb=zzJ1Y}~`|=&s?]ón񬫏ϵeOYj=/TI+X{WxHG! ɕG%{؍E7}o+{?[{S+ 8G7iӍ{?;;^ɕK${Ou{-qeKǺv^'I8 6̔%{z6}d[m2/6<}nvsn=kIOL`2Ke{%j&cf9M`Yf&GjM`UB˚FUL`'EZh&GCmͽM`v0Ǿe{|\0 Q$C3>Y=أN故uL`iZ{`&GL3) |fn{,U\Q?7=|AafόM`]e#i6קNm{|Czs=&_Չ=nuy36=T&cY~*|Y=1w;щ{U{DT;ʁ=:.ʁ=ßexRp`S9:w}d&]y1%{tRCBGٿs8xўȦ~.vX"kddpQoI\êdnLGlH=OdkמiE =_򱲙fI!xҭUDQX`  QDuLs,NjxVb=nE Dԑ+{0=P>أ#b=&lc{Tc)X`}l̩=[H-O7I-Go{?qEc=1E,& {_(F,x %{|=b<${49 /b{T)ӔWM`aYWB?I\_?#x= K'c@>$4JǔE=ھnM,c/%{~WBGJv֬.٣|=({&+=b]Eu8džnl#|W=nK.BdG38ynoѩQ^PY%{[MDDzٟؼHX=vUvkd[< # v믌 pgIx1;0dLk .KH> d3yf7omFz-QgMfn챭uVto=v)s%V []`&}9Azy"Wd~Y-#${{ccTNX]y=:vißO{@54-ɟ3%{@Rd H/WK_%{@=uhP]'a${@#HK=d ~(:$ u${ȯc6P 'JRPPω*A5I=ڨdQK!ߦ%{@l!ꎶ)=Nmd%29=Sdds${@:~dOe&kO!${@]:dk/&=Izxj=^ԴdoN+,Ia%{ȏ/Li{@}q[P\~]ԡێH=>qd'7=d,Dԅ_h=^Ғ=.99d߆!ǻIZoEԻu!?g-\{PW1"غdaVc{Lw$X}i=6_Y}SVߣeMҭ uqV{xH͝7tQd;{h'RRQrS6j=(DGr{.I!7@"{:Z}խSaL[FG?V#y {,;Z}nj=VcCu{߱Z}mQqcLj=¢#X|{Z4Vߣ| JGz!{3S1g{{4}J-[GVñsn=.tw{<_]{Vc⭾G#<1oRcWޤG|I}|%*'=*WN{X]9qrRߣxGjI}NՒՒ{;[eּ:=fc{ L*ޚHmԬy'5Bݚn{\E=oIySQkΡ:Ԛݷ=é5{Tj{]@yeּm=CyKy)RkޣԚ)=v.Ly kޣΰ5ﱧHvÚ?a{Rذ=1yJּGɞe kޣٗ51pFa{/Yʰ=}+jX*0yFA9 k5HfXj{ ~ZRk豝Ԛ9j{P:Z- ּRkclrԚY*=fy[[ѭyq}VּǛ3tkޣEP9ݚ;f{4mf{D=ȷQּǧ:k#suk#*%514G2f{|YFfּG= gּǫm5ГYy2kc̚d =Ŭy*|f{ȷYv`ּ} =joؚnc`ޣtŭyƝ="w=&m6>0To`Áyy5N= { {|,>!05qOּG yբ=wL{X/jkƄǠM yބǹ yays=:=>ښXr-!0OB`ޣ`k㨨yNydM&{498i#uyޅ= %{x&{4Q2,iޣsXҼ갟?NmǪ2e0\^7|ohOk֞K}ukϥی8sn\Z{.&נ֞_GRkeIs9b!\멵,NjlRkesMjlZ{.C~֞˯R֞ˁ kϥ sa4 keQŰ\'mF=sɔaokX{.u1=+{֞ ǰ\>kX{.$aoݰ\`X{.巷0=K9 kϥojrT%sadX{.O1=XZ{.S7daj_F=gRkϥIs]#\f^sI4Z{.֞RAߥ[{.O֭=#Z֞KukKxhsiTV=ske=֞Rys\dx\KǬ= 0krs\ 1kmX{fxӇY{.(fĬ=so3ksibfメY{.ϭe֞ ٹ%$xG`۾=y;{. =sy4Rzˈg{.۞ . ̑sɝ3!O֞5Q[{.{._Em Kd'\.KLs$!OB`%ބ 2|_B`ű?!6&!RRB`>=`kek3֞K =ْ\VeKsə=iei=<9\Os)THs_!ieY{.?NmGʳؐd$c#x.Y4C}SF{l(EOS4m4ǜ #3D{4r] `AVZJh` 阜'f QySh`7= !gPh`<-2p4EE=opOh`lFţ= OkD{rf3zJF{Ϩ\&#eh`őfA=rfTܬQ' ڷqo Q^;H qEw#/0֮ #`h`O+Ԍ?¸0h`s&h`#h`QqS*F{7ڵT4Ǣɽgh`:~ 8mh`tj~E{B{ˎ9|N/$=9dGB2ߣ,2#,@5 {ݜe|βV/X'\SU.R1߳q*=gY[Dl2cup܉|.ؾ=& P%.Gt|j+?QdSk2c'ug` %-|[ºx"yt1tvO $75Ql{qI_EOwX瓚*Z|}@M{ci2cdG>6&=D]&=>6&=|KO5Rh%jӡY'{h:{:{AQ߃E}=({PAQ߃E}=({PAQ߃E}=({PAQ߃E}=({PAQ߃E}=({PAQCG}=tQCG}=tQCG}=tQCG}=tPCC} =4PCC} =4PCC} =4PCC} =4p=D}'{8QÁPQCE}=TPQCE}=TPQCE}=TPQÎv=aG};{QÎv=aG};{QÎaaa?g_gCC:Ѽ=t4AѼE{P4AѼE{P4AѼE{P4AѼE{h@0м= 4ay{h@0м= 4ay{h@0м= 4AѼE{P4AѼE{P4AѼE{P4AѼE:Ѽ=t4y{hCG:Ѽ=t4y{hCG:Ѽ=44y {hhCCм=44DN4DN4@x=hCE*PѼ=T4y{hCE*PѼ=T4y{hCE*PѼ=T4y{Ѽ{Ѽ{Ѽ{Ѽ{Ѽ'{ hhEG{.:shυ=\(shυ=\(shυ=\(s1О\ b=h@{.s1О\ b=h@{.s1О\ b=h@{.s1О\ b=hυ=\(shυ=\(shυ=\(shυ=\t碣=hEG{.:sў\t碣=hEG{.:sў\t碣= hhEC{.sО\4碡='sq='sq==sq=sq=sq=sq=sQў\T碢=hEE{.*sQў\T碢=hEE{.vbG{.vbG{.vbG{.vbG{.v=~=t|{PAQE{PAQE{PAQE0P= a|{(@0P= a|{(@0P= a|{(@0P= a|{(@{PAQE{PAQE{PAQE{P|{(CG:Q=t|{(CG:Q=t|{h(CCP=4| {8Q{8Pz(Á=(Á=(Á=(Á=(CE*PQ=T|{(CE*PQ=T|{Q{Q{Q{Q{QOY'5PrMukJQ)ERkJQ)ERkJQ)ERkj\S(@55PrM kj\S(@55PrM kj\S(@55PrM kj\S(@55P)ERkJQ)ERkJQ)ERkJQ)E(TG:5QrMuk\S(TG:5QrMuk\S(TG5PrM5k\S j(TCNkDNk@=k@k@k@k@k\S嚪(TE*5UQrMUk\S嚪(TE*5UQrM(ԎrM(ԎrM(ԎrM(ԎrM('{s=s=s=Ptυ{.s E\(B=Ptυ{.s E\(b{.b{.b{.b{.b{.b{.b{.b{.b{.b{.b{.B=Ptυ{.s E\(B=Ptυ{.s螋螋螋螋螋螋螋螋螋螋h螋h螋h螋h螋h螋sq{.Ntʼn8={.tEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\TtEE\螋s{.vtŎ=;bG\OY'c;c;:c;:c;:c;ݱ-Ewl)cK[Rtǖ;ݱ-Ewl)cK[Rtǖ;ݱ-Ewl)cK[Rtǖ;ݱ-Ewl)cK[Rtǖ;ݱ-Ewl)cK[Rtǖ;ݱ[ݱ[ݱ[ݱ[ݱ[ݱ[ݱ[ݱ[ ݱ[ ݱ[ ݱ[ ݱ[ ݱ[ ݱ[ ݱ[ ݱ['cDwl莭ݱu;Ntց:[c;*c;*c;*c;*c;*c;*ckGwl莭ݱ;vt֎[;ckGwl莭ݱ;vt֎[;ckGwl0t6 ݱ Cwl#2) Q){ڄ۔R OHM.<+5JԔS*RS OxZaROpiUL鄧SR OAxԌ3*fI9,5YgQJ*%Qj~sR /ZPxA`ER.I-,rYjE+R /\ZLx1‹+ץQnH-!rSjI%[RK /ܖZZxi2(w UZVxYr)^^y CWTI$Xjeᕕ'RHE/G5P>I)Yj-ᵔ/Rk |ZGxԺ*J']j}Ro zB@ oUF) hcፕ&JJTxS%m&&7% m.BIG@[ o'R2[+ hmLJfNx;% ]JV^x{% vQA@; $wVh]\JnMx7%.CG@{ 'R {+ h}`Wx_'R_)B@%TA) `ვ:D*|R>L)E@ &#PБG*tQJY:Zh#|R>V@@ ߧ!_K@c(hX? 㕁#ܣ "L8SP.+C)TPp2~@N@ ? RF+GzL1e,=.2~BO@O ?L R"i᧕3$zVY%&OP&Pp2& OTs)y zQEe&$2^~YM@!W_Uk¯)uוzSMe!%~[YL@,!wUп,#S++*H#e5},}">TYK@ #υ?W_(K/}%E@_  ?Q o&N;e3}/~AJ@? l#R$V"_QЯ¿*;7ߔ_*wߕ=W*N>66_j2H“X) qRS OI⥦x0i!\jZi)5t+5 3R3 HI$<9,5,³R JI&<9.5sRs INI DNK%<9#5<y%>#R OI- 9/`B KR /L.K-""b‹kR /NK BnH-!)RKRK /MH-# +5Tx([jYe=儗#^T>T>b+|.a'|i/|>e] |m](|!c]$|k],|1g]"| o]*|)i`]&| .4j])|%id]%|il]-|5ibC t5 t7:HszI HKKF "mnn-661 4Vx,oG@Ǔ6Ppdel9b5d +K@?@@ ?HF@ ?DF@ ?LF@?BF@ ?J@ ?F@ ?N@O?A@O ?I{weGfMqhzF q]Xp nqwww, r"\,V@+KĊhpxzAL0\.^^/F/WKKb%RFV׊U*:2p7hjILCb:n3Ќpf,4+.f*Z5)VChpXk5ýb-VOu:.Z7<(C녇hm ãb#QxLl6M& )4<)6Ch0Po iKe* m*E[H6hP+mEۡBh{}vcE;CaNaE@*z%zeOh0WW:,hKXHѮhװnaEâ@{ + P7;h\E}ÒC& ވ^MMEތ^--%ފ^mma%EoGo++zzGXE;; +LQn0==aiއ+:f(z?zPthaU}}(auEA k((hXSa谰amEG#:DGu ):Wt :&lccaCEG)DX''&>>6Ui鰙Ϡτ}}6lssaKEG[)BZ6.ap!0"tQ8RpK%hEK1.C)]> tE+ѕᓊBWO)]>tMkѵ᳊Cׅ)]>tCэዊnB7/)tK[ѭ᫊nC)tG;ѝᛊBwo)tO{ѽỊCcݏ)z=W z0!P8QpG#dEG= W8z<@CEO'Ï= ()xXLB'bSQJ}&Fh>5ARU_uk1FcQhṼQ߉yѼ{1O GhX-~ /baU,QEѢwZLMtZBAQ3ss,$ZRK<<5W<=_K| ZF-ˢeBZN-ˣbZA-+RLP-/B/R+ċыJJT+2ZYU:22^LAS1&F1MU44MmtE@3V1T,4KmlCVU;jh5KVWh GT{Zh-OV:hu@Uzh=uHWhuDl6TGFh#uLl6V&huBl6U'fh3uJl6WAD[-TRD[-UVh+>GYY"ϡϩ}}^ uD_D_Tm"jїїUGUU!}}]]77T[[ʈ:GuUDEUWGt,:Vu8tx- {D'UNB'NV"U~~FCC/k":GccumD?A?QESS5 \ jpDDTG++uCDFV7FuSDSVԭ^QџПԝY__UԽ]i45$@gTDt:K=lPDsUDt:O=|5, jxD Ո.B].V"]FGt)T2tz,@W'"]*tz*鈮Aרg"]:tz.n@7"ݨ^&tz)nAW"ݪ^6tz-@w7"ݩތ.tz+Aw"ݫލ>t~5.j|DՄB=V"z=&G(zTc1~D=PF$zR}S)5%A4IhRaP}&Fh}.jTG_:hXCb}~tXl6 цQ(:&6FG&hm͢Sbsyhm%imB[!m)6hHkmMۡ"i{}4vbM;#QNQM@jz%zeOh(WWE4:*iKTHӮhרnQMݣ@{D4k д7;:G>h\M}CE4&:Oh|MEJkzz]TF耨сQ9MFG4> ވ]MMEތ]--%ފ]mmQ%MoGo*kzzGTE;;4 +Jn(==QFiއk:ehz?zPthQFU5}}(QuMAjh(hTSa谨QmMG#:DGFu5i:t :&jccQCMGiDX''&>>5i騙ϠD5}}6jssQKMGZiBZ6e娝D5}}5kkQGM_G_. 􍨓ooFWhVtooG5}}'Jww5h:ut<:>tB]ӉĨIQOM'^}D}50GG5NAD58VOO44gg@M?G?iE4X/8=@D5=&hz=M0z8H4Yӣ=MǢ5=>z"Pӓ#MO)z ?$TTҟEjhP-jWCZX#zb2ywb^4^̇?GZ@$D Bh!X-EobQ],hq=],3ssL\\=K,ԳRh)=G<=OGhi=_, IJhYP,ӋhyXVKĊhET@//D/ŋЋ bbRD/E/իJh%FVk*hN LSAL QLES&1 Mӛt4]o3 UD361 l4[UNZMnZCk5^ZKk~ZGuAZOa@ QHq DMILu`h N2%RB[iehk56htk~tgoA`!hadlQ~c1CO'􇆞DO =S <,&I1DCPe>#42 Ѡ|)ZԚD:F7Sd4|+Aļh^g~͏bI,4?B0Z*AĢhQX -ffX-af瘙fX-ifRfxz+o扥fX-ceѲfX-gfX`Ѯ-d⹻fXnZaYi[ eJXmαǜki_)ii?)e55~~`Z!gGGKSLK?F?6Z OOK?C?3- 3//~~enkksߠߘ,N57[-̭~~ons??;, i.KA1w[+̽nt: t::o tjLtyY,󠥳!KsÖEG,3Z:oY]`[]hFX]dFZ]lFY]bF[-l"hX-j48ZNK% ;S<=K%lZCϳs<4Zˠe,Z.ˡ">`}}Vu!![ччmuGA5}}tt:rt8:vt:qt$:ut:st4:wt C:;i4;t{3v3љGg샎Fgۇα;:kqt:>|ttBt"tbttRt2t}r+ GW+퓎BW٧]O;]cqt->:t}z G7틎nB7ٗ݌n/;b_qt+վ6t}v; Gw;훎Bwٷݍo;cqt/׾>t~tA!aQ}c1GO'쇎DOڏ=S <,&I1DCP>#4r Ѡ})ZԺD:FwSd4}+Aļh^~ݏbI,t?B0Z*AĢhQX -榉nX-f縙nX-fRnxz+扥nX-eѲnX-nXъnxz[&^^薋nx z[%^^VJnX֊U*nxz[/)n@nMb6h"fnfmb嶋h!VEb5%VGb #Dkb-'Fkb; E뺃b=;$Gb'{ܝbzzKtˈ.3Cѡ.+>>!!W-1}}Ո裮fL\G1pub:t:Ջht1 1}}5qLDtMbkӧѧ]>>YY"ϡϹ1}}޵ uL_D_tmbkӗї]UU!1}}]77\鮈[[ʘ:wULEuWt,:u8tx- {L']NB'1Nvb]~~CC/kb:ccwmL?A?qSS7 1 npLDt++wCLFv7wSLS1ܭ11ӟПܝ1__1ܽ1i47$@g1tt:=lPLs1ut:=|7, nxL ݈.B1].vb]Ft)ԍ2t{,@W'b]鞌*t{*阮A׸gb]랍:t{.n@7b^&t{)nAWb^6t{-@w7bތ.t{+Awbލ>t~7.n|L݄B1=vbzM7aoxf[L43&fYv1͎wUѪNZ-%VGǻhxXk}bmv_։uѺAZ/>$GLJhmcbcq|\l6OMѦI,>%6Gǁ-q-іqi+UӾh߸~q)OA??>kkҞ^^t: .@t`\A蠸qOG+zzzC|77zzzS|77{z zK|Ɨzzz[\ʞށWN2OBS<;NxzzOqAޏgz:gy@qUOBy0p\GG>>t:,ptx\舸#ёq]OGzFG=xXF>>7IɸOOM=}}:n33qsOE[x\VEŸ//m=}}9n++q{O_E_;xZ=}}#_qgOA߉]jOǢc.C]=y:wt":1$tR%"܌n_t %~ӭUO<ݎn_t#~ӝMOw<ݍt'~ӽ]OⱞG<={z=Oz(ap<#xGѣ{C{z= D'ѓGBOS< <,&I1DCP?#4 Ѡ)ZD:FSd4+Aļh^bI,?B0Z*AĢhQX -槉~X-g~X-gR~xz+牥~X-eѲ~X-~Xъ~xz_&^^藋~x z_%^^WJ~X׊U*~xz_/)~@~Mb7h"f~fmb巋h!VEb5%VGb #Dkb-'Fkb? Eb=?$Gb?"6Db#?&6Fb?!6Eb3?%6G @[dmd mU2mQ2m:EzLۡM%h'ӎhG<>9vB;< 7^^%hg?^^ $ӫѫ}d %ӮhW_8vC"ɴ;M=X2œi/%KxN ^a@_A_*(y׽ MM6}}']]'cѱ>o@ǡ|GN: t: dt/|_,ȗt?'s /OO}~~ ~~KKK_&__ڗ 77|@S}~~+;;A@GQ@D''I@F_) W NCNGD@g3|j@g3}Z@g|z@g}F@s|f@s}V@|v@}Հ.@j].]kt1 tХR_;eN@}݀@Wz] ]t57 toеZ8uI@ף}Ӏn@7f݈n [t3ٷ toЭV:mM@}ۀ@wv݉ ;t7w t<{ѽS@ݏWzwA*CF.=]z=zwq 3'ѓW@O|ɽ O@Ф 0_@ hFQ|m@ j Em:% hɃQ<8hr̓I!yѼ74/G'h[Z-|k@ o hap-I#EѢwZ,G'hO3KC?Yqg-7OomX⿶t<8U_4A6o_[_>k\ν]meY@ZN/^<.^`gƞ<˹L=kr;E|͏n%y ϓa~|C?j B>ϕ߿|a,s7 Kl;O$s gc=sUX3O/g~:Ϻe/kʵL:s#\S$Y/% V-p,7o# Ȇ {9S~_ǽvƵ3y+n1:q@=$?kOxh7̂ 7c[:kSara/?\r7c9ٳʽku}p)s {xїc=E|&{L|o6~[7@/Sr'^rzwMoUZ3*'Vа}.e2S3]˺:6[Kv[֯g&2SWI˹iM5R[o۲ܢa2iYYUˤeiS&o TLDNu& ۝hwPUV D2*N2)U22h"%`*9+'z„*b)fbU Xn/!2:!2:!2:!SetN=TT*SetNi2:MF4&{Ni26-;g{i2:]Ft.etN2:].c3dlF"g{2:CFg !3dtΐљ2:S)c3elfz2etΔљ2:SFg,%dt9Kfجe,-etΖ2:[Fgls͖USrWUFWUetU]UFWUetU]1Ez)blR3,1[22 -,!,!,Y222222222ZfYBfYBfY"#yyyyyy&OKPFghe e e̜GBYBYBYBYBYBYBYBY"KF,K,KdΔ2*ܥ*9Kv9K8%l3!K19YµK"5+g G;G{[V^fKsْzz9[LbJdK xZGPѤn1:gT9N.jr+{[v0g{'xsZ5# Sqåܽ~cHMu*UDWwoYUK:G"6?d)_O9|ɽ{6x9Zc>c>c>cc!.E-{[z޻˧3vOv6vjY%K?;;qgj3e3׺~u_7vΦ69loj3;x8n}?:Aٟ4/m ht  *g 2g`hcP "-"邗yA<(b 3G;208~pV{LFR33 @t4${g-'N~h K܄l`P<؛=Rn^½  _ #1Dl0Dl1D0D^rFYŅW"'01yņ.]*H!`>:m t @ θ8$FTt0$k3&ec`FFPrҬtSLP*ټ"Data generated by Autodesk Revit! 3IYhJ t  UYe yſc߅0( (( + ,Fv  .  UT%J%JU^ sz͛X=}gnMr ? JnvYY]-'[5R}CA?@Os"vUTUr bm ! ߦBmf@ъ!jTKU)@axk"l9*G GsTj(5ˣx4(ntX9ه#g*>U MT'LR'5Q4 UfJTI6x"T8ԨJxb UYKTDU4(ntEUሩj6Q"Zޒwu&T &V)(k Mgf&<&fԨ:xT]sTjT=ST}SrQgiYfU("`ۋU(j-2!Ά~j5΅~5B͠P B"%t1 j ]BP#t)  uBWAWC@BAC7@ݠP' nncН]P_ A{0\ht/{-h$4  BDAh4MAӡL*fAǠ9\h4Z-A%RhZVAC5ZIh>j*` ,m@/@[mЋv%eUhz zzzz zz ރ@C@B{}~#1 )t :}@_@_BGcyO bv;tL[ٳ zrpΪ\|+_Ĝ Gi1LPSj<|އ%sm9t:?;QV pA;D52G"6VYe?C#Cn+Kiqؑ\*.`k7x(&r ;/Ifr! 6 )493#G;c 9nO&F $g_.mi&T39Kj2񢚫 VWy0ɹlF2{us&GLTyus yUFv yEz#H}n BDKsdũZe樁ED+3J5|"jD\bFD1TC%"ښQ'RZƠ8mA78m`FqcьjIDpv BD:iL$jt.M2tNӯ0Cw+sPDt5.^U(ӄ^6Bqy '^ԵfUיMT>6roS>2n+3nPZ| gu3]|O,hn..MBq9quӘHDpIąOk'=B# V^0=4[BӃ9Wqk\O9RzcȺ@tg1Ƽj #_<'SL4՜x$ 1 E홌57;̑PDikQ/.W}&PD ӒsZ~?E?gݢ qwϛL, 07 JD س&LܖG#fp(3}82XِLPC4(O14~$+%/ UXX50iu _͹'XܶShqoeBx s{7^ٹ`84:h*("~VQi1*jmE]ѿ1& Kf6Q"bN&ɷ(#Sڽ&玈4]{~L`S )!јr&nǜ'nP$jQlKL;Wq 1Y.#Ś$f[%t0TYSbL[`?8ETuS\ъT 1h;ۻj: U,~9Xy<g[m M,DHƭ$:ԋ{2Ըuj\)Od 2DPS] ^;o -32J0U"YqD;p&PDl2_^|._o^^7u?X-KP/LL&n5B-d}od/#S؞I#d~Xw /UxzQfb5qDD&x#{ EP'*,.M# 0^S4BϽErw&PD$2Y ٻT("vs[s9YHV5ګsMuUl E>;0ԋ e5*MT؛Id7}T("&+̦ yM=`6U"csE}›O&PD$2YgT("'ͦyM=l6U"∹ DY5kfU("fjHb#Sɿ'/-cm t [5 xf =xUEB TQ"(C G M)[V!HBX`슀EPѵ 6,kYwu_W7,*Jsf;{fw;w3g9S}}:OU!|Z> ?ɘ x FNS#''00.n !6=ųD>uEDQ<\,Vf,͊4|3zBx[LHӞuw,daqhr4:|Zig^PPwB56qF<q)9%b;8O* 0e:W.KBH]l֕uaXg6u*`} +]ZhpJh/1OɳX[ȦSɶ$c`y~\}BFaJ$uƅNe0J*/jSH"f6pDI &: 5zԩZٵ2L_~šP!M1ÙKH]ùG9܍,OBp:r_+ݺSӭPX󸎆_%bѐ"AB#e]UCJXEq졹u!Dut֩/7H{l #K֩ay'A=Uݺg{Pٓʞ3w=0.1F.^Kse˄ d&(9,ajC. 8```mUt䡪Hy-*^ԑjTy*P$dҡuC$9I!vQlp9׆Enfc/) ~6P !z@ 8Wzbs6j+v]h**ɢ1kDFʌk2ƬA՘iT8uwCXoP4;C(B$P'h\jWmr}a3ԩZ_BTj aO]Ff,FeO}qF :y#CX7FNp۳h,U4G7SRXkxԵDUF0Wԑ32r8DUF}w9 hԣ|Dn,ߪ&2L~d}y<}XwMܲy8$}\ ͑Qp@ eުu7bP7`T5gEd{XXW,o%^>`2YB vzDl#Fs9&=o,8,Yq,Rd] 5<6<b׳5VD-@t =; ~0v-N8 3PN+C}w G7x 6B``:~p 0X"/ 08G HwxQ Ecp,~p/XP@aW  #+p2 fx `6j9(_ P<`>('a,@9X0 t@yXr*8`1K8 P^p8 <^ pG ZkBhEJ"7ס\oXb8^#QMG\p x qo8m'\ ^ /x;.+^p%8 x@x/,`'(H6y| p5-5(ע|t` L,(7p 8| p!|"s \ y7|Mw\E7| -w. p)|-Wp\5+o`&ooa7 | B`[iCYy c@_#sZut<Оo*eN v+iJǩ$6NF[09n#U3R4P*lYh*4gr~FCSǞAc >udU$7lE!j æ G3unQ4MpiTvJCO:F6ӋF1X Ei3^vgv\cFd1YM5 VO4b1_joZ=lHxx̏OSZZ,hXJD1I] d JW8X,5e-ҹ9uNJ4g8I \;P>p\9\_57^~&(Wʻy.pmsIOp= 3pMwO p}$.គVu0Awd6l/=% u}E|;JѱPK楔s?e*fTbb$ =3WY p 7md4ڃGs6~6${NC{,熿B)E4;!,3VĦ)]ߴ(KMXn(sa#de8pp՘ J LpF |247#1_J[\EmiG@|0>Ӕ^4TۖLUlIWӖn9TD|)29lFG>guv2:D\2>< { <=֏_ȮR-F1+i . (8e֊47NexλtT/lۙ>SRv$J0Ng/9`Ex`>#7)$[4%q&E#'0^FufXJf4wa$Cs091krWq67_9A z h7*/}9_8W58ǹ6?8p~" -tgqyTPh>hݫfu@j"8υb]O珹$NL6ܰ7z.duh b3@`qx3r"לKkwkp?[ʃkj?/Dy,c$85!D凖nM-;Y)[br /Ze}_ٸhKnK-_ٸ4el\JlcS>S)[6 *yo+d~;d+Z$y"͖o~}ɑ_Yyz<~Yڬzpp~k }; 13lg= r khpEBdVGxD3AƒlnXfEqFT1A tGZ%LW3V-Л~Wjӗ8zdfw`l?ĝ2XSMow7]a p{LoV+A BVpTwW+0TXyS^MWv7BP1UC UvS(MW=d)TQE#k<{MⳕuF_{$saGth; 3lL;Ch[vTۘ rcL;.)sBR⣛ā.kW+<гIyT\iؾct.Gor*h tEg&9/$,b,k"73 ;RpxydĦL̀bЀїB t4w+|{IL-%DGwzKDd[z%m]" /::}'V1{j3bk&rjqpÖA ,9=l>.Eٟ=6hrC~>~9|vvh/a~4=OW9>z?~^ cm`bU4@϶ZvƧH9;[P[{_D|H9TLVV.D/F>b h ;$[>ޭpnHr'rڲR>1?wō)VJccQ!qF*?IHvVC *t+3H qPX!\v-fED֨NB;PyTdN[߬HZUOxRы\^xB$NʱL`y?>ߐ!EeD[4'T4Wfpb/&6yW~gܔTp|gk"i{^QLO?Ym[:WΤ{S\ĆL=] W~?L7F3/67gUm:Aq/CyD]KYDyGgby)c dru Σ(,ZYR-(zVCpA|XW~8eگ摰mo{+b3 _ԹbMo/:W?;%"g&CXw/FF+e7[bF:iEމ\0m'+dXh`nkI-7g45Ty$rRGwɉyEus!3ޖݥΟjuvUb3#u5 vXOtSȜk[Ua~[L%uJ$)9b_'˦>%#8ܳYwڬSe%T_ς՚-OF$NC{4Lo*ݽ"ús1ɍHY9q*%weuJԗROG}t^|Vy_-֛}iN}k급^^]黻s{]yZ&nAX 8=gYE6f AU۞j‹?b~.iضrNRJ?q?PG\ľg+?F"g]s*UJf=UᾶܙSF"sg &+Qǵ=4Errz;p~V]Qyiܦ O%NfU/blc'}'{wnxHL-g$m6z,wnڭ-eEjFw˪b?'/˙S}4x bE :4^dcT֩Z7K6zʋ|IPsz38K4{9{Ch=y1\S\f1Ϭmcy2Wy.:y}E;.ָnɩ_s"|WV/#}ߛ92/۸ ;u?VdŭR)gbr"kѳm\[lX*Qi̾ sN?ދӘ+朣~{70&Yr_ԗWoUSmuu>}ωuP羋VH&pGzbY E^k,=wbbODZg5*^b^sx{k{MKf }Ae:Y9H>8'JƽD9fpV=?Mws'o 1Oe1WLGs(s0W+ qf^J# =a> ķ ^{v6!NpJ&Y&z{erͶ}?Q뫘 *rxOw 5 7=JΪsG~㾹tBۻ`땙yUT 떗mnpǰ?Mv3gBtڷc\]ᤋb+u?VUXlxbJ2ɝos% Of(xC9/ (Pπj.HRxH<`\ӌѭUk(E/oW%I%z2,o$$'tGBv?՝dgPG(H0lwiM_3Rhve|8@ee9[z 1r6kW~\@~HsN/ֹqm[u9ڟQQvr .G+uĬy];+챺a(u}(?z 2qankx!/2nbnO B >s4 Dh.#/6cd>h4B56Ȧ!Tshg<+ "8'bLhٺz#@mm X2f./"*c|"s\K!UMjUKicATՌ\$.fI2vl4V 3 PjXGf楡V,-=vZ/ mu[eY[B,b(b{/lJC& &YeV|eea(LGGd<*k_>X_SbBu= dgN I4 x tUSPPS%?.H_{E|ytҜ۾_ShUa$LW=>2qT)(͌S@J鎃4ǎ$Jr?C=B?Kj_|N:t{f[{o~F C5D1ąTV¹yŅ3 #Z^8h2y=YǷ8`@X;`2D$5=.6=u1UxHDP 1StWc^ϯLfɦۡyPSy NFP]%n+]]ASp)d$zedvd̚!Y5N2;_d> .Jp=I '+sx{ SpM}Q+8/3BfuJϺۖ>z~DOKD&00r"@X9kh/d &iQNb8Ҁx_ NƬCJ3[_ MVԾfW.klR*CtqOkO'sea˅#PH~V8-} `9V9L/~ W,jHKtRxHio0AN-xך"R4|yӊȰxwI %$y!H$K51; JΘ#TSZCjA^KEK_xA( H߂%#)a&K2eJF-JpB}}JFl ;U2b횠4 wػ\_2r~Cf$k┝bMd4K;NlL:-(3@+^eA,A3G^r)^=9_, Rr|_ ~~8t_>M|mz-py, kޕ/^{jW$d{5/A+z{a 1j?S")Hb7U3`ܕIE^]Y~g\ɪzRtj?Gh?'R[|?RMX !.hkQ΀N_f[!_Tf?G FY7NA4`xKE.%m&-,EN ˫-"ηQOl!VWC97N_Fb8Kb(wyb4xܝ_Id?(/>9l(\ɮ6V $jaPjwcJYN >uEDQ<ݏLZ!g ;X<)1aQ`ih5rƗ.mhUzAICV~D<^8X^:wLX=؊ ,B|:K@S|5o }PgV C~1!$#ue?ƈІ/J_CBGgo)0KBۚ.fԶkCR|:%-7ʻ+mxz0eCBGW㹯ǐsSG~s/^w2 fW_eAhI~s>ᄽl9'C,xZ&O1*7Ufx$~a0%H(~G:o~Bex b8n[oR.bkDDa冧 򑗷w.iվ:-|n鍦?B#RƷF[a}mm!meF76*20祐dž5D{R/W2#߃O/' `XGJ;M5%K9E\ 瀋H39;H.rfyJ<^[a<q+º, +dnT7 6e@+y^ nIm!˓uS2 Lt)wUz&:˩}mU\u$>׭htH2*!~]V”v|N}AŌX Daϝ칋L٤K\Eeϝ3'a?~n!G"QoE[1=Տy?dYTwK*1pi:qUm{%Y%SvdK{\%*u=Uɸܺd0#tB~|\# TIqY>0J]] Rx cnB@~Z+ua,o$Xkv5*ښ}0B͊cNƗ|vg*K赳Z;H䓛R6k~Θ[Xo!{W%JJ1;'iWlq]17_]S +oCʤkXcXyh,3!Zh, I}b5攩y^r·t7غƔT7#O^M8>Rm9tmWMZqkGO=uӣ-fc5N*kV't*Mib}Rz_il諧<Ɵz\zW(?:D7gQ-y.ϟ9&k PytiDuy> %91EW~J~ G xuiVmQdx7È-Hacu>RRQbg@xaV6T7/@mɧMڪ|Q}}vfQ{(voz|bط)vlg}dO]s/ksͭtHdґ~Idc|-JK~ T曆CxKWVx!PvM|лWvW~#PUm]װ,e=[o_*~ ?Wdk5K:_w,|&h6d%51>}t_O^ZUU?#y3{ҏڿ&~`do߂{҃ Tע;ݕTvG:I󻿢7us񦇹Zn.ޤ7߷JLޢ癠?C_yOo{k[NTsLș֮e.zc[?u=wd'j /RU m [5t g [Al@LN@,@TNB'w<7|f}gv޽tEIP(ѥE  ɄdAO fB V bCJ@JBJAJC@BAC*@< Jʐ*j/H HMH-HmHH]H=H}HHC7  i ii ii ii  CkCve55Hn>} EoNzBzAzC@BAC@BAC@BACF@ H(hH0$2222222IMv'jW-'ܪ:z7GouJ-oth~3/kZ%ךLr<}Jwxo%f> K\u-,Q$ yyy yy yyyy yy I]e'Q9m t @Z3#^0Rx;{]Ci=e˿Y9!0!1]5^ ;;+TJ>"Data generated by Autodesk Revit! ^ ܾHA3FDt _#"e ̝E(I@gFLb9Y(***H E 9)DPA怊`V ?5Sݯ_mn٭s~eޫ_[]v*.JU* oTׂ~ZĪV,qCb[( f D*SV{KYxfRvFPQ g,.u@bڧWuG7͈Qe&"%cޯpSgD=0?*mB!?^ `['=,`gAvؕ8NRga uAݡPO(z Aǡ@h4 AáHh4= yeo4ѫe)yU)rp&4 ́BA Ћ%h!2kH^@Kerh*Z@kuYs+x9]4TGPH˖S Jq(- 6WV%{`1qXEL'`S M)G["xyE' 9\ڑng(x-۟UJߤ`+WcA湹&|*,%>P=0 I}c<}m%[ fmN1af!Hm`JAjZpEk!]9cJ@}{,A&?W=F]ecx%Zޤ nI+/z-=Wy'~plrkZ:M۵v%hDХ*)zuhm@oBoAoC@BAC@B[3硏OOϠϡ//m7Ewv{h  I........AW@WBWAWC@B ЍMPCfVtt;tj 5B/C+h) ZB>>>>>>A@BAۡN('7ʅ*AAC@BA*!СPUT:    ՄNNNjA@SӠӡ33ss:P]B"bR2rtt%tt5t t-Tj5nnnAACw@&НPSjZAwC@{Am}P;A=u~Pqh4 Bàh$4  Bh"4 MCOAˠ U5h% Z Bh#)7gƷd<4M3Y/7SfCN߱J&kwKGXixZKu|N{C~AQzX/iȻ3X:·Y, ~,Uv>kRҒ$G#7yJތn 9e)NR1j7tܶ|=␀u[0_{Ռ꜁^|!:_8ۃȝS|r^)Cdj!O} 1u3G8b5y/<9{yRyjfW@<'3@f(Ӂ=Uӻy:Hf D<ӁR1yj<X zyJCyjV9a<"3gYLE--lIJrTp[D)A W0](F^ UORe@2kLYOf9/'Օ`GXQffڭgig( 9+ IԸlFFZ8^wpH,:Ԗ٫MU*'ZEX&B1I"b*Q bJkpu*JBo<1]#7PU\ŪƸOEaxcYttv%wa#-BuP#xF"o 1S2 3%YjXIElq#jsV ʔْ7G4ɴqͭ>sxLYufitb[{EeHԼDhnF:qډ"ϫKln6tԎwG:EcE("KS#Q/%DQ ҉ NxYm;!ҲEjD("Qf1f#G$=#N\vERuev/Zv'ұcႳظlXg Div/EZZ"Vqn̞H#V4+@6nuՉ8T#fڛMmfC7$kեSi:sc֫ϱ@8lHlC"6mMjoސT7qG wFl"ۺb뛣0f]ހl`ճmݦݶ@[*-FgEt-qw,28VIa7xcą&:C7B^h M1{{?/qߗ>E b$CQCbC j*A¿UR{~l1%U*9~skNQnQu;vnRskYcߦ]ǔ[{>!;|1}^7`PaZ 7^=Ky.Vq3hUY$||wnG#Oc5aE(">~qG9ibĆVb,3(S/ֱ?1GX"RmA:bR[Ǯ̉kuEr& &ߨQ [yU?[3]$lN"b2sO{e";Ԗq=pl2ԖqًXLJbOj85#q?y!贶i$RZyym m4sӛx g#މPD 6sf$j"%Sw_,ϫ  k#{ОP)4T* C>P6OBоP%h?h@ 2T::: UCA5á##ccЉIP-6t*tt:tt&tt6tt.tt>T'O/Яo.O/oP( uCNc2k1]*\?fjJa*w"8^%WcI/M|:.QX VlJcJ)vY-AWk(FYh##-d ״qWP8c1yOBfcKE o >4 Dj#]疒bu$k[vZ*㳮e| G7L2&*+AUx=3>Hg Tmٕ]2tfe%Ҳ[pɸ"{Qn}(Q "[ DQ.\5J4f!iЅ f}0O=$h*DeZ4qa~"\pB5'd &XE(8m4C$?P3rKAjTJ2$UNҝQE44Wּ468uVu69DݨPDλ*'݄Fa'NN^qbP"0uVͺRW;Q"u4df=gHKjڋt=JXեϩcqY݌tj'PDיHj'‘NFK6o3-W:&qaL~&?>cAAge DavSS%H#uZ6O{wb.<צKc6\94uY"N4ɏtj'PDK2HˮP[&Bqϲz3K?[(_J x|-KG"Zq Q#y8kH6U S#y8H>gzjyu3qaR ܨnD("Ɣ'_<( /0ָ%)..|Kcfuoqbn L wzs3(GWDZv["nO:HX'52=WHpMD#3lܝQHLġ"1|{T=vgw>$;Wi5Z@-7t7tj =zju:B<30zʇBݠP' z =Bh 4z Bàh$4  Bh"4 MBӠS h&4 ́BA Ћ襜{e0'T * B堽P"7 zBGcP/D.fcg{/XD򼬡E_󴊑 ְ"\ GXcu\ ojչz9 K]j+ JeepSE@j md1 |?㚶_G>#?FC@4B:Cc-].'w7 X(g]:ʹm#m"}cp?=vI}_]m3TM攌M"Nm= X-8n*E^uDtPDEjW %bxHYȋ )OF xXj%EO m73Yt0uQsc˰;\bLFt!TW[j̝g fڊPDNdp`DZ6FmE(nPv4@ 7(oP6X&L{D \BWvq; ̔蹕9qT=&%X:nw1<hʿy ,<5whY@2X›&$10I3M&fvګ@vr&fHKh0 VKcV1MXrɡJA} L ʬ8ZIEJf/`+I`|^"/ ~-e~v41ޘᕇ`rR$d=]*$O;'HI^y&'+OBa|7_&)sdt4_&nq`RK,Iy."Iv\_%6d͋HRL^/;ɵ6$#E5keZ`$tf ,[i:+B- .'73KQ^~aEqDPbˈW8g"}Q^N%EO}^|&V^&N{bW" dyٕ18'8v![oX,) * ;: ( 4,>ҝNy2h9qȥiF6Y&rEXK`9.Q[%vK[Պ.Z?΃-nSӖ ?)oq%dD2r IPfv:;?Dc##iZ)]0rQW Bh~h]@ Z"*lASךX^dv 2쫴FӅiqIJZmIP zeLo$[5a}+}; n7sv {U1Y-!cAc;$ulSAA1% C)fBfztb~N+.\سE("~ {'kZp[Ca_%7Ek0I,=JoM>J K31ܟ_j\9#1 _Ä3   L7"g u[9l3H"bŽdIHDʷ`g¸%ţܢTz o0e$MUV*'/SiY\@^'+/UPWQ\Eƭ(){1{K01H0jLؓ09iK&S=o3ʑ`r}% @ <H/>Qڪ}%VURYuJS[ĪUV'jU:@bՁ*jx:PbAjXUYea^|*KĪUVUuĪCV"PUռD*ڪ'Ī걬ͺun.0í*<aL8mJ0p8t$ttLq>D6{_ˠiSD(" Ush$Dȫ-qj'PDeʱˎU[&Bqɴj/w`*"v. 2"\Eevl..{i«,x5F./@ЉIP- L4[3ҮDRK.Ȕ`&C M{Xqxϻ B<Ÿ!ɻe75WZ3P$RDg1'%誁"ɘL>9nON љq`+ѵΔ8c}J<+aQvEN Ps)/.LIvD2dJƩ^aNGﲐ^TIpz+ # ItG8S=;sh$Dȫ-qj'PDeʹU[&Bqj_q{Y}j/WQ%:>ԑ`1u% Ԙ $ ՘ %|MC0I01K01H01J01I01K0Ԙzj̕j̕UjUj5j5̵j̵L}5ssss@i ܠ ܨ(ܤ$4TcJ0717K01H01J0ԘFmjm>!%;Ԙ;$jLc xês|^¸wz=̑("ƲhVĢfT} 3qgf[4cR\Ǹ-$-CQbuW(j` %A E bVWܣ[RQc`Z1%{՘{%1`ڈ1嫧Rg[`H0mcaƄ`J01~C$՘%|Ut@*?z@i+BV,sGWxuQyPdbdn%Kc –E(":BQi941'*$NvECXƫI,S[&B9QWxzʇIiN̈́s"qj4paZE(" ;sh$*?'*]%NvEDD,UK,뮶L"GZt$W = H\4fB9F8WS]7?JPD< Gϡމ8WyLN蓈eJ_e}ՖPDbHO2+}vqp;>*CQXWOl33@=>8AiE$PʁG3 Iy" 04̎ >u. QaH1CUR0f3\.ŌPaFH1#i|1Ƕ+së3.KNʣ1Г@$h24Z"3&q-M"VX1hIQcH0O1OJ0c՘̸X1Ҹ@"ƫxiLb&0Ib0IajMڅ;juz9{|?R6nsL{3h) Ze ʮ)욪Lb0ӤF"zc ;꧊N74ڧZV>,aInɕhϧbb(8 ~X}@ME`PEaHl@fyjPփ|#!켄j:yFA^H|i5pKA]X SF)L;Sz?W2ЩֿYMlWrM}8/:Ӣ?rQ0lvv,iw;_oK6UEWVBx%|%ޡ=NlO.'_+0L.7_˗4sUO;О7&!j, iģ@K#R -Q'T LvW,5FY Gy.{/*4|noJ-s4{]'iJsQp4ޚBRy {F}ɤݓJ fK%հSWZFrX[s*JY\@+2%\LK *,s{nZj860[¿U Ԟa*ZH#g^4*cX y@kg=Yƛ]F /qfuN4Kf R;E)s ~T4xc0| 0 , s\8, `1p!X\%%f_ VBŗͰNP5a}<ɲlJl&i@n/HKGA2AZ|gy@4I'p7QTp JQ`MpIwQTop $g6l& dux"}Ix|<?ۀ jIԎOQ; _` k+p058s` 8 <NL8 .??/ k:'+'*nS`ni" x oG10C _} ;x|~ ~bl^F`^C/`c&6`sЄ l f[^`5 }`Nl;f#X|,vA X %` K=2`Xu`=pXI`30l[-`g"/o)`O28  ^?Wk 08烷mp!.t ߃ρX,^ )`2X Ux , 40@Ke2`Y,X,˃A`X.+J 2~ `50n_5H?`M0a-0|u~`]0||냃Q!6!$ _w]`p76}` p?l&o`k l ہaxq x `K-4<Q;{Q{{`+` (o5`-p 8 ` !`W8F=h-0 `/pIE\ NzS] :ux $6$k5 $d[J}`}>~ > $ x, ` xH8W G1XKp.x|c)J\i(RtgDbjC* mݦsjSgMVnJ%{Bb豐&MdFvt@6BEm[I$j#ԮQY]$t<۷2.h^zFbc&M*t4EƴZer2 rch/;2əф򦽲]"]&PI伴9 q@Sx$&90<h}Y)Y2ybKuh.#>b}Vi*oO[VK^srI^Ux-}>H &Չ+Sx4Hļ^i WZ[NJh4:QH4[]Pգ6vC/,U`Z+393T~e`79ٶiȧK`9${;)X/* U*[:,L->K*>v3Rx abJtb!7F H-u52YRY먒u gE?!8Mƶ  WBGUCjTxnT A* ƱUkl"E {Zh/fhJ9 AQBGv1=P)Њ3JT7"tkXvA'PV>uv*,}t)aG*$FuD8m#IJwgur37c}SQF<꩏72iGu|w=\tZ|<>LKqR0mކt9 i>y)(gNTx|B?71|g>UTSעOΪM~<<*W{u*8XЪ|R)WGO2SpJ1ŲI*b{z$ogE-a{\ v*.{y? nuۃލ&XdC1û YkdR LSx7VT߻y/>dL[])μEsU=nT*.$j(OϮwCU+]2z.~ugZYիc4Z**`7o6wFVÒ7^F&EbT>m¿oe޿s†D]ЩzJPlI7MPݛ˿"nljӽ8Ô2C{gx7 nû1mE0wCtÎ7OސI1 >m»ŭ:<~շwo ̻7Dnw3y7wfճlY~vڛŃ{vfPmm]$97{83Q7>~:,ÿ1o s[ )oZ[ơÒ7OސI[߿gU7b6{ c/wo̿75UK]ݽr&Uij)᠗l}~kF5Ni>VeyI|ɦ Z,/Bk|o+,' ^6~ݥ VբLܛ-ʘXFogpԲ \V>m{M{90؝4`헝eߙw7c::?W~C伟}KW}6 ۾|Xm6$b+(5e w/Z-צ?> G-suc7f^m o=}jzϻ.w`N7U’[q\v2,E|;δz ʙ5JhtML?؉)/4t]62MS0沌>^@,%g K3|&p3|K9Mm[ ɶ$oQ&|Z,s(^/5-ڿC\f7-RrHi6/ڇqKCqZ؛!}6,{9%g>JZ`瑐?*lѴӾmY=U;+D1aQk=nY{bÕY$Hg$5EAD@wy,_k+^JZva%OcK}&8bODR-b(b|e/ZQS^[2O[h'e0] G1D޲G՛>[9he-{^9޴ go1v˦O[l\xE}](cuK =st2uvlܠ^]EꓢQ9W(#nN/fF]ja߿-e3t9}4r6>8Mi}EJybTk-Œ{U w!;?Y%1yia09y\r39W?*]9,L}PD_'^nLEq~%'!a+@$rUKVawxTupQdfϵN߬ @q:,KuE7_*["Tl.IpX.;Vr2 /RUROaImOJSX\D\4Q>LE"@MɓpQVHћoRkyjPփ|#!yűj:yFA^H|i,PJnɔ9뷡qʨ8EbW[N& مM >߹\0]:6nk`_mW'DRUOuSoss^bR~oVΝ:t۱/;ɏ1rqc~VO#YƎc4LÚcfv Cka8QfeQ.w:yKп췫z.z<>&(nۡ7PmP.j2ԃV]~TgIkK[WіCrC*- brPZ\]ʩT]wueUAfWQ,^xz![Y" &]/{bߛ˗/L&dn9wVtyy$g=[''}2 I]pZF6MSO:fU|e:.b:{QD?PIs}<¬_gOlJ: Yn=%ՙJHP t "aέ[j$ &#-D~nI,ެA?bRD{؅dLG5S^36ZJHOB gqx^q"Ӳ]*V-6=L4u4f r_ *i|1tnhyM |󗻝xEDelY<ϞIޓ@@}*{zδ׮/LX[g}^_[}a1s :V=6 eYY,*:}uV@B U췖 jlȋ2B2)L4ueOqYFc[ZH/:ҫ﹅oBt-$xܶQ6!``O%P9`%d|}Y$^maZ U}=MWG]q@9FG6!)s+׫v}a|I}[_z!H/8ΘomNnF"Agx`:،>D:I&od7D:Еᲊdx/3is/2<Fr!D39ou߂z ZފlS( 88 ;2V ٶ~tDnosm۴ xohLbT7eKן[KhWh?8'qIT2mG]=t܂bAON7)BWH3R]IQ/Y'FCRIXiWʃD 8p6.JaulGfZTwş)9 Xe(J ƣq~; Z૥Z\_/:p_6pT_hCHryıf?N3']~.#fwqҮ+~j͙߭y ]QrB]R9JQU^~לaG3yW狣8wCqAG]~xZN'Tǡsn,l@mx D 8Auzx.VLJ%4̈{"-#( & /kKMȎeAw?ɠjCS ߾*o[oesX[x`G7܌#h0ja;xܮr:KaV5=3r^8"Ίdž* U4V!n8q*81fs$"f]78ުEON1{AUwǀGvNϑvmGzVXc_5–Xsj$C/ F_Xn+ W>!;u芧h? B~E`ً'`̂q)* -0A-EYr;l3ס(4B qzY,& l[B{n3){{~&$9Cf X5(Ok ʙa+ȝA}g_oP5/bҠVPQٕ7Ano x\n+E,翵{Xh ʴ w%ޘQoܩߠ4kPq:l=WPPoW? >.j~D8-]0y`W$ `$8jO!ww}ɀotZE6n,;Fd.۾=ڇlw]K*q]etSp_32` %+,t2;3:x绉=/.Ƅ=߫  SXOez=~uJB)> 6…nrRF}z;#qc3Ө4HWFgWٟ(n8&{׶,ϗv1n^Lsȹ._Z,:No&ҙed=lJ? HEI?<Λ3lTBf&r.ᗃ=/ַ%틨+k4ʹdh>ͧ{whA%}QtUc!mrYF3\\C͋G:EṬ_CmcTKk^Ɉ"H$ɗ6ܽ5E\SO쯂ϝ负ŝpWY#`{x݇Li{=R.rQBLtDk-l]&sJL߉U5%jz8&Vm;W4FQح/n,}_wȒ҉cG_1gm-㬲-n#('=f/$Q+rN"¼xJ.*mb>qZ#*=X;lP<n<(ڪsaFD>ƨMVb;\rdoĻ8m݇zzq<:Cӈ|n> )Ng-3k8jy0y&wWfM2ڡfnKB3c#N=nҷ7yS@4 p"l!{Ȉ/=Z?/kܐ9Gߧ+psnܼE"BPJǣsX7r-2'+Gf~Yh"'o5w熺v"1?vogtaҙT昵3[k>>oc6G9ϱɔR6;K) ϭr:?tel@[@mH+R-He[g[ŒcJ<8tg-)%.˜K7n9%HjNF"#ut͵s8 ^cM\Iتftg<#F<,zQsG%nm,sP#gt${֝Y_T1|`=3]Rםv_<}QZB7y՜u=z@ }ٜ@fݳi\c83_B4G%Mg%)4K[s㔷S]l-VSm@Y7_eSf-&9bi^}9wʳ{JZ][hRv\ m νYBڷ1m=xùst r.3qvu{o_/5G Ed5>z,َve\wwBT\hΚV7G̺ 7/kYT*3 xE6ӳEi] yP)kL;SY_Շ͂魿ck]Z;}|.-#rG8;2W?ڑ;^!1uk,%hc=~yqUo]B'sKޣ;"V;v[Yĝ \lWl;"Pˈq̓.&iٞ04kcyEKQY蛧[Ft}sg&Q4v˻~Íuв]B[{ST]ntʻp;mXzDEAac6Bp9;cw]1 etvZn7=+&RňzuoHk?^lAozKb95[/|Fז-{7U{7HEwIؾw흺|[ms0vXW~[O[Z kߌQkV[^{Lww bkdMVy} KZ¨-NQq)9v蝾;gƛj7GӺSxJkb^zE~boFNyuF7Sf:5u & OwǢOd ( o Ny^m[))j^y-f<^kGoogyNv}Ck'l嫔~9k,w9źNQSφףk7z93<--sgf3&Ŏjǟ)=~rP&4h]/"GFEH4)j~9~laHO=wbLS#Vy7&1*Zw$,*M^Y[#bmU~c3nn>(XN,RbnǗm0yвpI4֠Q/TF\3w_Po4ɑ]{>ϔУõ']ȿ9Z]~tI V>s[/~zY%x@DA;#XUe>֓WՁo7~kOu">?2>lR9PI}(9 LEN2 y1 s<>9Š@ V@diq-6x <7 2śde đd <d-x -~ cA[C<m -_sfi]L`  #NOX<`?p>le{`Ov`<~ 0k| *hX0 Ox#aop =X7Zm~ p? 'xC7xBwA! iL/ iY M^0&!NpW ⌼^fC9TxR@V$ %ǎڱ=ⳍ_‡wP-Av4q|D[Ay!@>sB! 6 vE)r~<9NӍa&<$쉰b]59*ք}=3.{cpa8qUBdضoeieԐE}yȲjMjwV0ر5M}Hlf\:mjlk2(gӢ|F3%cw@s]uC+jţ XIJ*CMxKl -"68.<"9z C5j~/? _$h=PrXH_:q9QʨܤϱiAX]{zѻ!ٮ]*xAʇ  zU'oAxIğw759f'LoN3M1fG ?Oi*RфĞhU@S"$[cKa;y)8D,c3(F~W 'esWT |ѷ'U\\;ϨYyVU*ͭWyU5그?\,yzGzp_Us\ )+rkOژ{!ׯ.e8 l8DgD" PEՖBvF- ;xph9Zk ;o6 ڲ%ZhN <1|`҉h\89o7'R–*3{q ? p,\sB8xB N#'E|ab]qy\1,CБmR5.3G9+T8[m8MEO9c'SI)YoW&A̋DĬVIvϹKIEk]т֜)t _ zϷRO0jm I"$:mf {:AS tj=Ǹ]ȓ=X3><*1*iOB ĻVfOBy5KՃ˗ⶹEK,VjV^SB\oA"`p䩯i[L'226)"v<$QqѦQgKsRd½E+Nlxo Vora֕j!HIP4G$J0.=^!f? %MgpU5tYi=FNެ?X Ms5Y#N"|@}َ&є$N+1hӻK^ǦS6ʠ_ArkSOs&6p g\zwInI8xqrBj%M]^_v3ݲJl-(Ewu9f~unTwY8WTݲqZ}mW-Fs\9{ҍeT6o@ŧ9TN 13tg--"<3U]jIB8K_Prb BV-ZB I kH&]2IӉ8^D<~?35EzcVcSd*?reRxQxG|#Νdo;&<#>ǧ8k"^oN9>ǧ:tħ4G| ?4?ߒǷtqķcy|kG|:Owsķmmy|[G|;/dKʍ '='pxOw8g{Ù>c:] .Ǩ!o :cT]6ԅS$N(]:u]_i*qg/tpPftd_.L7.YByb#d(Npgb Hb>_e ު?Mx]A&l3M/u[?uFwF(,i#d)v I[}UpW͚O Nhg*&ߝŋ-5(b X d3>7Njwu"N]Wm;+njN/+FΦl3|-ƿѥbUUv|Fm>*ePFye><_<ϒx6;1l͟w 6cǰɹvjeg/+/93inm]\:jN^e'[ˠk}w1yWcmJ]uyEˠ5c &1L{qw]Qd|&gГ,/=WknZ5ZnujGOW8OCrI,B &p<>%Z=GY2^93(&X<0Q}l6*LQME]u>ʣ! jDzUc$p5jk zUnG /C-Jhq,o- >/4 PO²&ߧc.7Mygu8[u}zr|_Q]Dv7h !㺾i@ ])E9/aט%}J;p)֥5l#(K($RcY( ZmV` P9(Ѧg8z[)H0]Krьw\4ȃCdytX!Z,n^\V|~EyE)͝ݛL7 bIBZ6QKq!0H|?LjO'y]-DHO6-'~b=UxrRy#u"J} F";Nj q[Ia>ωR ;< D)*9c=& r.K.t*,WD Qr^G|z%eYFn)<6n\vWsnɍT|^E}'~uOᱲjTxI+6p-#3: /zUR yjJ<>$ V Oz-+p+}ّ N /AAה]X\12]$;U/&F~uq]|q#r0 kO_4_\UFsE*v[F~Ƞ4E-I_EH6h"K N g!(qY4x,&gZg7?mI^8v%gmWF]e%{S;eAv}W1IjΛC:ɓ wO:T*HӥH l i e^Wh{'{_{hF"#0֟LU |}dlh^ ez@[w.,huOEH9 mv2͉c2ܲ(-kfElvڟL(vڨ [Zb6k6E}iƜ'PGuP$?T{goI8J懊MF}QdzߝI}6>Z< {o3;ƔS|]*']ǨDm,$xWzecBITu+RَtK uAsۜ8uxA 2?M>Vȸ)~sT 0*LAW8{6t_Sue􇄊ўfެS (EcBF;A!}/&K8`Od >L3c5"c=mVgy5VUc3cӕPWg|*KЙ)!uJ:x7&dR>J{I8 31ADU H]l:˴~]_[Vt,"'®ey`mʞsك)r {e=S@mtNn7߇lh)\6EEI6o`/6z$]P!˻6߫qMbK K x+1}.Kt?+벯 *Rt=|k '[й2 jy&?'EoKt.1Ja(ޏKw9ֽo8Q߭|vqsVe*$ggkq+*N0zOҟ94|mPo -\|&SAW p`#ffYRhs͛.slx0/8=?&b/]yx. v zF,  Yzx>^p7 r_#o0Sp<_{ Ax'?\ p?Ux/s`:C^??ثw^ D8lp5ox=x; So%Z t\p  ^N uF|f\ >kV G> p#G `%|>1|z4oqi4ookxI `clpp/f(xIs~ST.Mci9gU;46zEtΉ}uUZJCg:N;G/wAB:5᭭%2Gz0Ds08/zϖ M&C.~F_L9vb!Iq#"ߟJhβh~ vofECHT8=N'6LpKHUy7݈A{> !ֵS137eҲ1io4`u#9)v/oyl$t= sM"C7Τ& l:ukh8тOhTT9 !b9OiΕ:z}/UY`j"W 0M}'Dl+8<I{R9^㆓2hiPXZ&oO\ޅv\QU򬪚Up͛[U3joqUMXRU \0\(\*?.v!\;x6wvIPaϞ=d~ۥlsU|͡c1D⣐-l=O]a5ac7P *!LNvpflz-֛llH_9)jN@s~}ӓWwLfѵUW$G/DXjRRw{F{c702z̡jqZ@=yCKt";VD+pÙ<CБv(X[VMNo*kH7 e$9)* ͠!D | >!%8:tKsFդm76I ˲j#R]+ (DmfH nB5 3 z,qd魣' Kwq>L&JN$xH.I"$dtERUb@܏Z†rƜ\N#_B2q8ϵ C0:쏅BXwdQ2Ť^^V\yIiljug[Ʉ$ K"hR=V˲';SjقV7IRK\- f4Tt|Fr Á sdqp}n1Ε=wd8yI#!_r呏G>@?ԨG>J~>|4ԨϱG vv%lcecp4y9Ŀf=ьq:ь F 5\QI"BqbMH*6.z>i&ߞhƗ2͌L3~!fp+;B 9**R^ɳm'!'nn,q+&xw$4.#ad٥|06UI*/|8`X+݉tQoK"9`LfzHL O6bA4~9Hu KJ.baLq%/8"g7sx= oz;tVOC.~oT1+K h)4mTS`AI`3bAʣm"à4 GU*>(i'϶BEU6' in|OmI\[گ ;*#NVVxm8:J-I;҄E:(kSI^k/z ?lA^)\YpB3|- =Հb;B:L#,/u~ρ=$uC>cczv\`J+ZEU-V4m5wRPf=ʕ'>[iLa@8Bf*f-rC7k~کx֬i;'U>G2H^e24i}L{֨!R`Gh (mh'Dk֡׺􊝣un;3a@S"MdpRVYm/|:̧m 5=АL!˧FҭԬ]t&m\Y孯ޣ^Q~ϸ tvL8CS u(ݩJ&XIIZʢ}.o̰'X/ ,L#-e-FІ|%굟mlг ߝqˆA)ǥp$ ޥ~mD!PgqEGBٗO') hv'yt7 vgHz28%hFl)PXٌ1Q{B |'|̅|@ff|=r}m>bE4*x⑶NkZB)V2dee tnr[V1ƫBcBcWWa$;Km($t:~ { l5_~(Fn22F\ ei7 l$FڔA15X, <=_ͧ[i%}5뫢_*.Fx;1ؚ(N a+ Zh:Zm]-*fv}FY.L::oټ*E{Tpdȷv. pdRmK܉3:č>>&n06514ce_&LoDbfvĤTzIתM~c3rR3 NƄVmڌH쟑7 "S'HdFuLMJk?jTx؈䌴L>1/61%IM웖mOs4KL{232HM*6*.El6m[JM LMwwbNr\TxX~C2YDuI0F"eIC:Err/G.d|E~mW#L^joj߶[|q'Kvzsj CMJuF`d{NiܤԌt@BkpW(|ʙkxÏβ:L.ueg ee x>ڃ$ eWIMr'_9۵LPm,2p"n:hVzkyV1H E4ܦ 5yS$s) u]zv7^nPMAs+w,=}e9 Qvf[ondvց^^&١rVJX >@ZI$zJ023Qɡ3Ĕf%u9)W嬈J<}1''J=]ǫėPY_FƘ}7Qlx*.{#W"P\r0jw!=e_w>X,gs1WJ,$кeU|n/m桉{BW樮WjيYM\ btUbgsixa6;O30K)mAr')ojf*|vFQ8jZ#Ay Wۄ`gga+_NWJTjI^|n#yԈpGVDD+bQs5+WԹPXk@|쌈qm 0A9Щ l=njvMl?UzwGϛ-yg)';"Ńj}x\/?hιj<&;pcoEb8j"za灖Er(1QCz^y3/3㸾>D7-"%|o75]+ 1TD/D| ѐ=ByCmB'R~UFMN82J݂q60Οxr;sq60m Q74aӨ#ؘY垏OIb8%h̬1wB?P:x>=a$© F^J u,`23}S2Y׿J1,ኸ-w kjpc[KmFIJMft>joxD"oc V9>$ VG@%º!}PYJ__uXw( \zfl­ps{ 6<'[ۘN۹xgE wminU.u66dDmD:GSd7Dk_ "+vV)ƛG~9DS[ZRx/o׵'c**>7g]-kUxg+)< ا՝>Cˡwsl81\Q#qܸ0|=֫F q=QP}4j|2{͝H*#9<}z}ӋcuOWX)Z+zjg*>7ucU묛]mx$GUY MI=ԫyK[j$jC]j*k jk!m^>ԫL_Nn ^j]KP_y^ֻNV1m{U]?S/6lRY/*e),9vSa{v4;mU""~j<aV#eJ̬j\nS+.lweSQ"e(;l̂+yS"k;0F1]]TWʯcJg=Ѩ5-.Vg3ؽqt2[5u$>㍭]ji>]{Qʼnjzޒ{9.˹+RyHc 1l=C?t,@i@r.嵒aMA9/_ꖌZ( /✸:=ѼT= ӎk=uysܭ\ZߌѮg;uYk_;Ky5;8dog*we;H$zJ^ wIu/w)S"N>aMuԂ"Y}Lgc:s=.w[F]*;K]b<+zި㻞1=ez(ז 7p2o7!C i9^N7#i;<ӕ~w0}h6K:GGkLj5Q/6&<ײp\Ha9Eb67GrrP"ɖNʖPޭ5DAJ4%qPzZ"K))ѐsP¾D;F̥3e޳i_g'{ͦ@}-+Hg_ V QWxbxNzҦ)I綈&j@fEZ'&cv} ՀHΘCKF#Ɇ#}CbFi*|c>I`9EZ49eefOS \!!|EgyZ땃E^Eg{+gz+T!nmi2V _+/RKA*p-ۋ w{5}>V>`ay" =pG^MYݕm2ݕLtGvZh7/ia6&R3toɳmXd?Ai>+֦wȱN?XSD; nz|TDr:JxwXTYqhf3*޼~ϕÎSfi U[cnw.;݁O_7=Uo3ҏgYc+M[Qܼ #;i^ǹ/9Np2>| 0 7ѐOO.'b`1 p9 p p p5 X|\ pu )g~WpeLA>`Z,-~dcoKQ!Eg ۄ(򋛺ok=Q("$Q=E~O_ː_#\ ~?w)r)v)q)u)G7P;|ߛ>l)))?ٲוnt^?5kj l*L]KS ÷vХczb,&- D66QGZeO4K>X (+ ޕUU|ˢix `&*d".RYjfEeӢ-_[HiYY\*3͙{罹߿bf3gΜ3wNA›QYx-4Ct6߹YK"+vzw>disp VJ%I Q~Z{*5qQ|$>Nc :.y当6 v"6U.,wxs*kw]Q|=jFVk}/H0ӓ5QEp]2?|OrL$ DϏA꟟Oȿ~ӏIJ+o*62t7=gNSa4ySK̢CI#Wc#qa$3FF66ˈI-{dܛ7~F?D+&KA܌fG!]iG$Dg"ߑ 1 62h$ G6đ\謹BWO\T0.؃FXn~h()aօ(>J =W|mtDr쏑ےڴZJǡ@gHWNNIrO(5t#)9B1fPIFJ" 0@*L^4oBq &"=p7iR[gC $h$@tT9'#htEQ-9Z3FFQ|>/]x'HդoDM,4kIR[&|>i^|r 'xdO)m_<|,0| hqtx'A40}ރ}ڻKB+f2 :7gգ@{c/.=(ac_l~#~Տɸz{؀ xW8"cgt1ȟh'>;c.+Fx twZ?|<^lx,)7ӯY ,NpAgh(\G]Xf1 9R>N=Fyλ(Q;O*F>h;o)XAX.*m0\3dFxa` >FWc`/왶 >0^D!0!t|$>0Q;e-6R7LCI40A܏|=dO 7y>03f  n`+PbFH+Fp zuFEUݑ<,R)5eV>0 .Jt`ԀT x>0j`)X)"0 $U.z7~.Fd`ԐTۛ 5.N(TOuTs !jߥ{  6F_Z>wF &iEQc"^BC` _[k$xۧ|:P,,*@ey.ٖV)рPf 3fGYeuWG qR!ѯFh Np8kk~58MdS9&/Gi"[T菮DS&Vv`NN#6݆h78}+ŴIJe>؝>"Ajs&Цvl>}&O_ܱSI@ ݪ~%XT%t148l:]Zϥ DKۡmI.]Hra۝cdے!/@("~ Hc?M,XvRf;<) XMv 55O~g i!*$|PHߍ rg?tb(-GZeJsQ7^b>OV]1ǵ$mV{q]b{+_W9Yu :<%r IowH 4]WL}{6ZR]4IZb@XO*%&ax o$OA-¦\*\[t |փ?TnK3)/D,@1KƬ"a] ~MNjm}udMxy{C%ndcuގ9C0! vر:bC#bbŎ128Ru+D#1!lb%tmNT u h%۲(18] %Rz r-lN?[O->P8%lE?[; w ‰(ٖ~F; '!^DW%g:YfhT {3O(PCHj2"QH;Ԗk`$Asy[G ĻA>gk~Q95s tkm2X::|=' 0^G5<G\==~:}pUy?-aʡLPm[I&?-w`<^-]N;P3cB`IsvFXL\ ?qy\cI}5h`I /k1&c`t A#zrԨ&j o3]>퀯 UoG_諕f0U퀯 oC-`оI}1\2d iKN^ī1<ڈY6._#a oG`|q$^H\yo OF[@ǿ8BD= po#j5@t?AxV.:<ZYբ{MJRMR%ςY7ʡ6{oOсhSSvT&f_<"g2毇'Rw\AZw#fQV2ۚ49JeؘJ GycsS{VG7so@rbw!|\J[I]5a-Uxol}1bޮqU.LSLֶiC7:=&bk=~7齝snUv[tz΄ӖRW|m\B1d.ѝ=N; {_6սB}Q=-5^W=o#*~[[W `y[[7mm4f(nmm]%ն6迧#}A/v%sP@ P={꼧!܋:yNnwPn1{#6䯎yu ^ؽL7)кˋhT`[4a0ܓ^(҉SC]$AHp)#*<@ 'I&L$t3@evǬla`&~b~5cGg"/ 8 c, h?7tIf/Z_1L&L3IeUFEfՄme;ė>UNDfAD 8DZK(0&ԜmV͹Z`5hxZDցfeȚCTZ;gȚcV֡Cɲ"$z\G 2룆C}`B$,5c,; aY"ѼYBHX_8/wCU}7i{sk<"N`n( H7H1H# ψH6=BHy֟u>-fv)[ [.0,nRt!0:K(L{(&քw$\?hc@l )voaAeca#ձ|e˙&79 t:-A㈖|1-@eiiZ闻s&hjc*帤 <7˔x}Lcj}81&J;I}Xh#9\6>&}XA6Q9'Y FU`&ʁoJn=R<!Bķ WL1 2 L%EvhPSEAEhlH^(R~[΃T!a7< lҀ4p@ֱ& = FWLIf\n=m'b~ O݂FQ3Hb&ݛf1,nC5CvJMpRB*U+0_YOɦS%x|t +0в6A{, A潽qTH8W[@ H5SFm n7Aƛg9)~'l!o;aJtv@0%؝0 NmQ=7]t=8)}s%+{:+y::]kςb܀Yq>"`mX,~x\hxtmTYKEu^sϵn{2KGp-NjTTe:bC;Ƌ +R#S+'Zޟ*6<+dѯTqJX#4ݖ>kq-W:> 2V|FEr#v~-?<ċm4<z^Du~!W\mx߆*\Öľ]T;tĆx}&߲ GYm|c}jjgg4GBMWNB]f X~@VX}޵:AҜeZ(n G|S `SW^WL*oRY*ꐘRﶄxzUζ&&Z\ycE$.",2_fj^Z D?Us!]YO6$=m#NgLq~9jŁw~\^_(h * :Gia:%Ϭɾu>rBĖ.O=hizPs@G;f~G&xSgHㄧ'ҝ0TaWlMpiEo h _*T[&jm.ZH )7J4om&j߶D3uooj=f̐`PWB(M`8؜э.f"J\޻;(r)is*sR슓x'x23/Q/L{R2/\t ~Fh# 䀛EQ,R*<ەY/+s,"$mGDJ.D${ܔDDPz8e6WqXWm^6vAN877-GnSysMzilX,' srgj)acʞ [2. VP> - BWEL,bb\Z18"U%.2!ԯ:2QkjX7jѫtsʅM֨Wِ+p5O:O=w5JV"e!o9+ÝȶcF^ZTIĿ[ KdjXel.P,sC`YhzϚ/m.huiVVH,CpS8[QM PƄ4CŋUC!\E]b 56[e8$7&%k^l /?qCduMr^eϞn۾(tE Ll|Up6yhp>&9<"/<1,FWm\ĸňuEX Wq.b\bsZ#p!Firzrdy]dfWzմ:T8Z]"E25k8`gI`hNNeQ0~Uٰe3Άl='+k"kĈkȷrXq+ۊ+:Nljv⺝!?f?#UY:T[1om~]IXKkNnX-;T2@3 _lFVP7-)4A3㊳εjG[gee󿗑YfMo(__pޚGppZ| tռK2Uh̻,iA.kLЊ9 MUPۂB^og^4z-ԃu?:K5n8a>av"%6-fpG VgxEK٣oΏHɃgw9 ot>foL5|5P͠ӈl,ec#l`Sžent"KwIBrsk&Hp-ǽvXv_.v& ?N*zС޿GT|vD!\84XH(jijzQ<OzJpx :$TwX'*m&yb/2][=fgI շ_3 62}1y(OhngM;@8ƒ AÄ/6!ni% >n:f(:S> &8p#nx0p3D-fn#J)j§ wN#IC ݄ !K؍G@XKHXG㎥,CǝO1'-Ը3~cܐ%%|%<%4.k\k\-!K8!ˮe72Aı^L=d %t%LoC4.d #DkYdv5ª,A dGL4nWv7>i4M-=ϭjk8T1*Υ2#Ks3 $]; oo^sZe*tR羕O4DS8w~ōg k| t߄4P[~ȯ hnNXwtTSc^@ 'טN$̚l "; >S_a3'<AuyZN.&2VZ06.! ?WFg"7$FB(KCSnv\B?g+'JFrA%#,N= Gl߼rGaa |V4C,㞥a "[]jdo2IFj?.u՗ݨR؊8I|wn|MAIXb=ͪyo4-%?PJ{T{jF)1r#[՛r#Z Qǿ69Fz{o~w-_6ǚv5jvn0M$:uCf& P?A*R{"a%YLvSaS?qǐzCUOL6ZuU٩ζUU/Aú\W1vUj.@b8T5ԟM٬<5L2)nՕgX!&`'%=_]ymUb G'0B]yU8)(Oe6՗B/$ >gVTFpǘ2uUU}~.E]vZ /-&oge?ʺaF0_3gf` ̜E/+W#:|١ : Af@%SQ3A<2etNDt8#bؑԬޢ@OYu^w$Cy1֣H1?__7d.p-_?se/+=k ^ߺl\8I~v֟lm5P1w_p.~ b^|^s P>d:F'ydǾcr5>['398]'~ݚ==O]NOxt: }zMyq[^G Ow>7uT-/Mb*/tzҍxqeɫgW1hљ(jnKGIC&ht4r񭑛>*%iPEephI8aҌS5OeЇn4㔪f `5yxd:_֖qxD #5M"Do"Ӕ.nE罕FJլQ.) 01&om dDt _,ig xgM6P Jy)*Hb("Ы PDDD KTi޹wwn2͹MWU%LQQ: p #2 h c4q@2d2Hgd"I@&y  d@f d@ d灼E ," / @Yr + j kz l @^  d׀l:7M n E@vd7=@> o .C@r@Q 9# O| 3 ǁPɊ'PGRDd(Ŧ՟,dzVwjf]RXf+fȱ#ugjIk]q~;uIj.LU5l3actC/cWeH:"L$^C hz-E5^cUxwI 6l<_juL^ة}'ߌCSon)YyZo=3Ͻk]sus.7D_OM`"}nԿ&kuzӫ׷w^tvX¦/or>%6qẺGgJV?-;y킗N̐iي޿uw"LqHRH gt0OkԆ^į?XiƑyC>e6*ch˛kfI/8(K i'N砿xܩ"L:Bwy) i^zLt㽙hg>ځ*I<;'6;J.l_7߷@=,b ?/@o@ \r  DI Hp v @"8DR Hi 1@b$Hd eUI?϶VJ>[)πH;Fm}wz\|P kӣy?PynŁibLxj1}GYq҉Ѻ/|L_3'vm;՗m<Yl=?]T@ʠPy 7"J@RTRH*4 UTr#@nr3[RH- Rȭ@@i @n Hs|ZG 4g@c]bz[q^.@剕4 -jiioWwKz7 47"jꞆZ[J}{d-?@,%IҡH+ N . Uq?$"ך^>]7f9JƒRR6 5q]HB:g6J'Fѫ"m#I:_Iيn M$ւLD@\_}ONz? rHn`e95I%,գ8qE4Zz-K n ZQPQ:69ZqWRHT &bA*dR-ȤYjA-T s^:QaM*%i@nLe јNjʌYJWj4*f#*2iʴ.XˌS̿7ݯqteŃ؃l>I+(ԥ,@IKV&Y2-̀Ic mr;@r'   >  t .@;@O   < 7/~@y  2@$!@ d( 2 #2 c< dL Y@ @&d@2s@['L7 D,ZЅvpjpfƅܺ|ⵯÖXmKU]ڝ/NgC r P32 l s2@^"@YdJvU!nw߆n]'nYg^rc;tDX! @dK@2 *}diB>mB{lZ4#'fmJIk\w.ya͉][{gਘAQ_ù} ?7׸y=@F iZD}"'XͷdmfD+>CB*ot^=}f[h A*6{$:Uos.lfzL#Y\(& ?Hhc+N^'Ecܷ=g+eWP\Pepw=0jZ=ݚ]w懴}ۋuC4Zp'XY3xN+9a|ڙ bÏԉ Uj7kbw{+W@* : U2w6646t<މ rG3zY/$QglȾbκ3n`ĚCwnWܽVg./ >hE@Z) [5IiDzկ!פ.K'+K|%t/PEڒ2VTsEnUFUjzyxnd.-Ɍd].Sר|bWmJkeK_&͔_h%͔1}Ib ?̂YM1dXkAV 2,Է LC 2,4 ĂLS2lH*,i~uQwci*̜UU;A(xbLE9Ԋ7f21_X*h|XMaAaVF(3g)e&uT/*cצo6}c F/OGfjk%Zo0~1ΩiTzi6{m6f-C hml?grhml[ƂkЮM[@66omlfت<1& / jǍρ bm, 1_gX*h|XMaA6O)3B\fRG% 7J]QbOs _9 K g|k w@R ' ?9  y "K@. WE/ $H$( @J) $H,8 @$I @) TR H @I*j@nRM@nr @j6:*پAld?`8]#Dj|Q*P4#e_*,}vҞ8T>LVqGn^v Ynp_ ޡSW?v+7_(Cg/ov~zd_(<傓幌z2eIjEnX烊&"H/QdKR+M (Y,#-e(S3y7Cm };%5Jf(F&a^;3Sߒ6{izXz m#^$}|gCFMUy 4N8h!N8ih!NqRiX!N8Ui}wIy%MEFX}L\JE0c$I2:eB$sU/>e3cX6sCx#T&2_eS##HjIQ/ Ⱦ\ߐr_l$$cUl)@s_ulb)߃P{+7j_cJRVbY4&TL>I/RFH;Tm1#d#C$+IY$)Q6"YHISF,.*3sF%ubJ,f6qF=,όIVV3B5O|AlnSR$OY0!^l#{{ F(|Sr%@EyjSTVS^y**R2߾\HC 4HS i9@ZI 8 @H{ w]@r@r@N@:yH ]tH '^@ȿH? <d@ q Oy 2S@d@F d @2H&, @ \ L2 d 9 SL2 32 s<d>@Y% y@Y$R T>ܙdn.WlDf3caP8|B"s+G:^5^P$2G4;͙,%5OΌWŬ*^pΤ;Oxd l<0nws'~CV{kc>)㻚<8_Xx?rM+;tO z\_k$#]C6ևz-}NQx2&з?u 3/5 sJbuZ}CrNI+c5eZ08JtNɷpNI$@a)2c1eAd9%2s+yr + j kz l @^  d׀l:7M n E@vd7=@> o .C@ri0km ,t @?}JX8bE3YE=jٞ2:,6T<Ϥˆq;0hϷ_O"Data generated by Autodesk Revit! ')PBCTԷ[t  Ye oטgI`1'BBBls 6`sN\T=Qԋ^UHQW WU{QVڪI ]w݌4i}vfvfvf>, &H tSpbUTfZtJPG!.MD:"Z:a(cMD2a~w\D0II (bF}-/ {.FphF5.uПDIgPc@ъsKCuP#B> olpC yjxMsTj(ֱwE4(^ C}Dۦ }l2JAkPߘۡc6wVѷfԨQw5Ԩ{vX5~SCA9CYMT()X*z4 ՈLQKK5Q ̈́9'7T%e6wh<5j9*a55NJjJ:UРxу7T.LPMTq{ ht{;N&B@)ThTU@ӡL͆GǠǡ''9\h4Z-AC%K+RUh:ZVA5P5Z6@Mf@[mthjآAnh: A{YvC] t: (t :B} $&t : B砷"t ]`8?‰ *L 4zCth4,XVA5P5Z6@Mf@[mvNjvAnhBm^hu@~ :A#P7Aǡ^:Q^V6%ƄӭZ"b FۭxYS1rM +ǖ;!Nڪ}9JDvt:ʿ9Q q]CHoST|;hw{k?M :7Dq'b>)-b9 tsd/aOCA<p! 65ҥSѝNB%NU;DNa_OזkUAMW=+/j r!,p9.H:&bgK1VFZ)38bfejWჴceu]mnW]7*K /⩉G͑~ode*x-(U'(U I3Jv'b*1׌R= 57Ů< jkK3?of,MKg_.)$~8/g*ZQD3E&b51EiD,R2$MsH5N Db3Tx zQ/bLzM\b6Q"%sGN&>&s^_1B41Pf鬥r2kU5n׎IF2GDk"Qn..*oeXtW]gB'5̟^sCw8!YSlz,Y4lbx<ٵvAOg)x2'䎞"x'b -Y aX8xJh6Jo޲њ%g-+l}/ndHKx6YfaWJK(OƾܲS"ʛHvsN=qd#T8EÓHvEU'< 39$"JBɫ+uoU ΫK:D/ \dj"ꙥ T("eB% 4&qXU"ӄe=Dԝ [ї-hJpG5cip͸Y!׫.q^M3c4f _)ᶁnF)tpyHMĜ2TT("N_*ozQgr1Q6xMyI$rbI:WoI;"+*~]̈́ {U {l˯d7DcI4+֊R1S3Vp6b$FVj\E.H/nz.ѩq3Ը_'>8^).҇$2CU8bp_elj"bd;tԢ$uT%>felk*+#ڲQ{lOk:*2 :4ԋڐkF*2\"#m6GB ,ʥ!rB՚u_l EVs b\5qD\"8՛#SY+`9TYSa6=kN*:E5b5qD\"m6GB'S{?(a=rPOεMu j6U"\zQ{s1QXl ED{.ɑQ:̑PDt%_ֹfSݳvMU8`s^\LC˼&2B ,c%29sd*rsC@>m1g5Tc:ED9kbD\"SmH sd*TK3PLdm t q5`xf = |#!D p| $g-LB*j[^UxZV+zԞVjWmGTP<ofݙ¡{3yޛ3w cc[!=Zn Bڃǧd$/^+x.D`?d9G 2U 9? i Q'K~k{yoR7jlOHէy+Bфy6ZPc$d #x@$!`\D\((#Hb9 b~i _,|Ш8lX޴ KS bBYm2I̦lnhBې`H1|A:9\S0t&>d8>Cvh&A hA@M'uCjT/Ly;^թFPZ_Ĩ/@Kg{>eS{>VeG ?"F}!Z4VC^͐1 |3/bQO. 1(;fB3FCѩClRˇkXkS~6:|XIk ~NZS>-sq0pipѹG[֡SWn9Jr[wbu =V┴u4g*SWg[B$PJBT/Lظ?S__"։a^ڭ{u.{Vfl3gu*{grN[@tܺo<0jj{n4ܺӉeR p)w#ڦ1vd V:_X@Q0eCՑ2@琇&<8@QGj6mCB֋R_fStwI~m<@ѿ9$#ZN(T#i*xk"O[2<+@5:6s}"fCƺ] |k p @']Оm:ȱ\N5[݃={ӂ! 27@}x(C;;CĮSG T8c|@p0 1< i3Sx3#8 ~p4S=I? p<0 3N8 `dNXp2u3Xp !iw:3^p& p y 0+_`.@lU? ~b.A~X,Z~p/D\rp5oAM0 k-n`! "(K,8(ס|,8`9+NX p:*3p&j Xp A:@6OMA|hM6ę PnAI삭^p`.&%Wj l=Ғ|h)eO`W+ p%nWp5 N`/{, wNX pr͙Kf<NXprVLUg<l8`-yXp> 0&f^p1- p)mv+^p%x1w\y/E9x)>)(w!)+QN^r jSנ.Sס (r FS7%0mҽM ƀy5BuGJTIiʒAHUn!('W6^X09j#VIB*tX| ݅Q-l56wԉ2 +/^G:b*:7lY7tC>ME'=hto̘nJ묫c=ji<}01eνںDlbnJq:NGgg SMpgnw'kr%Dsx=ե\:..%L=`9cր?c_" <y/0,?l pנ&O&썧UugObP :ipx-$5q|[qR^wm$W=f³<5i͟ˉܮ;-~{ٛ7<И#wMS -82,%LB< `+*r{zÜ)88Q'0"8c3x(^dQ{Y uD6hZScX^/lh\/2\Uހ-/ihdyCӥpU74U5i \#Fu\?AbSCS MWz z@q\"=1\ ǭty޽{x΀ ?؀\tl"TH!zExי|n<wC+aUT 0ApFܯoxdi4g3gy 5ԳDu-H؛jϣo" ќܖ[> .~ӣ,5ѳTݡQn]h g02Cwʨj,\_@^&834 ciPUS YFZW-\HQJMg #0ԇ;қj,邶tFPeg ʬ8EBJgpE}D'p! |A BBpN}/[^[p:/q")N\[`=_ ~I_3ԏ{6Dzٽ6EYݺ-_RKUvǨ7q̬qf ՙRt8o:1].> .vZIuݍY6N0^z :m{jK Ut<#>h"b%-A joK_{D'GnNSYhpifd ?C(SΌ^3? Fx|C~2a -]1o'1[8T^n=7qRz cxOYc=6?dcm}{WD,1L134$+˾vqԥSv:A q ,)sشqic_>hHq:lD)Q#)*"לKk>K)\k}Yυk7֣f^ϋƱ݉ǀQj"\Ԁ>]NB[Ih(EezUN+>a@P-dqih}j'K.azTN "knFʊʉ8^v|TDc@\4'%T_rW8NFWffeʮ~=+w5qD|; 13&Q7Q9Lmhs12H>ͼ3ƒBjX"F8#[]WHs9`|՛٪Mv祜 'c7~a‚! F6ߤ9V~AனoY}"Zu:ܿa(.  x#--íW+u4-W;,*6ort&h|Kϕ*SQdL 99, ʧM=#b9XI' #\A6,׫_GK\rpИySiǢ>h#-l%k^Т\B\si;;& :jpҦiQwpq=I~k.:+&.tQTu_TSk"9N̓c@• lR >ʴPzkm[gtԷ~[o/جMZtC&sB*2܂\74N!r9ϡ9roĦLT] h@{Bcu-{oGƕf~Xg^SG ѝmbk\ְ-KcoEG~53'V?#Vmқ*zoRשއ [.ySJ,9=l>.EٯpFO+fqMnsC2{|+gh%~4=OW9[J>z?~ޘfc\h`b*5AtN+g'bvkOtͩ?7=$RW[V6&']dRKu 5zG崖$!=*ZZc-( W.%Α sL!ө-fExkTUQ;yTeZKN[߬pZEOtx+Rq2i ^cmst}!M ^˰h OVij ͦ|^Ll86ϸ)E䵟k"y4~Wk);32'm_uKf՟љޔ;!S䪼Uw~O}&͝ ٗGmEcQ<˨[E]#%/߿v.pr(LL)m3etL!z?0py}|3NJyTEC;@U F8`\#EGŕ~*NPW du"l!Tlϳs/f q}2E>j`dTs\DF#6T\Tx)QٓoUS//$Ord\Jo[<}soĕDq0FT,֊3&W}%Oo95Ld$~~U,&S&Rx뜅(wlu ]㛕EʛxZ?t譈ڑɟ \ׂh \\q2}[UZWLTEF?jly{˄SAfP3\.Pnujͻ`|E6IDL?Z890E徑E]y_OElL*fQmPB7XdA2ę5C9RaXp?5<3T~7H߭—}[][Ҽx*_wX7vӷuUE+ơ|ֹ9owJx!6*nEF}Yћv@~Ψ#UO_NR[5a:0c剬žojL~tV`k>v0o%ɗX"(:#_YW}MVG[c>sR#;[J-1~miEޱ\PmX60 _4] PC? ]D/Hm崺JsAuI 9{o))||5R)R7)rgNQ͝3MWWǵ{ VirrK< 9R~VFTyo֑O$Nf U"Bc'}ǖrnHLg$3foU6z,97b{V@͵esjFe[``v矓)޾|b} Ïo+ubMtR+Od|pC|ᮞN͗y| ?Jd"ZPR3j c}z9qΏҢ:'ȉ6GvʛZ뜜lwV_X-|Ǒ޼Zk߾z-.VqEaMt㊐F+r"=#\$Ws!5[>([}Ilr@q.a':<[)6zklG$9Qzŕϵ=zEl@{UWެ3Yy,XJ?E'/bhWޣB晜;'53Gy%Eau㚎?oQ}T{hBՃñQu.hU xԤ~h(-9UOs j}3dbαqcgG5N,nese]UFcrvs,mΑy֟&ZW99w۪bZAH\,z!﵆s=!&}=%q1*~@;__??kZt 껀3j#љ͒mpiGEQz4Msl#"j6Ko|qCnxi5!_?f8c* WH^1?Vse9fW+|ov1zi 2B''!oN|<:#jgȷ dYOiblw~9j}('^/SeXciQ ZP`y3 57=ÿagg>]왪d#{$5傇kaA}=U,#glE9g;=ʀJ_U!2aӋu1m!QP[r?A,u9ǥ.1!պ-e"&u9}M ŕI*eխG 3MPd5Dq s[;7Gȸy)/:YO9"4O aռypai4Mco85C]G7O`^i5f>y77l"Y|F#Z6UBC>2p?@dOlC(g,0t_ Q#3̅$7t-}O=\[]B1 3\{yq;1g '-T\ۢ|03CO~}}'V0 o{Ӗ>h@'*Sll;FbzQiVX!Z's-ߣ4rv60N3kgh=ǭB$-A *O}WyQtҜ}[~Ar% 㽉SbLRoOw9v$QCN>8BʝڋX.߆xgͶ*׫1, Zb>b Ersf7'Fj$fit;ӗwJ: >&0pw/3vāS 0w֕Z 1cb K]頡)mK\E-(=ۡk 5qj"7c)*%PW.O]-QSp}_?pu1b-4_sgk\&ty^<{gz^%?<<_s+8.\w_(j&pFgNY?_\GVE pDszYhubFЉ/?L2- PZ^G_Mz/1斎*4,73߭d;<ί\:$cfT@{NA' > 4_wk!. E47 tK5Ek*mۆV_{leo&_|h7Yd7/ȰdD<OI = &%ɧPZ9'|P@\5XF0܂W}+#+{ {.pWeh8Mtְ]A㕯{tiY8 3e~,!UҺ ߛP}Y$=û~8|͖m@| m;Vrzb>C) עSo7۝"" h=諞4+x=qoMH5}~t?8OL&d*ΰV'H$sŌ2"F"~% qU"+0̯$bÜ'T}ZB\^{[\ Ry!s |(P$FfׇVw|: z Ù-;@+ &Ix.2&p90<􋁗y-û7\ZK%^l%\ڭlb ĪA器\7uY^_*5Vvr@Kbeq]ሗ%Κ!Uqg̑OSXCbAnKEK_bwPCחMɈ5k$C.;GU2buhQudnJF5񐝣*vMPФʴ%#+4rr9&$N&J}?w?e2VmiCn" b 9w-sLQwKqkXNA }c3ǤF1kǮSr'd}J|M?VNVE'wOHG,!szVfC-KϨ p~v[{j?W*p~wls->" ͡R|_ >pvmoh57m9ۢ~(`P(GTJƷh(߻wVb_c~h?&lnޫ)| _=~ xXsa;%\ᚂ]_ u|?S z./=A^]IBsi3Gx~L]):~[~},7=翲|uρi->7mI .dkQ΀/[[s'/CƦh%G!/etAK{̍_"Xt dvg}B]4AR(\TB"!Xv$#Fy.[ΘkU? Ն)θq'‘sk%W`a4ݪMhP,^WU(ӵr7@o)WhLS'T6Ejװ]n.>D82m)|V\}@m*V]5 Pk_뤻ZzBXƾs鞞526\TdybOGw suc ~fe]S쵆v9M2S8F :fEpK]tk` f]QQcvgnl"Ytv"ѕ!G1?U\/'me>վR[-T|v' z e+3)Vudme.tN;vWy0%  A!t/;ءpHC>';:w%`|C2gLp1S:;UF@/Aתz5W< ׭QyųS| rom?wL5;61!@[vqI#dx>q~T a0^B3b'cy/6XB67\޶YaK/N}~zajk@W'kTa4{ N:7cA TyYy#vP[tB6L=B쭪doma_kL6]Әqx9Mџ] -=/$/Bz?NՐ鞄n vp70iS+wf[ϷX5K'ѐOY[v|^dxNz KïpEx ~, p4rN%z6j_J)X1HU4p$%_Y$dd`ʫHFoU%6֫%#M)xQA2m\'ř>Q^pQ$l2ɟlDIېMNVIB];j˄s5mfy,& Sq俈]o|z`zd(R;S\j_rE3Evjg*$Kٵ_kbujwdaQl3L2唪vx]1wdB?]˖.ԉم投W:6Z4tS'jks]({SOP'o1&j=Ty>f%1?L@[zSٺdq!㇦Tɞ'js!{/3s8G>878+ЗtmژkX. G.U5X\TJ?sp]ϫ{&穓癠7TsuWƅ>hy:kTy^-9OHPɮ%{ 5uRu׫]'j%/TL_pm q5t g OTAcw{+X {GQz؈ 7cxl *6D|,<8 7wW>eR1+)a;7|||@F!!_ _!co_qod`/L3B\!bA!%ORdd9dd%dA!@Hd5d d-dd=dd#dd3d d+$  쁄ABAC! !CÚyݣwYLjE޺Q`p}np]tԐ($@b!qxH$I@CR!' itH$Ɇ@r!y|HR)h7Ids.UE^[2o*?j~e̘Ix#CN˱gQ헪/p^c/:9'P芰sMguz:^?"vT7eÃ.bK쥵mB se5>0bu"{m6{=s,^ V/uʰE,ǹ"CK'Z\n[̵"/dD&dŢEa`6b8 LieV8#6jGx4p3:3-u=%QL(?|~TWEUz#d*ۺI/RQ~% PW1m >4A@s@kmA;ph:Ca#:HtG FqGYzCx': `p p`9I`  NS80&tp&3Yl0LtpfY`6s<0, "8t[e`98\.+Ebp K|߀o?Og ~?_o 0 "**`0 pP 0l0 y`>XE`18,K2p; kp/(x <O,x<^/*X^7-6x #1| >/`= | ߂ ;|~?+ P2hGPT@ePT@u[AM ہ`GF`_A3-A+A[ڃ`08 C00D0\0 B,%`)XV9}sr-YiuZ4^5{,!^jZVT=iR~+)AH/hxF"dG:WSJJϕ+dkyZ)v7yJ^߯Xk R:z)J1+(,?4i㧭ޙhNѾAEZ2ݩTG;v5/1:?ڮSmW}*hvOݮ͙_ݮ:j\Ǵh2䌴]*z&ܮ%0/㨪MCŠu+og@u6inSs/!n橵}33hӪ6mnSsLTTisV656mZڷ6&m665wDA6m-QsM=Mۦ֦rMK۴M*3QqMJuԴE6&Rݺّ񲬽$rUxgաDuDťKTpRY:կݮݺ[]zӨqfnw_kؼeִY bRX@~@~yՇye%{5s?UH΢,yz8u9\Mf)3 'V%rnO{%2k9G,z#n#:jNsfeQ9Йg.5):*_b+-n;F4f,;ԑ1ȺtǺVaճ#;,?{cDvhzщ"XJ#ǩD*z$"Cr^NSkF*zTR"_^+Wqd3> GM-5}$*A"V\?j@>*6T*h?@Vu$ʵɄywb~G^ELOWD ^b U MwJD8xbIdD**FU.K^ Du%>8R]"ԓb6pr5Z]oŞH~LFLTM"$od'Rb)b]t:ʫc&-}2-SR5. f_ٓhHijoF;A]t~|PDTST*RwJzu֝)gR"5(Z~gF,?;yΣ9Z5%)qޣښmƙ0LTLUijZ~Ō]jfW4IMaDUgM\FK"~ Tf\1/4Wl'}]jefl@[%S>KMXuzfnSϊUNn_~VnSώUMnkg}9ylrGYfo3QsX '^5Ǩcj檣c橣3*Fms 3*F/3G$:cX(gUlEbIm*Ij$uk?qgf]D**"3 odԑTT,WG;Yȑ7r8uyʫP]"݊Dúi̵gI_{0k2ѧt&*/VV%q'RQqi"U-EAezU|<~bt07Q.U p% Wk:p=7p+ wZp7 !0x< ')4x< σ%2x ց x !| >>E}|p%R\.JKa&SEvM|Oi0•!] 6Au:D g \ajo UVϫcO*7Jk|ZTGiwH8/>9Қ nF3QZFxo\iq+c:~`bv؏cfk[smb"PO6n\i)i`P-݈9]ι2aӞDk"\[M%ݐjMݨʼ3xzןK]*Wx!jtJX _XF{:[Lu c6Gm(RQ  *ԫz2J4JJ|J]"O{Y%3+d\yW;QWHg+RQw>TW|*hV7E**^rיZ%u%J|Y]"\rUbtG~4ѽ_D.Tq=/5Kފ{M=Ū7Yq{uI!}{ϼoH4oo-W(D[$RQv*K!od#x7{D**x3Cj%1'ψDZgC~NE_zWZDogw&RQ_|(_X4h7&n{ ,?\~Q(D-U gDt] *֙(I"Ox#c&}Euyt3?UH%:X!oϿxṳ{U)JtoV؜|*- l jmlv;Π6;Az`W{`O4F`_M@Sp84A Ap8!= G#A@wp 8z }@_/(}jp5\ ׃p# nXG4{ޠ!4gal\c/zv:AӰEjY#>:+E%z*A8b»u\_s;㦮OKݖ(P%|2˟y͌RDVm7­E8$~?󚹒6v` u@xַ֛:-@ U]U,3 %U]U"v E7&P֌hsm55ykI.vct?38$qxD͎^w][;#/hEoHUTVD]**Qנ@(TDX*vQD,TI޳K:U])K"*Ԫk*UK]*xW>4<V-F7{ns&ꛨNJ&蚡3QTݍlPw#ZI%Rپe*nDw]t#:6ixэ.Mt#:6hZ*nG݈μf[q-m$V*^[mDgVk-0Ftm-ѴQ[՘oVT.w!ڪ#੡aܠ=ie=DBĞ\bW#KSWn,1!1j^=װ*m+RmDc-ʵ;H O4gNr,f›ͅCՂePӦ;F_U#«)"1H[LQ`9,GqCEOxkvj{=(::jWS촒|}Lt yW#DuokE, R~A&d>.0駉UhBD-_ϱ1_`[Z=]Ԉ-N^&\<!Q:gtbs]S+RHzT+WC+Ԉq5bfR,R̮gouN]5btM$9&++TS]ԊA'/.¦.yܿ_O_(=btsL_&oYbQzV)7T^VXpʣ +݇fMIZgfR]OTT O{bHP^U1+q^~hʅ!:+}h~^bP/ٿf~,yS-n8hpÞ NS80&bdp&8 35 }Y,Lxq: mݙ;1k [{d̚Y]QF[56hgj:B[ptuE6*3Qq:2{##,n+Vڋ*QDmƚwXSqZ5R2h V3:u՝V:5HEuۍT"Umg*2z.t&NWt&jPHE$uMT" -Dݙ궳DY8[v%HUoXwOOUkJ4Ӳ*.U$ۿ}RYi>vS~zYK YSPzO?U`u"b/=@wf֜$7{~e HYYsR}[LwHEŜDJdcmWKJ&YsK3$fkD3O^q7f槢/Q-wBH:BM-[$-VX;OM Γt%1U1D2Ɩ5K%ej2fyh0o'z`WJg悬պ"&RŽ!{X=\=0 IHQ&{E.NEuDuf@N]"遗T[nDwZ&h$?n^d%ZJBBRE,UY'חѓ FLT}IwJJgI*N krJRT\=\=0ﵒq ɞL;QwIMF15ݍMj&fqǏfIǿEEUUM{R,M%Ly+estDsGQXkCTGu$TQ.ITkQDu*݂T-uTHWծA~Du:$Qݯ^%Q=IT* S$Q=$aUTuT=,uTHzTU ?UJz,QToMTIzTG&RQQh|=Ō$ccSS泐es3ss?j$/Ԛ/$/՚/%jz++kk[[fZANN٨lhWkh~Pk~h~Tk~h~Rk~h~Vk~h~Qk~h~Uk~h~Sk~h~Wk~hPkhTkhRkhVkh i^hzhhJԚ&Sd|/Buvu䭺̛'T(LO0o@JxEtc$Jqw #*8s˼< KWCGMX]:,Um t[WTTU5ObުUXU*&QUUMb/:|۹ol)PkjH4[5[I4[5[K45 _Z4)U|wy\/UqV_z_ū5B~q[e2NoF4h?%/y*ǞAOĜhv(~IFG jB7;ƞ"sunZLi&% uqk";'R}ɳCP^UT*GɗTbE** RG)DVLb1ɕ1Ǽ3%h ӨmcF\2ƚ'clt-bT$JYT*RkJtd">1FVdf>DrFhL*H WOPr:# >/`8 C00D0jMZWh5%jfZ3Px@xԠĊrSXz'io}Kc:a^>gb>*3 [*d'1`,8N ƃ0dp&8 `qf` s}]ihbt- #{U56qq>5cN(KqZJoduWѥQVw&*NUGf2odđŭVz$UAńDkaMDjd|Qqz:%fJw&Pw~[LLRw;]RTLvɣS3g5gI4g5gK4SԚ)TfD3M&LWkK45H43ԚLfD3K%VkfK4sԚ9͹j[aМ)6&500R!3 G[ڼr&j JiAY3k;  D¬ntam/RkI4CY[,ќWu̥r8.Kᒸ@sc ao*$ia_ .`ͽ$^nzalz6+)wa$$$e96P&ÚOuIGEǑDZ2-ABz?3O\ 7I AU3Fao25ULmgT=olIi@3#'!>::z~0@3<GCu EuANG;/Q;: Czѷƥ]0p 0wh qn]dGlP/zʕ@'2 vV#+\p$HJQ&AUrX_Q+W4FJO8e%'.TEKy=PJK$퉴-9孿Qe ;?K Fhp:Wp |+,8|| NMp8|\tp .|p% \.WWp L7d}.?,?`62\~ ?W_!U+p p-x</E,x /yO9 3x ^_[`>x 7owo莉,E,qަqޡqM4Ӹ2n`u=@_z`sp c( 80 ; `0 # `8c`8_L%p._Kp.ERp1 \.L0 <w= =}[$!x p/x<~S<X ~k:!j/怓` xLς\p.ρ_σ+ JGpx|/?k+Zgpx| 7F: f--p+'&Xnoow ?._A,怞i <ςe\,XD9X V뀏z>J<X He`5>X| `Cl5&`30 $-l&-D0Wm`0+ P v; P`gp=%hQ&0 K%hI|$q 8 ǂoI[`2KЃ/A7 ƺ Lw;2]p9G7sg2m%vE֨ +.Cz]*ɀK2Y,Oe~YMcCW]3wy9;||ۙr{Ð,g7=2~wx[s [ƼdKg)Dc drj`ʐߜu1/X(udc$AcE~5nvwr*uNZu܍i%-la1J0#s &att{npjZa1\zS%b&T&K +$,G5/Z2iQ4ߗ{b[Fʕ| 8=zIi %dJ^=XD [ Te.OF[C0rnueXv~ f9VNeJ?b4&oi{Zp6RO~E^s3Z30:C# Yp{N^Zr۪rUp9o#;tho?7f0]^"g ¥MK(܁Y.o2;[E癏ß[sŸoPy<<3gn 5s:18' >$nTs&[:, } =5?5p '(iQԻcxY10cj䷵7zZ*E̽ &{+ps2Op4elyhnwSѨp{ҩbc7 fŢYJI#RqlGei ^lŶXM2l[/6^>5\[1_rgRZ=Xٙl:ys[unL(?iUGAOK-m:T3V,kcknY[܄[\e91K,OͺѬ]Vu#s&[K\ѬͺQ/HHfVoݴVX7nP꭛6ELBF!ي iY7 G]n]yl'54/Mۇ׺}W㍾odݴ}ʻ& R keZ;eh2Hr/&Xo4Mݖ8;)\QI5FTH_#bo޾ Q7 z]훷~R},g#?ڦhߐȾB݌5&wo8qvs7^79ɵ7,'AfXĦxGucJuC*`݄j֍fpu)Y7%ߺQΙ~M׬WސJרSotPuX7MǢ~1?^YyE[Ѻ!-#j{)!hkM'5gi;g8Z7Դ5ÃeP-S$od*L,F}C.`t;4FS%NoJ}u4M^o\{C*ߚn:-LbPc]7aEo>ѬC6بhߐjtdW9~O;8JZ!;+^'| 6>Jjn7Fv<2筠+fQM,F%29t(rƌ |jsLey:!E_o\[mE o~{]Y›/9{QASSZgc}[$gMߜ|_˽% IxeC8wWEbF/}ޝS}UΖ׽vs?1mݖ$ܻYgX[Ey#ʼ~ =i퀹loIZnd(}Y%w6.Ykftv;d~FgnN])[ވV&}VѨjN)lH4#Tw-~U(Uz6}5ƼyV>. =<\y6go>~95tͶlWr>#e,,κ쪩?hTnIl7uYYiu~yQ!H&7Fm한ħ>'-iKjBZ ]h]~:}&BI/zMRgDї:GYskZN놤6Y6RMCyE'%ߣ/rpA*njΧrNTϿ[>v_+:nI(:<:FjztW4=Zӣ%5=IeNPG?N_%ѣ)4rztbۤMY^g/s{uѽqj9K"<] I{+ךo@>~OdD@(%ϋ3~ui4Msmb>7`-k%I0bJ1`ӑNA~ׇNm"FhIgz>lT'|1RZ "~9?v)~tS&y$k ]%T!<,"s qv2)&٭\)ʘ9ixes%ь +avOnآɁq&TG#mboj:^(&V?~ysiy3Bgqb}Ӊt5tm**UCMi󉗖UdoUoГA}}}i(<[k/)&^SG@UwNt-̬q@9Ӂw/sKg:{xM/ U"rut?5o}*\}?UZ_Sm N>QYt.WjL3Y-HբSq*QWTOrR~8mn@?22͛dYFQF07=7>GFTedX,#YFG\̧4ϱfܿ4[HĽI#mԍ\.F=,'liMj VtGgx+=:ӵ)bGgzb |':ecRgm$B$PSna?5o}Q/LW95۶1Fr}ayT'lj8Y}iXoEde@gVslo͏t&}A:pdo#WJ<[XEt\ uN#2<B&>ت sŚ¯R 苔`l) 88 ;BVC*P1m)lޛ!#GH,Sm~7"W?;d6GͿ{n /< 76J,t5|z Z*^m*4]* |g:ٰk>wh~V.S aRTH`1)_KKʶgӪJ)VYy+aswp@ZK" 6g%ƧydQVnm1ﯫ}wFdߥJ^dKvgnҍJJ29{BGg*361weϑH㍏q^WQs^Uܣy=>#Z: PZok‰@)+Խ#ұRo ΢FW qmRyhn[L1PY<Xud#Gߌ!\o_c?~mZK2cڼ]}wT:DN[\f/9.vozvG 9nOaOU+i9!#*kӣ˦XxO!BI+[12j)Ts"qlɾzv֫;m}љiDfӣ$ IWȎqrY 9N_ٚwNdOT+ h`{xݻܭRixXnu}z?Y"8-!ʏMf_{ksMNڋZNGy?T;{)t_UY-T>x{!;9SH5$gƾ{f:)r_Gq8ͬJMꖅ3o )HsE>ՐSmdĉ־W}ə}\ UªiE}Un +&Q6e6ҬdWg(DNz%)~oD8K yP(z^\/rG8}ΙKLY@9jߩSa΃9#^]dϷ!\ٍGuWc(l6|IHYFǝ[!8jucӨutEkmg#c1a'O1Yjc9Tg\K=V9%Ye|r֑ʨm^iap QFV v%wC4_鱗m12xɄU`s)OfЕT!# ObgJ(v%5~n+5{?̍ z |&r]^B߅7+PH9k|ZeS.V2Φ8>=',ptYۍS5ǻɿ|{4 -Bncg(Q N[DGJ$_?v߿t45a/o3TS`^5in푭-:=VLݮOp$V])G;nm =YC1eo=YslTr.3qFL+^43xM^ݣ*\uB(AxsMWg+UՓ֞kf]u‹TL$D֯U5@xOͼKmڌT֔ѵ?=nXFzk\7HoM1BO/ty3k+j]89@ŹS<!NKeoANp{yz8$gdcJt:EO!ʨhh8o#CKjg:cv9.ON-iufF*garMμԬSoϹqwn{3uz g\a3MQHPrjq΄K]^uߞz~ 9W9=lJ ~u{F֮uz=>v]g~Vɽ\VSu>Y{ts!X}ioaCj;Ti՝~xRuW:ҝԑY26 {QļEDEfC[y*[38US^öOMZUrԸg/Rߥ괚FdƞW˪gdc}oبoe|=;"mM:\s5th}v7>ߍ :&F"9қWN/a6_`38FMl^"kAl=.~U!?9xQzS)ק3U@e i2ObmW#u,u]vzODu.̮<5k|X+oߝU95f#y~#?*swEUN 4cYyl'è^bRϱfEX,~UA__@YKX_ FH3޳r}zi!ΌkƳٴt=ZklP5̣c˹?L:x_>=S_d+x=lq|WE۹냝}V-@qó{]9e :7G ѫˀ} 'sůne/:3m" T(1EMD/ 2`"į 2UsIɬkM0@n 2n`CH!7<7d -A ddq>S~I| w |`3('\ wsy.ɋH']H'N/ x`8l |To,6%w  5|G17ӡ~x/2\ nP.XrOk>W|J\p \ p)5|rklqd[G)NfL+5+#AU9 %8ϡg'lK1€mI|ДU;_6%|j={|[mK Aft*CSe9 ,5T|>/"2\@]h$Uy>$0U99CK{ Gpmhv?#~کŗJ|HMfp04{hMNJR [RjȢ\uU& U;TUWWlXyREݦ^^`6656KRU/zߢ9f +WUw+;"V/.:/DtbY e-$TēaTlTp8cΗο0oЬW&9/* j_{ȱ 3HW :q9QƥoW8]w_CK-E Cƣp)b4'w2xQnCbetM؏O iiQJNul 9A+ vH:n$ˑ/}7Zϱ`kԪiw17;FǶƿ=߆4$ >HhDc~ϠiфĞU@uݵ %0!Hof D2fqH!3>>#*pCO`LYuU,kJAYT:L)W̲npmUVGcpmk\Es*pk?\P1o:DJJJo%eWpb9"c۳xDPE@źBF'6wRB r8v`> %Zhˎ et2|q`҉h\8=ݤ=,5εTݎa`aO02CS&k8xTt N##9|ab,]qy\1-,CSZ(ָ\PkJ*2mJ7e1Y( *nЇb"a#2$$(Xh3%-fyyj\1ıi-\8kq`ܨup'DClFձ$-gVK%[VE"Q_˟9t!x^E|pm7 \5֩G%8$N >}@GU^&-hk%eoQ-{W8Q!-T.*קQVղWzK"yשMRټ g~w.ܿ91_x;DŽ/x<<ˣ7S;͖?6Ʀm{W0 #/iB&e:i9[Z~7yXWx c-, D4m ҿ_OOĒ&%&RmSЦ )jT{tHu.3Hɜ _9,-o /O-B,=ɶ[<ɦ7?{L(KV[Yվ'<z4=6eV?y~>۪1?ǀҿߓ_͘1}u2{ DKϜ)}Ռ ҿIZrb BV-Zʴz$D%EqQbx:6rkyHJoP&fx9^C)^ _2XSs)Ǜx|)6mzD}!AO<)!ohoO'ƦyɦSx)&<))ojo㛙4'$S|2O67M-x| Sy;U0Ln4Px/LsS4nCnإ+opeg{Ü$vLֶF'!i :c諗uھ?] GrEֹmT[w;yQ杪^Ӆ^ㆊ1^KGft3~ qwN='faB_DqLDIgeXi 4a4!ƿ`MԍQY F‘SԅYu6ᮚq_f;9b! xq\L dl"ڝ:Ȼp;+oSxuewΠl_pP'^}AU>lQn/mr+ue:^׶Ԝux_ߪTyKL׾q?q82v>^WN25掕lj:fAAaiQxVxx2(yQe^U'۫A R</_w9ƯOo:_Wk^ *ꢁ\yo/#>~@?g/O$DzY/J6MM^kozr5)sZ{KޔjGOWxEKbEX5=p2B5E]<{.Rr~'rD%S>\ chʻ~Qy;|G}ClLG>FDjHj xE+s;bQ1)WBcAxf[g}OBPUؚz@}5Mk{wz߭?8 gk>N#Qz>r ݷATЋl@|zECu? q 뵻l:{T؋l\>=i)5ْO>%{M88,(Upy@wQ 5|y1T+ +|0`BhQ3BLFX$nMhƑH`Hi`}'}pu17YГke4tZڝ=akSx" /A^*~ I⫽³4% “'֎'2,$z,+<`]`]D`)wL0jC_1_iYrwGu6P++ ~BvY0dsΟyI?l] l1tGs Gҝ omk 1&:9| /~. \ ·AxQM 8%7vgr%`-Ep^u#}Ddm2*>"Z*CvZFE-e4_"'/}|ј]ɢ2,%?͟,ZK-,g7 Ǯx,ʨu1d v1kJ;ó ‚$5qgϡ&}z`ĝGA'zևR$Fn||{ Jjg>=4#lbkuAU/e_L}dLL~2NPgNdhZ#H?mkif)7onZbrY1QlsKµg-vtE!ŇEcM<7.X(S^ts j OEU [Z*{KKUVUmuP։Bm2?/P1~cyPTSK4b;k5Iw+u;B`NX 8k<Ɓ?=ju%)؛mN^N~΁l"dJ^=$8WR߫C˃'_ywA#3;G懼38μ'0k?w}y?1x?3;ޙ A.|a_ [ mvݺϪ$(b{x"@Sȋ~&Ht֯: oCu8þ߰.;k) k =zVL+dͿ&#F`a G~i*P$AgtRtV*F{bu\vDLaL 2 3\2.I7ҋ&=7u!@5~wbY٣Hl؆Pm`u~~īQoqѕf+љS^ݽb%):%[T?Åq}:{x#  ԡ_ W3 S1l"IUa[_חP_ص|&~Ȟ(e`[3={T#!>pQZup!ѫS* =bCTt `m~{{$= uժـIfZC)W^GbjJLXsYbbᓑf&}K-K-:>j0\Oм2jy"?Ƣ_5/1s0->Kīڀ~׍xto=n_j9W)$edQ+*Nv0`yO{~+ ni)|=M$sT wOk~.@D@4ykĄa4Jb>)M"6u Txn 5f3"$B $YzB 5 ~ 0{(&B9mx*Oޟg0 `$t`3 Έ. Wc3`7p< ,=N$ p2> Ů `&p130^Y~xkpT@ lps8C.xE p(|p .x!kQ qcnx/,K>ox)WXY_O_oޯE9Xp=n@& Q [P.Mf/&Nd6?=9%%kz2;}2sHf롪MB!(# a49p(9=̤i kt/t1Ct8>8 gW:$7+=8T.xcOwb̀`e'ho,!ѥ]lQ{M tbsEY?k#:dS($c>- !"S183aҲ-4[m"K6G}wmNT#QqvcsE,M7$ t^(A7jHcJ4F4旺 8U7}Xu݆RG%0!na 2Ã̃s 1)86 } |Cev!\{'p]0K*5b*\U+cfYE76* ףpm1µ e=pk\xh;xСC?[R6oqU ,ߞC۳1DQF@źRxz \/T&S\>,`u9? WDmJZѩi2Kt$~YtmA!&fq v 3O02zLjqM=yr%~OKˡL4xNxɡ)PHGPLMN*2mJ7 e$/ ($1d5^0iVȇ#ׇ>/#6<(Z{n:bv%$b#! 7qi_9W(ĝd Qep#}afvX+7#vF iESCZG6^r { #Yv m($t:u?=l5@~$FzsK#.xs6#mҠLAOj>zWO+pnPk7۶< v4b5QwEmt Cغc/Ť}FY., ZvҝZvlԮO mK[KYuo7m»_:p}|A}M\tA4)]`z ~+ k|%ER\]68p$jIyq"&TU _’’ⲢZ/=b7GG,,|5)5^oeJ%ޔ4GRoWUQ^\]NMININ~sa]w  jXSX TԦ vg-bjtH em,tF뎬v wc9=]^M7.ךC\K0%t f$|&3{=玬a6 CsJ5CXGL1 o]R((Y7'pP n˒36/β%uEeׂ ee2Av[7:9&"2s_n)ZPQ]-CE]yhv'WhWjيYM\3bvBlLaArsfx*I\&g`At];M;MGM?y$(b[Μ,r 1[)b0u@͎Ջ/mrza1=PMmyuCOŴ%\4u&/=Y;;#j~ ɠTTcٰ.(X;r:=i+.}[G!9-f]^~4x,POU-|1uvO41|_'̖d2L85=3KiS/*jҋu9uOukDSoe/Uٱ*I7YLћUJ &GO~791?&Y:b-M 9lϚW"ºCiBÙelMszkMd6.TKSOmmq]M{?j_so#jCF.F4.oj1EvN$zJvMR7p_d߿K:Qx/Nl# +{ܣI`X=- Y6_ޥh| 8dD')+<~ugD};>mZɱpY\!p lX+ǭ D-C(h}_N~N\#w$g>Q=gPzMT?W{eHenss~Q76H%f(jGrzt MQ#99Og]n܀g\{0xQCCZfoN/ueRT穓lkR#2>Oj*S[5Ohdg fvzw쵿(Lm6B3^uV4n;كR8䘫B+TmS㉌Iˡ̊ yF?ylG~j]+?q*2]Ɗ"6|,r4Fx# l4E@<M\~6J0ϥwQG9\>v1>g4{d8_O_u2[AlN|}mlVNNrʹ{ x ?ZxQ s/KrpE}34?is:qx9s-c5P}| %#E2)%~ԒX#Mvwׇ۠ӼTyiLj|]%GnsߌJߘS+2{~ ;H$zJ^ wyN^,X) =<4ucwkr=k~K / ՈH]-0Q@e_NXo[$zJpyϿ^҉›L4}cr>RxҢܶtZ3~[^#.9][Tm?gDQH]h!2+}Ԙ?3v]NWg,4όE?L|콩~.vFV_-^&KZiv 'Ɂ9r~ʛm?=zߊlrg?-3v6iܜ?U{LwccPŢ LLFi%${hU\ p''ӹ0`Vj%,hhnՐRnK79b~w=ϵokBu郓gms/d;Ag?:r2:esڏاxOo5},O~{y8NLj\1 OD|=BϢkFkMFs]qޝʕ5#lh*Rfr7ltcP)iٟ-Gii^ \?0WlxW koi.mAmMhRhЗ ᣿%Z7Y} D a=-D-[)AvDi0%:Jt%"DKDr)mJt%BؗtGP!bDdw 2zϔQzϦ` Q7B{0}%+\3+Bg_sJӕ6M U=EUjlDlFTD{C~>a`"1Vh8";Dd4lZo~|X(͍ETo'}pр즞o>R˜yr˜?Ma& .cpL~cRE]yk"w^H{4C믺.ݠs P{m+ĽRsU씜(@'|TXU}|-"&8\#XQ,5I] vW0}W+^9Vm g4ݗ}ݟ ]|>SX ާ!۝+֦K嚮қI?XSD;k8 b?dT}(j8=!$~ġgm'icr*#1v]Dy];XOϗd3aU'L~ͻ>=e|ow'=aDy[v;XxTlp1+vXjkv=2px5& {vxyw?B 80`N;  0`2Cp! G8 p249???8M" !pxZ^Sw'd_{mI˥?,oǰ.iDi/Yl/.L"J{qsۋtKDi/!J{"J{ha{OR;֥}\J{?t)=RKiuչc)9Ö!h!g8[6>]c vó1?_55@0hvi@A<6;1J\i"g^FNVA{$5MhMT0tga9BBHeitg v 3n"Tgd"槯Md<]l#A?Pʹ%_rT|I\7D1K0#;Ѝ)c!&8DtD<1xPK͡4]l#ICIԗN2f.)§U`3ެwbW"jVgwvQqbQRD~tDRҀ|":H%D^[BUHgbH%~`RoMI$R>KY3:f:Uu:jKp3ӭi1R E*U"J#pɰ9k_?y,)6)ybb7~큿bUL%cUDaXx9VE$FUcUDaXx9VE$_JT(р&P4QMU5.bVS]_Q(crLr2#yHxá2{?8}х*ゑ,2ʐ tFZw@ue=F]F➡9l?^ PWu͛^x4fD2J?##fgcAYEMt|Q{p|U{E J|=8jXɎƒc#MZY\UaJyhem^{ܨ:߬:ߢ:j++$q:T~se饕r4 l=-JfIG@G[ < u8Dk9B4\6e9xddj 2OFT2cw1v߳5nhӞvqLO4zg,FKL 8|1V.|9]gE_NSSǨinp|9. s& ^GzKN{*&˫<da˻~&n|z $ULQSUߑ!Y ;dmO^!Yw 98?ogRJFRR$ɉfBcΐl(djoe*,;*w838F5 f5q;ۭl}B~-!P 抢cgCƶj1>13F|,t:hYX+evU(D<IoϻMu]^r!'-@v-"$6Ǐ/6 b`/3i#Gs|i(%ZBU3iWz6yl9Y>[Xdl˨C}2U9yؐ%02{Ne@؋:,c/BQCU P-m-|ksjѝ%4uW"|!cCZv ]!D }b>RϢ$9D F/9Gw GVEj!B(Ҩb2BbE8;w52(v}thgqj\" ´);NJz/Nn9Fm9$~ucl8c% 3t^~ג>Kw^,B$Kw^,:J'.61Z`s&V7m4sG;F \1ZazՐth1k<-u#ls@jFѫiCw1z jc:6W5Hѿ;F,Jc jl31Z>R:-Rc:y'- g1PlNkZpހw\Oe:DM(uY61z %Jw,>Cm(1z۳]:FGf:Ϣsƒf,{m8 6)e0,t,:(bgKin=9y$8"3ǿ#Xutī0x w!WvPDMK>DOCv2#sh M *\]4 H{4MfM4dFw<]P˷;tAGKM@Yp̅Bو}ЫD4TUk!M@GiDH*H$A#Yk{.͐sZdli's78h!-@7E[jk r6o%{kj-C!]LPl" u:Y8iZa|kTA }@D1txHD(0B hi1t@ʓѹ͂Xs mm<ֵֺ sh1 Q˞ 7K6V@[ۍ!!T6QfNmZ* ip!zTnU=<G8W)?ZÙ>>2G]Ot[g\\[, ;&vHJ1\fSp:I%ǔ8M8̜@2z*s$*[2xNg-~}dfblzXY&sP/0?ʹ$f3_WXT #3a,;~*XIO{ȡjzx7 E{DiЋhV3Lj}+1=8yL<-iEoQx#Uc]ål.wڗwoUQx[Y[.hlɁ[;]ʲ42孀]:[2]]ƬЇc vMt[C;rODu1e?wt#Y޿#*^1}LȘYtRcdjAnI#[.Q>8\ˍkl9`h6QIWc }3qّwm;G`$|Z>Gq7g"R~qKfjzsy7=]yI raSLHl9up*}Ԕ9-G}+qa!rCϡΟSGF3_֢;b98T P>$/tt)ntA!Ν:82lz.b#6 IG+_a06vpޏX`0Q xv,ެɶX4H ؍.vǝ{7 ! $ "OwMfxĸ^taٚ! xҙ=bz"=~CǣNVWoF\v.b#6.wTU}2oC`㘨눍!*18d$|[ǟ7{6y,r2sB0dx9#[ wc[";= "!;ݤxjl<"WFjrԕ{f0wڐ)j{P8;@ptKIc Y]am.Gwz&I4[1"Z:`|u:I,ebz]=ٻn%' pgII!I $bsYflaj`{NDf.5gy ÒWYvϻ[Љ" @ 05_pWͩlY]-z]YYwMweMJ>"}T}Tk@X+*ײ1;K@6`/hv/9a 늴4{<vrEս: D=>j:}1J gH+~+Zu p#L{~c ]b̢ݵh-?LpX`pW>aVHCnC D~iHu!qƼ!B-GMwma! 6Zf>D˴ŘoY 1-qik)1Jи"L[L(~竼Ѳ4Db u+pmkJ` ªVħ 6ג8T4߭LuZjUVD{KWJաӒ.,b x@cGG҇7H%(>5hq;B.f8ٕx> ]GۡtzL.| q#v#O\n#2H7t}Tz;auQ>U鮅G>4.7zQ]L2=bWwGrJUw 4Yp[lUD pm>ɠ2))/i\e{:dW!"pmPz_4frc;OU pq\mg/2@4v;NmMK*k1Jw4vnrbo\\RmQZLFxaRu8y&Wfn׍;VҹJQAo]P+_ǭpt a ^_#^;JϏZWIGéxiv~GngSbީo8oKrl܉o$wՎ>RE-w{$MbRk )Y,F/3)gW+Pȍ$+he§7|!< G0>qO?\=^R__4E ż8(9༅r-!-ԏd.e]Ǜ#`g>7)xbb :H*ɺ'rI ]@Mh$k8)&ɉt}ԯ2QNwwT5͋F$/ó/:m$V^]bWi7~gEف:euw%`VTW^4k@c,Bۻ]hiiYdDPF28q|a4c4*:q:q&QL|hϽ^n}U֫:sn:IƔ9JB\IҀ=vf)S 3Ĭ9 W&#H*N gE<,WL:GՕ )=($ʢMX[#12C&LJ5W6.#! Ұz̐ u)Fׯ?7Tp<^G(utt@ ڑ,Eꬶ1cTvl'`4'DP X(:ATQ!/C| 1(c|12 c -[0`l!1vK1nqCQ_Cbc;a3v\rqÌNŒacG;Ǝ0v##eܨE;QƎ2ve(c;%7Ƹ/1Ǝ1vcg8c;q.9θqƍe~qƎ3v`c'; Np M0nYPWe]e]e]e]lRi>C| s~|cq>&جgLf-eL@ː`=gL 3z&XDYk`-2z&X`=gL 3fl2Z&XDDz&X`=gL 3el2Z&XDTz&X`=g%:2vYk`-1>`=gL 3z&XDYkH(M *AH""%dR)Sp #CmEedQ9׸L N<S13EI#eAkc0aLI ;dRFP&r V;CT2;I#ݪr ~)DLP9Ig#Վ Gƈ1TUnET)# Z#LP*IxeD/hB`JQUm)nˋKjTrnUCpB&!P@\r%P|c w(h"JbJpEK3RзȒ7I k >rfc* Zˆr“'#D0K(#&x+zTJXRd*X81cz*#KT"Rs]'S!ݔ%G8̕㙔cvYo+C놷~{^`]7W+Wa-JY$2\Mov2&ĝY+#@^i 7>Fa%%75e(mbŹr?=DFd]}7H D!Fwx#%؂[|`+vt<}+y^ Wzfy+^z+a?JGԣc9QI5#$XEu#T~5l]/)Q `;;C;|G- &8g+-?J/o^yWz_~^ǼWzc~xWfWzf]w]FZKv@n[y S3S;!&UkT? -J9Bf( 2S2ef(Rf0. Z!3DV8{\y2dHad 3"eŐ2,R aa  3,u3 !5dVd%C3ITXlm˸$xN: YSD"V0+۞U)_Sga5y ;%O0 K-v1v?<2oX؏T5\Ҩ[׼{Š 0,0mblC?0LaPY碤ɃaE2O;<)ux)oaD1 1<'*{cw!|u·%|A— |wGmcd6ƲbF%{|t/q1NOe#/vNFVՔFܰHSGvi8U{6wi݋) _'?~𞱍HP 朆=npـϺT}G~OyC׶ppŝ9%#wH&X]H@IڊG#Ԣ2"ww>Q=&_r(sDF3wg,_#J Ç*PFÇͿԗR=#ҤTGJO*E7RSp|3< ˑ)mLFjJQ6_OlڒveOTWy}`j{GIFf>fOW\ppm0:mxїZndzw(v=+c<KswˡiA}z}Bٶ[ýCoyү| O/Pkb O0^a Pk d1&Z#b 9l\JQp>+BޭJ)yn ?6-_ ӻjX"CF9Ċ;39L&^ȧ7c 6?3#m57E ,fDLEhFL-ѳ9Jiэ$BR0"<9i) 龫y0ymf:~LLq5'0{QY\+׬f ȷ#xq7}f7#_!#|͡涝R_=_ \sdrz9_C YnV|lb>c[>c{>vcf)[H.r++|jr'ͪ WZ&FmV a.aX` -ݠ:zx9 ٳG'D78>3CW@\-ش,$<[;q$+'H-dEӋ *Rw;AŝNPq'Tw;AŝNPqs<9T,L\w;Aź^,~Hrc"cY+3cpqccGٌa iWFh(vq.cqeV 0FW$x!n0{OQ%apOs 9T ZXݰ УM3k:/R禧z #eo꼕:7׏o[b6ڨ6uZ{OY77>=SnilrONVA֌NzzAt33C6 *q֠y_΂4>Liq^ ]w rV>#}u/߬5Jۓ 3+0d%Xl^.f.Hs^kb?[OmBYYϥe,td;圈[S4_:g@ th.|~;zA) $)۬C3'M _H Z舓iL䈁rb:W +prGA&oW&uk,qDVSplfKnYczʎl`{<17в(/y?޶-UgUx{۸j>\`;^I=fI79&;9ހN.aEUaaDE"{M;} $|HYbptf:=iDQ#'=8Jbָ:M )T luجU' fP /~kEfeCIWvZ)[390{28@ם]okH?Mi1ar3LOjlGӲL }b*mjH 3z_$ݘQ :뒙UX07ӉHc7̫ږxϮ0rl -G|>_ `K?|/xwC4O?G?&IK,DI/aִ~/!7}`;|"&{tK&m 7q#h7~7ҾoÜ b혳7&gOwwslvOY>ɹ<|L -w}o[o[n\r7323η|7o[~i[-vm߲oF[OrS\krm\˵q6.ڸ\kJ\ilIqs<]stm\\ƕڸW]uoz=n=l dψOdϘOdτO,>b yO'|^>d 9'||2p Y>gdY>sO|'|>>D]aH>>_/dW|2dϯt>X>=~/|-2g+ /|\F$O'?&`Wȓ$< y<$$]ȓDz_^GK3e~KN~/}0K?̳_c>_/}3߼>ֲ\ 3, ʂԁ`i 2ò ̰,d)d\Bfa 3a k@fX32Jַ̰jd2òAf%ƷX t|oF<),>S>>oP>s?U>6gOLRqqC7'00Yb)h7'sO qsϜ?$SX\: $WOvsϮù-'Ks[ 熱q9NB|;+J,;'r+RZaOh}#%TK9 ҩIK nyR[eO4#5rC֓bF''l/{n-e[gl'ˆfe_[ 9kj[kh/_5-.'Nj {uN(^vkeB|,2y~]oʺv{mvQ_97-'{g{ulۅĀ6B 76!>`}}!>7(ħ4qOgoɑB|J[ 񉷓}YU^Oi]xݹϕ~ S~xz B|J?:񉗿C'y#UL)?4_OΊC|z7^ ^|nqg[۷[#pc˭]#ۜdFW nryS3rN`+]&+ۛ/3_Kb>_;T ϩ8m 1Mt   tf \ pTU>$J@td<@B R@h@uftftkgYʔEUS.=ͽ857so?`[3W6\q!|3G7dxg1/Un+,Nٌ90ve2Kh K4C$FDNC&hmp=@yiAՒؤ Yn=ZGu|ڹޅ~}ӈ?rYzY$ x?텃b7_їӘʾR+ > ϶B<ΊbX(b5.%ꇌݻ\B9]G}U%_}Rwiوĸ6WOƙc~hyKr-0_,GLֵeSv6*k "=ݏ(QZS/l~D~)z_ۦzc1Ъ5#UO(e,ϛYW9n7 lˆ)G2[;c$NLe.G~|Q\U3rx pĄ\rWH|*8]&i(nle[QuVWU]WZskMe~|!W^{}%>JJANP ~c1f0Fc}%JR{%{K-[do?{=Ͼўgo?{;ws};Awd {;=7ľ!ib{;!wCf0f0F{awf{G;po$ba{G;Qwe(e(|F{1wcc{;1Yz>?cۃ.,f0Fٛu&YgR7L$Lʨ=֙dI֙dI֙dI֙dI?{$L$cI֙dI֙dI֙dI֙ 7L$L!Ygu&Ygu&Ygu&Ygu&C*2*!cH֙dI֙dI֙dqZwYeU&Ye2l:3:3:3:3aoVdɨRW[U_`I`]`bhS2#hBC삪Ek`,za 먮B-~"i胮}Qݎ/{A#bhE?TmcwQU01D"ʢ4+uXG=ƠѢ?R3Gy U/ ֑c~j~U܏`yլ Rz0¸PQkf1F4∴A[X* i(pPĢmO"*b`G}F;1Rf0zbLULj=r ,34O;ڡGHljf@DR>j&8ZϚwb&ffN}*,& -tT:NҢ2K,-:^8[Zknedwd4٩bws:W_ONpVwcR^4G;)Iǽ)}oO9L+‹^Q-*( {tznT=22÷#sT.sw1” j3~ ycY&o˯wR/|δNL9)>2V[S^}$-mF>1F?vԡ)ǿcpؾ6 /]4cېz7د<Kɡv`x\YUԁ> #=##WGWHq5{Eijk$4^sǏЅ#`QѰt(k GY3y:T癢3m@wRy:V9\uki_}_ N$A_zrRQ7*~.wtI7~GeJ,}9[ e1$1[uoYs(>l.aJ %`Z7۹gԡ\4b)Uv.٬h&;ZnCw@*v΀,av?7P-FO1 uZUITፗک};.{l~i6p>BVc7C{S;aj_4}r׃t5XXkBGZQn [Ê|i?+N`|%fԻ'?C㳱eCG_.kT'> +?>iuBIqyg&6r um'*FGt<83Z?K͑n*A3vս-*又%XG%{>c[?5}*]CtMaWѮWzmmX=*dyW-ì` mGWw?[^q}Gw?E~ęr{⅂ߥ?2<:Lq[I ?,W:,akt/O}مR >ߛT1Y;|OzeYcxZWfutJn ~n-qz?\vz0N~?+pFޝ3H;sQ;y"w`3b\ l.' ~ ,8'\] "7>*"\b*'bo.j'7|rQXc-qC?A{t[^P^+es.6Vlp"iT+=Dۻm\.%wnqcs %,+w;UIBk7r#}ʽ*>%wY8#|Z?j$׃[4#ً4ߪ*.٨yëR?8+#ٍI4Kߜě=N[˦3?2'Oe^]?y=]V.[}# ԏw־[<^n7AA sa?2wۿn-?ӎrr܅wNeOġa#\˕\˕\˕\cyR˕\鹙ʕǕYJ&+=(=flrhҳɡaJ&+=flrhM 3Wz694sQz694\uSyGy< nKWx=qa_zްo\=o8M?nzsӧ_} ~7]?o~ްḶz:?sHkR#;wS3^ʭuro߼ʩ}x9_ ;no=[t>oo)噜n/mQK.jb`|^{7*1-ckMoYs<9?ܛ:՟u)>SJ9>4~]ƩEͽYr}̑9ǘXtCgw:T1AsDf]GŇ}~t[ˆL3xz #Ü3ǎJ=AsWIP|{Rk5Fs6km@3Z3ĩq qKLuL( Nuq[YNTsgm1G.9"Zĩq!q%JKZKY'[[gX.u!N)>TN!'kf(&)&4fz]K².U 5~^kK͑ kCŊbZRxX'j.jn\4w*> RB.JWܦaBӔfxlJ{:&,{Di rs[ڳz_k6kо|5F{SPrfay݉k  uBSOu>S9Mf}z{0,5/~p>GZ+G(}GsךWZjZ?Z?>P9YkCMfIuѺmֺUqK<ӬubPyYXF gNԚ&TniY7YzWB߿,l9\i)LM=]ߛޡ%C8<|9qq\9v\<g`S`'''`/ xv/qm/$ZMǀǁ?= <GG/¾<< {<;> |x#3g> |$SCab7?v qc~%^൰Ny x\O5&`#v5{a7ŃxmۀF n`h;vGMքk[Pjlk;p+Mdvm.;ہ> |v Q`h!F`7| x`{}awW x/ {`w7{7pl/̶ lX/:qp-mNo]);4Jjt5ib Je%UebŰp-.] \\?u]~8h?l ;}_>l5|<ع}<*6GaWs%wgo]΂] \, 8Nmkwv=p p:4z`=l=Yl%ƈ*XT)@: WR*Q!` p2l-0v5|kDVY~ëF [ NŽVVŽo  ;888X[ a' 6x0$0Qp"061X.:\@ VHko"Idm>zj`]g`g`틡Y`QE!w2S7!#x=pJԩ"끤݅"Iѿ<(8/5` qej DV݇E[x8_8 Ct#JUXBNe`2M/d/_j:F݃s jؾ{G;vanv,`/dƞ^@ʡyԻ+ j<2݀݁Q2+` Og 3η"qAsqVܸ٩ ̂;3*y 2»UK߿ Xzzq1 [pPB-Eg03II&N]ιvθ +/ zD#喵45_Z_04Q/4E Յ!\pc_z ~fu!]4Q.\&6'0MSKS$zA?\/Ocnd~tfpLcFFk-u/?p[{K[}KYR۳i_,mӈqusjKMSJ{9>ݛ.}v`nĿ(./3~ "p߈%#oq 8хDB#x'{Ĺoاx>Oo>S{i<徹uOo.Sl<徹}1r>O}Swye<|]O>Ssua΋#ܹ9k7N?c41Uc\Yu=!9`Ιkc홭8 AXH+g,Gs9}m_s]XSnyHnLU$s֒ip[{9#\Dv:^O{.Kw{}Z?cr]q\]ohdK~j*90m.cu [$7|n5"ks9Z C;mX"*x.Ii% /=j*XVX b5G Fvd6gmsEA":͈тP;@&цPq@وB)D܋{{a׉⃪Xj x[95 쀨9D B 1At Q p#@9Y |D~^j:- uZTtPq8|p>{saO$*z.z#=s^GeA{ 5ރ44j:`s)*j9fjc47P呂MEG}^Eo1 x7 }3@*`ljmz!tWDoqTV  } "Qh, 'n EQHP$ *(l=0$k7⽮%{0}|+O,tm t B[Bg |Y&!C@LvDDPp(`TH`@D2 xԚvhEDAVUIy߼ 1͛yCFmM[i67Y3! ! ! @C@BACZ@ZB.ttttdA@.dCBA ;'wXV=IJLeI/-[֧Q`g1EM.v?Ã]'uSV+6drL\x1{$?>֘pG=&Q_,8351I_Wוue}}N? ۖ<.o\;iĮk|n`8NZRl*}zzTUߓi~ұPsV?E-\{H'ptnX߀o$ t}:ۀ ޏ^[QǺ,W3*=80ђٿŸ~uJNDUMRgp\Ov#]~y47rLwTId$y{~R`'d[UU(?)Z*Ve#&1\\ r?dj5A!0pHȵ !c c! !C&@&B&A&C@BACf@n22 [ 7BfCn  r+6|H.$YY YY  <,[[N^ ̛ {so|9#KM ,_H1W oʷ2,[J5ʷ.ߝ(*]!!@Y=~Z!<yQF&fVcB6v' OB< y,9!χk9351A_WםeS_*ҢmI"ƛg}1sqs:{x~2lct$'dNu4Ezk|:r]^N/y 3+{N Kf|o7 zR3/E_!/AvC@^ yo! o@Cބyrr]!Aއ|䟐aY޼CQ`cpWê3߹Go˶{"LK^?DkUcw:q>Z}Pv1JF7:h$u4\Smo񨲎f#q< 1"^{? 8c!-V^I{Xr-'kq-ϲɵP|\EIru| )ŭbx[x=bR1#_f}3\Z΍ID*yOU5XōUu B}]K_׶%I0P;]GP%dEbzCLL1<CLC1<\+O5-pǞTalc*AffZ3<լ$k F&fךlʸ/m;2n333c3Y3K[*ze HRmm,VؙjvUbm'i7Sg!_@kH1ȷ C~9/$4'Y9!<$RC ! !@!)THH*$R RRRr!6"H]Ő H&>!HcHHSH3HsH HKȥV֐6a}CgX ljIk>Α`1/\ t`=VW1hlk(;gc24̸3ǻ-Z=#3$ r$ R[D ~yc??3gd㧍X}|ÙlZK@T;KHOH/Ho>+nLʇS ۩o>c3N} 'r϶W׹9NJ{>|킓G^ѽ.T5^U:X)ء%=Pvw2/A[02M2 %Pʎ=?03<≖`31U!ܖדd"Cq1J=.Wl<L./Cv؃JWb 2r54"0ӵap%/wqơ# {PӸ6jOݜq >f naS] [{UQ)H&iPέ(Ÿ6 R^FG]~g&ҋ?ޣZf5]0pر֎8;0A1\?)/7^tC.]:fϱOz򒘹'smpKmq6.ֵAc]ܲN$Ka0!0pHȵ !cdMzUbc*7bm3r5Mm74_YbDiEWZ)Rb{X_9[xs7kVfo35Sؖ`3QgGV%X&O[/m,"_clTd󌍊~1F1]bRe; ;! wArd !k!@da#G!! ![ [!A ! !Cv@vB< y 4ȳ <Hϐ@B! y d/UkA^샼yrmA!;w!yBC@BA> 8c'C>|?/!_AC| =ȏBNBNANC~ǧ⃔$@*@!~H"2H2$ ITCACj@jB.ԂԆԁ\ Ʉԃԇ444\i ii iiii     @^ސ!} W@B\r d dd0dd($2 222r-:(hX`ؽfm [t )g NMdfPw}WvԄT"JSJ$$32'QQL۔۸ y,\;NZy SR2W+9K/9Iɉs˻ssoǵOs^Sw={T=|ݷ^7n\GY/>|_ [\]O^nv|?R5?'~[|L?ߓ_:ܐΏcrMǛ?*Ǥ =[JpEWpFHP.$|X:Mh]sA>s4R ]TbUM)S~h[:S}pۥIX$''0@ej*Gq@$GQ M8g Pd%Il:YvM3+HYZ8k>@Ot[`4€!:{6VA.ėrD ?߸,q_eYO?./ğͫ<q;oIK[;r=u*~ne}?܀ky$?雒R`=y_ ?s ?M3[vl_WX@ۏ{3_i<OlUOo\oT˅~Z ߸7D?c[o[¿)#`yq E~F~~y?ERo >M ۃXc S:tIb)tJ/ۺ[Ǘ=ݮX3xo?=_C/tϤ=>v節/p_ĿaYQ}1ث{Ws߉5pop <-խ<\|Bk[l Aj?Y5 hډJ;_Iu6O;;c)X{6wG'WW-}ŕ{Lr^y[j' ^v92n]ٽ?SsC 5eG.l륃K3?l\,/[%^ [w K7ZA?y-/sO0w^; <|{Oy'76w1q}ru?^Uuީo_z&߷Iњ*Wpl{\GʹY}Ǿ{[<۴XTݔ.cg;\kv_EwLM9[n~zT&ǙbOgtWu~>T|?eգ^K6ўLz?[>ov-բxL&WJKz;|W_m-^GqUpyLAe1ůƫGmgzǂ+4Y/ \]_Vhx x N=#> R 盜?&XQؙpE{lQ10gb]n)Ʒp^|_EM/ xPMיR?Bx'Uʹi/cjv; |ssOfnTK+[ʺ5:Koʺ ުn>XY77YYp}J.ޥ_tE-{qM6K'K+>,,Ş? ?[{^7xxϼT[.^~L) ^z-o6,N/x#K9T_؟?֖pg^pw\~nū l OW/c+?$NOwp͓G аtg%W}~3}xxUOuzi%{mdG*Z< |]ObZ ,f?~:VO͏컙G ^-h7Vߟ5WWwݿ)%8˴I&eSga~|~k)_ڌR{[w~|Kt3t[dOwpoGO2i165L 2ԹIϝ[]߯1nx:?^ߞbHe ~L?S]? ^~)xIi0|N:w q#pN>{ޝN~V '簿58%} вp7p^p߆N^ڶ4*ւ$|ys|6;x2x /~MQ \teSWvUWM,+8Rk{8g~\:zt?/,3A8:߂;(yjű,0*x`ʁOr_5wJ~^fo7~\:myNnn:hv9_\0ܭ)' j4pQ'π=5p _Ѭ\8y!Nϝ#pA9 cS'ay󊡓7˾ ..S䂡?b>"C'_48xOF'v'x75G8oN?O4tMī7uƍ?/cKTkOR~ '}G?f(GtqΧp63pp=9F`[Wڕn 6Wp{Qk'?w װU4Ҝ;"Np+L)8!/kGS-5{ucK.Y8?zھW7oݵm CܼBN8 'v5|7xO77_-'e{ LWݜɋ . To/ގ;{ή/w?z4Mz>^ j> |'mgNpᔉ,\#c'w2ٙx8y4;B<3'/m m)'WZv:p{p;ӊTslk[?w|ҩ;ad'oq\MM]8mO0|$YW9T\ k]1}sO ~vkσ<;/g;?;;j+l ߂1&p zu"|xjɋ*݁X4>L? ^?+>L?/_Z4$L?5x~)=`VGK~~P0jn8֒no8M c`|Ӂ|mc~~m^>fˋϭ'Z|xhDZg5g?n~'Xó?kg'?uAg8xyݞp?M꿃6 s9 MWN^qpk}k{;'B[|'eWop7~o[}Nc|<|?r)؃ۿ<7pĝ4q+rwε+L{%ZN~j  qi 'lNo\3 p]1"<)2|PO6p xu'L}8yOp⥍Yplǃk'X~m >g?rsSt–8ɱ? |iѥnc n[%^ n:nps GZ4yp R89ٝ <3gx.zSL?wr_l+嶕q`p97xi''m^\axsNCmU`8Z`jo,voM 89<݇9`x7NO .nѓ盏gG.6|';_g׬c't`)'V\`UmbN x9xI6ͦ).5w|pso^89ܛ/ NY0porgS;z^Gco?ؽ~g_^4$~w?L? >zzc~>l{ ~g>j89܇p*`x~7Y1\}x;>}xƇ.^`?ω_K{psn:׀O~]0prsL gwv7epsnoݘ+sL?o xps~gw&4}xW.4̓pv.n*ǾzG7oV~U oyN~|89> {trxrl\Nr\!i:7?~m_`'{:;>8y[pv?kdn|G'R f߲7Mllׁ}|!N?7G;rT .bų_=&yFvW]FyTnϝa`.fujׁٺ/ˡ^5*\W)u~@?ϟ7~'~|ț<[ٺC?{P[+`yxctr/dܩ́zQ\u_W40N','LWgq~>a0/7++nuKiy~i~pceF8y%`xLvæpr~C"N>kY?|r_~qO? fp%N~%q9#/O?~ʡq֥0xco=P.ʾLϳ5+7u޳oC'f3wiqOp>?Q6s|<~m[r8|~775ہ:sghN>x2a:|~pvp~k6-u_IٺWy7]uw׀Z`[?+aXZsf:ΧQp;lՖ:VguNm;tnr`.oO;lZ>h?7=/i`/5Wcrp>?wml]C?:l}e s6--j͵pUnt_ v!:3;tJ~ l]}sC'_Zm-~{TUO[9i'j pZ稼6u siC?a=wy{C'ؼ9t`.e=Wcٺɛ۪`>?onǡY5`pF`.]oZCl[0<}գٍ%u=;#Zei+nG1[?x}J?.~5F?2WOؽ5F'23# .1:yR;[*cyb{ ^HM*yF'!}+ {;ȝ~~ęTp\Mn+/U(9mSs ǾYporVf-e7<Ǖ^'?XY6img\/.&gcW>OsM g)6ėp̽n~>moGg~)x~~q:9qJ[:]O)?/=8yfR,'x+N#KsWqyN~hm ;m\:*u)+y84?x:8{gp=<~g;g'}N;|I[/~ɌZ =v= 0"ǜp򌭅tpsp#h8)}[%g:lZZ<[wρϭ;< '4_A'] ]M2_^7[wԁ_Zfr<{. 8Kط/'nS^? .*= Xc?E܉sMa89Rbvprv 0s:Z8)1]9sc;$'gwN? fw:y%l0k{?x>9>9];9]==^kūwKٟ?'gwN?ofwN' 'gw:sy9|WϽ;~989;]y?7ٝ;]Grrv|~%b9y 1]9<9 98y<_gv緀ٝN\0}rrvt`vlZn;+WgwFsv$܆'^ٝo;]rrvl]ٝN9{5ANNn/Wgw ޷sv硓;/+Wgw:X1]9CWgw|~1s:y]89s;ylC?~N^Ny50[s:y89;'gwNWfw&'gw^ONNUsvMٝ~>6Λٝ+$<9sy 0;o;;;;*'gwN??Eprv`vAprv`virrvgٝ?'gw|yٝ;g~N\yĽٝ;y&cruv矁ٝNHLWgw9`Sd>??fkpr2] 0rrvٝW;g~N. rrvٟw;lͿٟ;IN:s:y;?wB?_;LNϷٝ? 'gw>V|9]991prv-#~~ٝW;g^N~Ne0rrv_ٝ#'gwMϝsv <}[oawN?~1#<ҷHdoaw.΃D<9ٿ8Oٝɏ=O$/lZ&;ٝ{woOٝi|sldž%+ѷjZ|.9̎b0[vtGfٝSvϧٝ?3=<[؝_ò;g:ѷ؛} aevlZjjٝ{ٝɛek+ٝxyM5-kuawN?|n~>֜N~IM sX0sO~;O-oawN?fw>EM sP0s[.{'\}eņ} [s} vԴ;gٝ} sy:97ٝ?gպ57Nm7uak6-!uakBoa}5-ٟW;g>غXٟo[gw>G ?G.yП''lZZٟ<. 0s~;g>vٝQy[0i9%-ѷշ;;g:ѷذoaw?P8||x.N'o 7gwNWofwN?o7gwtq}tt0s:V,0f ewN?/ fw+ܜ9|.N?o7gwN?fw 9V9 ps::`vcpsvM>ԯ$C}P2]`>ԯPA7'u fw4ܜ9W;;/O܇b %?fwN'ny{0 տ5gnNfwN' 7gw6E7o'C}hld>?/ fwބwV9ܼ8 LH܇}Pd.{tqy}܇}ufw< n^L;fwN' 7gwNWfknB`8i`8?n݄翃ٝٝ՗t{tv6݄;ٟ7gwNWfw|~ 9|V>4`vpsv|~)qjoLއ}hwͯkٝ?;;g^n~^wt Э(sy9sy0]N> n~L<=qU)pz✉P/rlAw fw>I7t ekN? 7'%C}(Gtt}s9sNއu?}އٟߙPvnB{%C?ٟ7gwQtq:Ic`8]psv_V.N?OM(8s0]y%9~^.qiPv_0 ew~@tq<9psv&CMxevcpsvٝ?nϗٝM(`vtJGg>LgͷO'C';wū&އ;gn|nEϳ2#ٟgχٝ? |<`v'ٝ??ٟ7gw0]U9s&eWt"Nd_DM䓏t؝o fB'JN|̖%M+p_yíńٝz,qE0s:W{Mb_цQfwN?xٺ ;l˭EeyW0[>?/Ͷ%߁ٲ/ycw>^~>.SEbv-~~gb_ ewj}s#9| fB'i`9]=~g1lY ,֢10s:cW绦刱;N+z}E/WdwN?/9ƅ~^ hٺl;gR6n-Kٲ?_;g<W_׾"[:ľ [nqa4- |ab_g4迗W %0[:Oyٺ;3M'qkg̖ܜɭEKC0[:}uٜW}Ő'% }E\r_ѧ_ٚ0[\2- ;Wn-χٲir`0[>?n-Zus![ٲiYW"[:yf︵hٟM+E}E@lY䩭|n-Z.lYشbٲy# =vt40s:K{y0s>?oVcK[0[#֢epb_F?O;oNes. ufN؝uifB'iZ%W [VN؝uYfi&rkѲui fqsL0[Nc̖~^=p0[ůٸχ%-|1`v"-'p_L?_W |mG&; fwN?b-bwN?fwN?{n-~>ۦfdlٟ`_'}o%}o6}+[>lY؟/fٝ? fwg 89}ٹec"fg)9`v̽n |- |~~Z 8fwW=6.twٟ}ٴě_؝?f|yw0si.rks0s:)sٟJ+ٝ?Y9}zٟ79z[>'lY؟oN;ͭE`,ta}EW4"s 0sl?qaNr{9`vlZJ֢ea~nA9}EW4Sqa 9ݥxٺlea>{.n-'ٝ?b}Y}ٹD<x?"~5y?vϧeGwꅮ~ Y~? ?,?ON^6GEŕ׽#k#N̏p}9qC/l3?&Y%^ [N^Nε/甓_;p|t]rrމWG<\1v?:/$Ȧkϳ,;y|i[S_<>~\~wZx|;8籈NJK+"?/[Xp够*oG?Nvxtr;εɵ;\ru2\]]\s;+Ox?trs \s;tr;εɵյs/eqNsݹv?w?w?w+ٝkܡk܉uW(\s;8εɵյɵ;C?B}?&lG&qpo"}\׹?8Ҵ(o.}oYwyǾE޳[FAcjZjunщd(Ҵ8մm;}'i0a \CM%Mu13ԴZVÄK^0v?7εn oYΫ|&Zb[V)j"}awsZOM3!ٺ8մ"}Kg5-?ru|IMKuuyS}czεM˰ ;`v?U߲|H}Kj,-\ebį7o]v[}Kpdb؝k<εt?sݹ -?7aEv?7lZn"}aws\ݹ sퟛcjZ~X;du!iaws\&Zrشpgݹ5-rgs\.njZ\} v?7_u!iwu1lZnzo!;-M sퟛ[շp[1ҷHV5-2εnzi4g [;5ԴL-.dv?7CշSմ=as\&l][/[æln&l]մasCMKC.?7{M%nK^6εn؝k܄KQpش^֥ݹ.]εn؝k܄MˮObn.VӲv.?H6-&l]bajZҗbn.>چ v?7εn¾ee-矫`؝kRHb¾垾]ԴT2LMK#9MŕlZTm[8D}{:շ >㝓-[p}5-6tD8ҷ8%[rǩoX-\I}˥ECbշ\G-[o9uzcl`-?7d6-?X}Mo1εn"}aӢs\&[kcws.?7ar^غ;asX}C7o!MK{$[n"}aӢs\ݹ sv?7l]n؝kܰ;4-^ݹ sv?7εnشhܰ;aӢs\כ#]o]NϨiY.]εn"}aws\ݹ [v?7l]~i!εn؝kܰ;-ݹ sv?7l]n"}-'ǦzPݹϽ}܇Zv?εn#7ɛ"xCn"mCk7\mMhN(8rD9K7};7Ľۓ7fnE7#7f8_&ܬ[`v?7εn~MhB ͑[L>M蝧+v?7M?7;40s;Pg]&4J4yѭ_d݇XcwsݹϽ![QonB}>ֈg>;3NCtw}&0sퟛVݹσ\Awsݹ]v?wٝkews`Veks7r;\.sퟻεM)r݊;awsnBs`؝kܰ;.y+j؝kܼ[QV݄8|԰;awsnE;'{&%{ sퟛ&C]ݹM݄g41Y4#yj"ݹ sퟛ廉"&r7fwsSWɛPsnE{w&fnE;P2sퟛ4݊;Maws5tJ> 5ݹM;݊;[\ƺ iiav?7WMawsSH7*aHފn ]uaws\ݹ sퟛߓfnBL4u+Z|o&Ԅεn>0sퟛ}\ݹ,݄5'uJ\ݹM>ܝ 55W&GfnE;'εn|gy݇D>,A6u>xV&ԙ.>܇:U) '8rDClNn݇>cJlC΢˺][9݇#k,bwsݹ]v?wٝkews7r;uٝkewsL>4vN<)YퟻεLބzǒAwsݹ4݇D u\^䭨\n>ewsݹ]v?wٝkewsݹ]v?wٝk܍܇(;\.sퟻε;\.sퟻεf%oB䭨}S7|OQ݊ fks5εn؝kܰ;aws\ݹ;}=av?7εn"7cv?7εn؝kܰ;܇ȾW"^d_Fmm*fVhmGl{;V;{x8md_юоp+~.M/WLn-צcc[Nd_Dy6aZ|Vj%MzdkrkєNn*^ﵩd;KMŀni_qgAkܰ;SYȾTt: jSq3ɭx䦢GWQݹϽfMEݹϽKT<;xv.־1pd_щ+:%XLmSJEεn$\.sퟻε;XKsٝkݟTtٝkews֢\.sퟻME֢{:ba0sퟻε>Tt&=MEwsrkэ+"\nwm-~fwsݹ]v?wٝkewsݹ]v?wٝkTtkkݹ sv?7H^T4}E}՝Ov?7εnrhkqݹM֢T4%M䦢aws\y+.7ӦuizG֢+v?7εnkk.T4W7Z\GNbjk ݹ sퟛME+h؝k,䦢iZ4εnfjk1|Z7,6''h"fFrSNn-T<Z4MES5h%7In- m*zS[Mſ1sퟛɭE=h6&m*ѳawsW4}EX[61 T4U"+ei_2xBrSь_Jpn׾bepd_Y}E侢sD<Op~־f+_Q};W<_Ll/}&pbW$OӾε;\.sퟻε;\.sퟻε;{6) V<cwsݹsMEZrk1ε;}i{;z)x~rSы'=v?wٝkewsݹݸ6;,;\.sퟻε;;J?/cٝk<ε;\.sퟻε;\.sퟻÒ6h#ݹσ\.sퟻε;[R--;\.sퟻ}E\Awsݹ]v?whkݹ]v?wٝkewsݹmD^D^D^D6~"sOD턓2;NpSw?~ ?OdGDtth0lDJw95^ϝ;?7cNp!zW ^|'л~Ȭ;JȰ;Y_;r$UdFDpz?Ѯ;?7~awsݹϝw9g$ .w= '|Wٝkk[$U;wQ':ޫo2~u.ɋD3$2εt?w]EMε;9ܼssݹỊ܎wε;|Nww'N[*rٝkewsADw$r&UFON;~hew:9sퟻε;\.sퟻε;;R$ 'OOews\sGY}pN'~dϝI?wnJ'Id؝k||'|Waws "\R$ 'owp;L今LDי~Q$ 'gws3O$'wN]Eεn؝k~~;fٝk4H4L;Xf؝kܜ^εn"'23$2*2ݓ$ XBD,N"$"_$'Ի'D_w˃$Id%Ud~NDfI4NNwuWMȌ#~"'ߦUHy~"gO'~"z?8zh'|OT ;F'j  ٝkewsݹ]v?wٚsݹ]v?wٝkewshDb`v?ퟻ$$Ut?wٝk=D&I-Jcwsݹ]?X.[ssݹ]v?wٝkewswON. \.sퟻε;\kewsݹz'Q{?Odėε;\.sퟻεVԻٝkews7~"ufwsݹ <ݹ]v?wٝkewsݹ-sퟳo¾%DE/[؝k0[Hb#}s[i( fwssR\yغ;9[.εn؝ sv?7εn؝kܰ;aws\[Lط;aws\~0[s_g-εEօݹ=va\s{æ1[v?؝kcws.q{ε&fws\lZ sݹσ\AwsݹٷɾTK-&lZ?gbLo1a\kewsݹ]?X[ Y熭96-dv?7εnؚk<`ퟳo1?X[ s?XlZٺ?XݹٷHbn؝kMyDs\ݹ sva\k}y?7εn؝kܰ;9ao1a\熭yشօaws\lZM.0iaws\yغ;v?7εn؝kܰ;aws0sퟳuqn؝kܰ;aks'䓉 o#\׹Noq"}-ε;\1v?;yݹٴ¾ݹcε;\[ٷɾh}9-l͵pط;9[syط;yݹ]v?wٝMq1[v?wٝkekssyشօ ɾń} sퟻεΦh\.sퟳi1?wٝk}6-i`v?wٝkewsݹ]v?gb;9[syش[-sݹٷoaws\ݹ sv?7εs6-!o;aws6-F} sv?7εn؝k} v?}އΛP}(s{εPPsŵ=v?؝kcwބ7H܇:}hٝk%>kܰ;9oBMxZKLaws\5?7εn Wٝkܰ;awsއ>ݹv?w؝7tvytqWW?؝kcwsݹyi=v?f׀ٝk<\qv?;y.sݹv?7[Qv?]Aw;9CPwN>y?M[7yl͵ sv?7εn؝kFkܰ;aws\5?7l͵ sv?}awsއPs\kܰ;oB?7ε[Qsބ_g݇sބ5\ݹyjn؝kܰ;aws\k7Fݹyj} C?M9oEyjn؝k7Fݹ [s_g:;sVh7Fݹ sVhܰ;aws\ݹyj?:8܂64!{wŽŊCܵP-J(^]{qϳ?39aҤלy8ss?W wpp@&Tsr@VTsr +;srJ U\yl9+;sr9;!wp+p9܄* ;!wNȝs9܄:ϫNq-l9;|NuP9`?9íh @֜qs;ȝs9܊:C]@&Ե}>p9í>4c%Ź\9+;lsrsr7>?[Q}>%C!wp+sr@& ι\9+;s}(!w ι\9+;sr.?W wp+sX|~չ\9#s9܇*>r@&Tsr7 +;sչ\-6Cȝs9܄*?߇fȝss?Pȝs9܇>r-į#~E+į "ιw s?As,~E]!wZqyι|>GrgWTSΐ;s'ι s?עNȝ >>a3dYY̐;sgC>,9;!wNȝs9?wB~d2Ccr'!w_:!I;$ȝs9}NEkI;|~fȝsyιNWt "ι ?wBprESNȝs9Z+.?ǙȲp2.NETtWtq98]9;!wZtq98]ESZtq9]¯(%~ggqs'ι\.?sp*\.?ϝ;sp**Ep9NE3\ ZT~Ep9?ZT ;!wNȝsr9;!wTT\ _Q!~Eϝ;s'ι s?wBϝ;s'ι kQsp**i??Nȝs98?עTT s?Nȝs98?̐s, kQs'ι\ SQsp-*NEpr9SQٯ!wZT kQs'ι s?B+Bϝ l, Y? SQw|fȝ "d\NW-|fȝsy ι<r^r^r? YsW+C֜c`s+\Țs9NETtq9]NE+;sr^y r~E+ee|fȲps?W wIqsp*\>?O9;!Nȝs9]9;!wTtq9]9kNȝsr9_Nȝsr9kTtq9]s}b~E]!w>ȝs2.NE;!wNȝs9]NE;!wWԉ_Qsι ?wBϝ;sp*\.?wBs+k$8yf39ܵj7hMOͪ>ёç [H=Rպ^KNe]09(5}7v$Xf?,BVR>7|GA5?o3ǰʭ J;AxxBA Y,k{+)uΫᡥ%؏vj-+f+V|oG:-*iyK]zeov$[/7K{fm)aofǽ5yfOi3{Gj؉ǞٕZYSs n.|qrx҃_ڟ]U] Fک _mg[];E^)#և3N {f_[xLvӏ'+Wo=5þ;ğƒՙԫvc3yjL ~j](Aڇ1M&پm V;7 /^GJ_媆{/oѾlxQ v\vְ`;W< [Pɾ{u4,8%Ž^uvk؜oڵ, ޓ.^~Bщo"b>cP/Ye 6avVԚ!ֻ-IO5C rXs _n]sTm9ɚk~=í [X 6:`U>58X}2Nzm )bw(Stv+aFke-sGyfH밭 VCTǠߛ7?ˣ]#7ntT0GȽf61 8l/f3C$y8v >#c˻U"3m=;(\`y`j溴 fjYl3? &μsw{,퇛7+ȰCw,+ڙVw4W#ٱ"3q[Ü6SvG1أMr:.2֬+CPصz6WΩmvs"ypc 3vǪ!oe%w<}Ű2U1]"u1uF9rL^,;eF93ﯕ>1ZV95x\cN:8jj1{r9V<ŘnjXdq۴O1x6]ݎW&R沯܎&pnV*{fc۱D_n(tg;܎N4%ٟu,(܋܎,zf܎Mhw7~q;6J4r1ݎ&A7ܦ x~m6XvD`=fk1nm.6?>mv` 6]v;Fח{<_ #"'oǛ'=w._GP 'D8گLEd#{4J ;?:iw+\T"{|]Zd߭Lcd|Z'=.|cVrZ-`TUG\zZj|:d՛kI {lQ=7ǥG} х=>4J[; cHG S'+!{l΋1=b-f]dMViF5E[3!{ Uǝ 6d޽vi/_@q6&C8Yf|Y+cɜsgdAH侺, ݝ#G5= _b6DzGD!B?{HYg=~ tgg**٣cmR=M'#{,Ya2GNJj=z,|gUV9GJ'oq^Jӳ%|~ȜYs=&tVg﫽p>g>sgw8U e0vdRE9b=Ι^_=S٣swsgG*;w{쑳D%6= l~ލcԃ~xicL~?t=\c=__e2/p ChsԚ8dEk!{y8GmT O{"{Ty.&>Rj?)Q"{\__;1cZ.ڂCъy"{HhZ/GH}@]f=dz}S=6ۨeγdHLJgY i{.j=m6ڛ٣W٣ ޵s!{,Ryd,QT^oső=n.qL7}ydBѥ7*'U wσi=F?]Ǭu+쑒ggZ٣hy{=zNᆭ=Bz;٣ѫŐ=c-,+2f^'#{VK*\rL+nliK&mEXa챷bmc\d{h' {l8J[3o G4}mdi+#k#{ЦfEd4=) c\ڜNy=-H12!{4lأ \L`?5=b$iG1fOjV=S٣zxuzdAYݞ:٣C#=jMBũ٣ůոR=).zcj {Yu4쑯v {l4xu)qyj}AE=mlʃjOL;< JsUg7]OWOKw `w/jx; {䵊{Z ڍ{GD8u{w=&^٣I`Cy&G\!.OÂ]LFH<@{2G&#{(rNFX>ddWOFh}_ٿaǠ=-; ~<#*ÉGW*MQ:T?{Ug-(NJ˝e%쑴R+tTcK}bO"G\J]w_UHDK-=.gtWe埬~u`sX?{\~Cf?{94=ny-=F0g?qcdq-~!59w=)\ ;+?___=1=6,ǢԺvBXk: 4d5}8vM{Ԇf{YMw 1vAdbiﶄ {DU3#K {غ]+VG{!{xJk4[dGޛڞ=N}M ccc d_ M1Rvoo& {{isz=(Ĵ{=s{Yg{wZǣ: 27]Ǩٝӎ=-+=n}Ѱ_=Njs4kf{lj챵}w΋Ǡqg,`:Fx>vX=i-QԴ=NFl=*U[?7 cR7weGoxd%z18wځ=ZQ>Ǔ;W7W٣ڢ=E"?fF7n6 q<1^e{Uv cz?wJr[L`SJkƮ6=)%]my6mR?zGd/?Vglm G1೵="B~Ӑ=^f_٣럓K#{\)5^m>c݃jrPdS۫w@g.dWS FuUEUK̈챻s:Jd{{o{\O `J5=v {i#3GZ?tڸ C1SfC ngw-a+[1Pg﫥zԊ#G8{|g`Aأq8{ {iRg`qɍ3LJq8~-=.3Gzأ8{2=*?{>3ǥqlc=?O{5%أά8{4 Cxx<cd=6g`N W 8t>ML#S, 㩧#:6cWBu=ƕ3ǻ.8{t3Gܬ8{qf`e 챶T2V ל3=" {8{t- n=Gupp9!& a3G8{Lj䟁=N!w"ph?{,=ѣ8{tKcQ qv.=VY3GY+q8yjg`8{h g`j~cQ8{|>g`tӆ 8{Z3GO0  ?أ8{C ,; 63ǖqX~=YG%E=v({gu{ؓK{U8t*=/UޣdU=~**>U#fFzM=K{oGjb(M=P48&4kb(P{ib1kdM=,nj?ibQ*M=]Э{OghbNM=|ukbC{ԞqT{Q4&_`={Igkb1Eݮǭ&5xp&Zcɚ{+hb1c7M=4#CU{LJjbﱾf>M=ƎIGDG{T;p\{GuU=_t3U8GU=߫bj{[J{ba4JG7=bqG={-=xX{#j_G=rGibcnx[[=T~{u3ޣy:bt"M4J{>ScT)bqmXX2{`!G=Nn{lW'8M`u#˔Q{nqǺqLj%6GGN6Ӆ񁽇c{{l{ {o ^ ǩ G G G ԕ U #TB`Q$Ǎt{g>J?=Vy1;,#OnPI{*5~QEVy k"bt& W47;M=DJ8M=M5WM=٢i&7Dcc˓{\Dޣ{lFyv_yEޣʜ^9(+KWoKzEcgr^;+'^赣W=i5"h {W=*^0":sE{k{xwG "uHW=fJyq?\w.cĝK55qrXYMܹԷ k%<&&\n;-ouêsYU6Yw.VQŝK Uqrs*\dQw.W/wUŝKj&sUŝ˲hUܹoSXw.YUq璾GsxGܹ #\s36p$OlΥ_Klq;fSw.\dܹdssy#>psIsY93>p)6%ssY9>!p2&.!p;!!p+1!p2jRB˄˳W ;ow.ۄKw _\̂=.1(TdDi##z),sDXPdóFd^٣=UX48/ow{!{ _ u FDCc#{}Z$ ǦgYû {>z>l`uk#{z![w ǰ#Znr`} ݌1a}"{tu==Vl)w;k0*ª_(13*cح"{\)eS=N~}'vyǜ7{C8~Աudcc8Eh4lG-nD#۳`eW8?QqBG6=7t\ȅ{{dOsdݽckp,SvpTD0αbbkd}9OQ`guGp^?{\uLGGcN=_rI?{<9Δ}#O=#=#>i<Ǚcyxd4G=yGعpGG?{dqqu=u8VGNGG~XG'~(yG?機=l˗؃= 0${=L0${=L"{=,"{=,"{=,"{=,"{=,"{=,"{=,"{=,"{=,"{=,${=L0${=L0${=L0${=L0 {= 0 {= 0 {= 0 {= H!{H!{H!{H&{dC'{=tC'{=tC'{=tG>𑽇=|d#{{G>𑽇=|d#{{GIdDIdDI/_/b0H$y=L0I"y=,H"y=,H"y=,H"y=,I&y=lI&y=lI&y=lI&y=lI&y=lI&y=,H"y=,H"y=,H"y=,0I$y=L0I$y=L0I$y=L0I$y=L0I$y= 0H y= 0H y= H!yH!yH&ydH&y=tIC'y=tIC'y=tIC'y=tIC'y=tIC'y=tIG>𑼇=|$#y{HGϗ/s1ȝI\Lrb;ܹX"w.sȝE\,rb;ܹX"w.6sɝM\lrb;ܹ&w.6sɝM\lrb;ܹ&w.6sɝM\lrb;ܹ&w.6sɝM\lrb;ܹX"w.sȝE\,rb;ܹX"w.sȝE\,rb;ܹ$w.&s1ɝI\Lrb;ܹ$w.&s1ɝI\Lrb;ܹ w.s1ȝA\ rb;ܹ;rB\ɝK2sI&w.%ܹ$;drL\ɝK2sI&w.:sɝN\tr碓;ܹE'w.:sɝN\tr碓;ܹG\|G\|G\|G\|G\Ǘ??~f=p~ f=p~g=p~g=p~f=p~g=p~g=p~g=p~g=p~g=p~g=p~=p~g=k8s3{8s3{g=p~og=p~g=p~g=p~g=p~g0`~g=p~g=R`~#Y|g3{8s3{8s3{:3{8s3{8s3{8s3{3{8s3{8s=kjIZkjEZkjEZkjE6kjM6kjM6kjM6kjM6kjM6kjM6kjM6kjEZkjEZkjEZkjE&kjI&kjI&kjI&kjI&kjAkjAkB)kBkLkLkLkLkLkN:kN:kN:kN:G>5xM}k#^S {|As1{.&y$﹘=b\,Es{.y"X=b\,Es{.y"=b\lMs{.6y&=b\lMs{.6y&=b\lMs{.y"X=b\,Es{.y"X=b\,Is1{.&y$﹘=b\LIs1{.&y$﹘=b\LIs1{.y =b\ As1{.y ﹤\R{.)=K2y%Ls{.:yE'=碓\tNs{.:yE'=碓\tNs{.:yE'=碓\t򞋏#{.>򞋏#{.>򞋏=x [ckwlMIޱ5;&y$Z[ckwl-Eޱ;y"Z[ckwl-Eޱ;y"Z[ckwl-Eޱ;y"Z[ckwl-Eޱ;y"Z[ckwl-Eޱ;y"Z[ckwlMIޱ5;&y$ؚ[ckwlMIޱ5;&y$[ckwl Aޱ5;y [ckwl Aޱ5;y ئwlS;)m y6cLޱM&[cwluNޱ;:yV'[cwluNޱwl}[yGޱwl}[yGޱwl}[yGޱwl}[yGޱwl;I$my˝˗?=&I]jAR4|XӲVұc=5=X X3Q2fb=dazf_IXEځ5+Y,Ěl.Y.ƚ9Y)Ś\>Y-ǚzP@e߰$Co42Ԇ7PHJ'Cmzc) M 2Ԧ72Pc;) ͤ27`EڒRVj+[I2֬P۰F.Cmz[) 2Y^%C2P;A+CzG) 띤2άw PE veTPڍnR!jwֻKe=X!dTTڋ^R 7뽥b2>PWrPO g.C)B:R u냤2JP>D*%CPk0ևIQ2e#X!d}TF:QRYhGKd?]%d5$ ǺO#CYץ2d֓~2S2TuC C5Y72TuK$CY2TS!2Pb/i u';2]FPw[)Ci u/{2}~g}4F7KceX? d4^zCR 0뇥8֏H2ԣdX?&Mg(C= i $'I2S&PO~Z"C=i ,gi2sPϳ~^!Ci "Y2K_fP/~Y#Ci *Wy2k_P~]Z C2ߐPo~SIz[bmoKKdwX#,C]i e2ߗP@Z!C}Ci 돤U2Ǭ?VPDE/JPTMgs֟KP_BZ+C}Ki 믤2׬aAF;IdY/m~`Eҟ2OP%y+ކUf]c b=HNš4kZ:tg=5dkF3&Lg-Y,Xb+9kֳ;fe=`փXMޅ5;XsCރ5'9XsKއ57XGk^c=|k~ˇ`|k!Y/(ZB1Y/,Z" EY/*z| k1֋ɧg|u|ka9ᬇF!_z|k Kȗd|k)KW~UQGװF-_Z?X˰^F,eX˱^N<РAgwhPoX>Az_ Y/A9"@ʑAP>H.u0AP?:ʫjsgﳇVAIp>!&ݍ ҈ ((" |_7]k3g>ٟܵ}4zGw{1h >>-''<$d>>h4hG&yt0:8!hGCyt8:>5=<|G_@_dtrG_D_KKzNTtjGӢ =:mїї= JGg3M=:mWWz5hsm77yt:+ңooF[yt6:;zGs=:myh[GGyt ޣ х].v[[N].v.].v;;n].v2tYGEߍ{{^}}?ۣDxCh_~~}G''ч<)ia.GG tEQ~~ϣy 2GB>ѯѯOyhDWFxt*:УߢFy;`~~C=]5pџП#=]џџ=]Xn@7Dyt#1:ޣM ݌nNtKtG[O{35Gۢy7ݎnߣ=}ѣ;ѝї< ??S==h!oF {"hoX-mżbqE *ގ"ށ*މmB~F%bIC,vxx4C1o&x{D4+&I>1M)hw@LESbKbwD,r1>ݦCC>>ݡ##ޝ>>ݥh?wy%}}+^)EDQ))/^h/t@t t`ttPt0tptWZ#ё^YEGrFG{*(:+:UTt<:ޫtWYщDI^UEF) W]gg>>Tyy//xN("WWїЗzNAxN(: 5Tt: oэxE7 nF7{݂n&)=//3=6ty+dEw;݉^Rt˛TEwiAx݋^Vt{E~oLEW=^S0z{]# EGYCyo*z=Vz›I7WS)o|EϠgEz =)z=・XыEmE/%^F/{(z-U4{E]C=P}WC1@hP>-j'bSѡN-8B̂fQYѬs1M}!fG/hxzZ̉T߈\jͭVy<[1/W}'Ch~x#zZ-ބޤֈ77hX-֊[[:ZH ZDmE&ZLm66U]"ށޡ~DTĻлojX-~K%ZJAQx4^!И-& j&bh/)ꀘbX-eѲX-XNh:)VD+Sb%:-VF+3b:+VEsb5:/VG b (DkKb-,Fk+b.ZWE}Z>UݧϢϪ>}}NO_@_P}:EEUק//z>NQ}:t:M5ttjӗїUct:C5LtjWWս>} }M5명O@Pt:K蛪Og>Q}:t:O|tjާ хOTG:t1Xu۪OKTWt)Tu2twwUOz}}ۧ>>PGG~~''!~~rtzħ+Q~~ssO@PKKOBROkkOAQ}]tJ jOCS}=PFWa>]Q}#ӟПHEתQ>Y:tz5֧ jO7xnB7 >݌nV}ݢ&t+U=__3>U=m6OCSt;]d@w}ݩ^.t??TFwi>݃Q}ݫ^>tzŧjOLDW}z=^azݧG# EY>=So8z\ ӓI5קSjOO|AϨ>=U }z=^V zE-i_eb UFIVOJi2Z?#VAgŪhUX  b Q/Ze6Zۿ"AMuzi}>>h\m6F~ico4m6MѦ~i34׏Ӵ9Ϣi UlD[5mshz?z~NM۠m\E5mhmմϧiG_Nh'FM;4voִ+/i7_PhwM{=[5 i ִ7/i_TӾh_5}}пMӇЇ5}}ؿCGG;5}}ԿK~h?nMCKh8_R''R>>ߣSS~~L?AӁ@?QA ?I`?Y!?EӡP?Ua0?Mp#~MG#BG4k:Wt,:Ot:ίxt_I щ~M'>>WϢ54}}ί~-M_@_kk:EE//4Nk:7t:ottHӗїƚ7t:oLtLWW{5} }o~ M@t:o~+Mg5[k:t:o|tN х~Mwt1~MKwt)2tCww}}}4GIOyFO5=hz=/z_y bM/5^hz쿣Tӈ^ebwE{B~_Q_ jT GAX՟!OE:\C 1 E&fElh6ͮs9W k1'S#Bsbn4^%Aożh^ͧzxz^#ތެ ObA^+ނޢoEoBh!^,"hQ,՛bh1Y,[VvvxzUSoBҿwwb ],;Rh)SGxCcz&=b"Ih'&zb*ih>$FKb>"Eb9>&Gb>!XOJXψU*XωjX/5X/ZXu::кh] h=ZU@ ѐ6DGthcmmm@Mufh3z/z hsh 5lm ms~~}C@[u΀A\mչm=^ hЎhG?NƀvF;ohW.nh7]0@{[ Kho.>h]4}ѾX@@6Ak8t>:_ tnЅB!Ec@Bҝ];mm%K%k@A]tL軺g@Cӽ>t~~##@@?F?P@?E?t9\? h@?C?9~,__%~"__'5~*ߠ] ][[=(ߡ^ zh@WAQOOzd@עkGtN zt =.эz|@7nF7݂nѓݪ// 6t~.ݮ_zr@w;݉/tKO zj@wA݋/tO~=#zf@=ү0zX#F@GC7z=gzB IS)=/z~@Ϡg􂀞E=Ӌz= ^ЋEv@/^F/wz4,21FwED}GQ:P H4 >-jO OE`+,h31+5\̆f ك/h+k1'3F̅ V*1'V̋ hF`xzSF9Q,~ --:Z(X/F "h`X-lłbqM4mڝ˴ rm1=>khCЎh NvF;7lhWkPnh-@{2+(lhowP>h}ѾA1C@ `p0ppw(hp~݆>>0q񠤡OO }}2ЧЧxCAсAAAAC!ACѡAaAAiCG#2DGe  :7t :&`Xtln8t\P AeC'*NB'U }}:f33AuCE j\PZ6t2:9cA]C_B_ :7t*:5h`4tZ// }}%hb tFЙ̠Z׃g,tV77VFg:6t.:7hc>jmcc>>aJY$ҧЧL&ftIt :$Z:d,6ɖAKCMa&pSSґHSQ(ShS1SұXn8thxtdtlDtb$t`U*3oo KC3- 3j353KB2#-]5,ٌtΌt=ތtt#ьtLt3Lt Lt+4^̏?77MMvx3zQ,?тvx zYծ z0ZnEF(Znf8ZnoCo[/WNNM &ލm%w$ZKNKGb b`h+&Iv&b bh=(iX-me2X-krX-o ۓbE=%VB+be=#VAسbUtMcv'mbHlRHmrHClJHCmjHlZHm鐎@G2!eC: e˅t4:ږtұXq8[1RH'lND'*!NUC4ggl>>kk99[3ϣZ!}}dtmݐdt :Ttmi40QH_F_C m 43љYH_E_55<!}}Y,2ooV!ζt:Ƕ\tmy<6]H l.D!].Cb9oo.!].]CҥR=eGHEߵ=Cm~~`CC7B1}0؇B)}8@WGCc!>//! >үѯS!JtU*;0ߢA!vHH@CC]mt vDHB#C]kGgg;:uvLHףؐn@7q!݈nC d't3N tҭVtHAτWWlHs! >vBHGCa_ Nt})]vJH@SCmtN^t}9}G!=3Cz=h_ !}-A7Bz=jgz̾q;;'vNHO'ܐBOy!=Cz=c,z. 94!hbWLB}b2SД44-<$FK2hX-ˡcby|x\VOhzxRV OJi2Z9<#VAgŪhX  b FxQ /Ze6Z;"AGuèzh}~m6}G Ch#Q8mGMѐ6Efs^0h0-aVGC 9mfw* F[9m s9mv.h{}h0юa~G;vor %ѮhװnaAG[ou'3,h/WXhﰈ}>aQG}b>>wA6GB owaGA tQ.G»} },,aIG@K9$dxOOG1GGDG$GdGCGCTG4GҎ@Ge :: st4::,tLXѱ0q踰a%G'ʎND'UN :4tXgg>>p9ϣχ}}!dtrXúst :%Ttji贰a#G_F_; J茰3љa3G_E_ u5-}}#Y謰oowt:'l\tny輰a;G .D] ip/7|}G@3= _uz(|uGG7= g9z =qx8p'ѓ\GOyFO= 8z=.tz.\y| bG/÷^ 8zJш[ebwE{B{_Q} jT GAXu!OE:\C 1 }&fElh6s9W k1'}#Bsbn4[%Aożh^nxz[#ތ~ ObA[+ނ~oEouBh!^,v"hQ,ubh1Y,w[VvvxzUmBrwwb ],t;Rh)SxCcn&=b"Ih'&nb*ih;$FKb;"E˺b9;&G˻b;!XNJXΈU*XΉjX.5X.ZXu:.Gu]4C9/G;G G F.&hghS h3~^^G]8m\8mVh+#ޏn.gmqh[Gۡ\8mh/vDh$heE++NE t#t&:}}3: #t:˹}}Elts9.kEl:G|t ].t9#tзз\].vy"mm7BK\}}ХRwc.C"]]ws D`~~nݭ+ +]E t+"ssw{~~//ݝ+BFvwG77DDW ]JEG.??]v]"GG??]u3Ku:W:Bף]݀npe#t#ѕM&W>B7]݂nq*F//R*G6tEz@wjF.tDt{ѽ^CDkуQBz=DkGѣYC{#8z5 "BO'}z =ZFikg3=u#zεy6B/\^t#zue1BW\uD:GhuPFBU\Q?{jT zFAM\!P=Y,qFhV4kC pfG=9qF q"4'3ͅ{zŹa~Xs_w.r;E?b2b2b2b2b2b2e -,&,&,ryyyyyyyyK2b2bi3е⹊ !c)T%ܻK%3&K1W㣕|u .)cԫK818봌uv)S-q-fKµ=bF^c<=Ƨ]O|ڵc'fNvf<Č=&`V_2}'ywiq w"%c]Z1gcG'x1tr&K)IGIH(琐˸>8 ތ+}u4n >=bGP\}McK^ճd}j~".wm 2n+%^= Qd\.,-c ׎K˸c23c?g=#WǮހk[+c?2.ϥkW1xOX]R^sץXJs)=_+R?-]}K u{KtE?h NO^:\aG5? ;ߑןfw`n?^_]ٿo1Õ/Wiw+K$P "xVkg33I ߴ9Z2gK1Opڬxcmޔ芯 קI9+oc+̮-z5VZ^`{Skӱ~Ю-W["meoݿ}S`-YpzAǞ})iMLkfZ-Ӛȴg52iMLkfZ@5fZP5gZH5fZ/Ӛ2y<Ӛ'2y2Ӛ2ìLkfZ3(Ӛ ɴfh52i͈LkFfZ3*Ӛљ֌ɴ "m t  .g N"N"ʘPu?R259QjbW2$IDތIDT<"EEWHcfg>ojw:ϵKdeTϪ`^Wg@|ۣ@V^|_ȟ?^u<4_D?ujok&'ݴ_?%suRG^nn|9?5?'~[~yˏ\/m.(_C_R2Z_[o?&KO2_^͟K|cs~l_[Wn"iڏ/4m Uqsђ-z.Lk%U9#!e]Jnx]%>n0Hu>~7{N0zUTp6xrG{VHSeqE.sO>%a3_-z]U&H*ϕterΖA6Zpc\?z-X,^''+,.Ϫ3h~7{/G9z~+`#x6x xFz^UztW\, zpYP.8twc5.Qii| &E]‹w_{oNjSmu,Z|꼠7+p+5vWq>eׁ{,}`l*)~nȡCYA p}’u vǍnj~(xl\m Z|9nj01ƕfr?V4 ^uv[{V8Ȥ ^%Џ.b Ap?UzU_W,Wo/qNᬚ=S ij)?*ZNW; ~[MW߃ nMov&x p[_V2t"޸t^*V8[=da𢋮3[]؟eg'$qW Bp&sN8. > ^}{׉*~_^p0|snn+Ŝg̐%հjU<^Hx_{k^v{c`x5{nܶ3hZPV1nGƏ66"YU]8n-A]+^53Sjsp|x#x~>Z1xUw55h> `8|Xi&uu+_\?{x?6,5ϻ58q?0rqn 6Kw.姧c{?k<`{>x'c;|;;oڋG;à r]80L?_sf\cnOmW3;/w274ׂ(nS|a+r .^p3(fgK*ۂ\|H6pbɇZ8 GE#Pw]޶[GgۙS'_1~+/~^ݜ0 햕lkKy?Yfu L?o Xw7כw;߻sN~-)pe/ɓ5fKt]~)zGN~Yg@h;|7f (Ο;yLoTpyYɿ]6w_<}y\B\ G'rD [#N]p^n;ƙ Mwq'|4| >(Tbwr %^jN^kp-x6xndasHs6Mpo Z*` -WN>!1W nt/n |s!;_~r=7fB-~w<;yi&_쮅WtW_6q+'45W,;e=L?`qs8y?^7׀uo̝]M{ w#^1?׀mɏd~_-nl'oq%Uɫ)|xsiɛthk6Յj9jwyi󀋁GW;UZaE8;yOy{B8yя;=͇7.yo|u5߁?m2;yL'`ꙁ~{֚)~=xJ>8_yk ~] '_)O?{wO7_ u]mvǀO};= ;kjNoMsN^y_AqE>7x??b[. 6>fooaLqՅ]W/ N{VVwk라^/<{3)w&'3}?'{KW56L?_ ~}ILT('x'&W_zQ N`U~]t{J\~nz)ˉoP0'Ǚ| _G6NdG߭0|N޶5߃oSǼ]!^{مaW8ק*%pJ7~~%l qE+76"|TLWpqwOwe*? *84Co-'ϳx<|f?Y4oBMzG? v0,sw_ ɷL>~\aQ8W?3-f~ _.qG%Oqe7l759՚d4>Vk˞p-h;ς'9ZG5`+NnEg9䞅Y. | '/=C3|x^ýn2ǘ];:Omۂπoc_9&A?`Xi /NOp~7w7J,5ϿŽN7?On>q+x?诱v~ N~ U_ /NO|{^N77tU`wr+.8wr LWzsMWN~/Ly`8vN^лf0d_ ^آo.x˽,Õ/`>? N>.xRR|~7ˏN7O-/7P;9ܶ"w{KlS0w(̃m_0nv{;yvx2.b[L? Z8-+eV[9W_z'XG^\~wN;Lo`8IԘj/)~AҀ.jprxz^I3prxz.jo3ý'29_rSŧ}IVY;˦::Y`>0\EkO,pmoj74Ϻg}n΀pvsUz'"`>K.\w>5Wpvөwh/1M6ϛ9<IeE4N77x2.~.5]989T?~I>90U_fn>Qy3])0 /w^nnQ;9T7)w.`rwmn7-s@ g7pqK?8M],[`;Fx'{rp` 8kV_ǵ Ӄ\?I|SqN~}ɧ|~gO]8/Hvog%pry2׀= '?|I8trxsb4Nhxd/µ>wr.G58yùOI 'oqy pu8{\?: nnȕjMr?5>en,,8];89X>Mk: Hs1oNOw;bmm >[n{N77'w?x}=m~҄"H`yCpU,' z@'_Sf+xs/D~!(ᎃL M{eϱweTNiGSē풢]FF<rcn3_-k<8sfe;[Z:E`.o./Y<$| ,W.yM(8|-|j˖N+{g.s?d̾e=K-\o[]N<D=~w2Un ڊ .V:~GR['W?]}- }N~>=vg^ A'߹刽<| yh_n?^;c 1fzQ煮iJE ?0[,ʟ j{du9 X>? [ڻy/o.x ?Y>?C\fٴ~.+֥JK-/Yu^ nYx>t< ~O⅖M˽厚cזN! 8Wyv6ע}&KopGCK'Tc) f xؔesY<~ K'_Try MM|~Ѵu{~>zsXZ6-Zkk~jg2?7?+2fmZ&X:yC?`.k8yJ M0[T/>Lճ +`ypW[:y٦`'^K7Lu)K'߱mf\zr/K'o~bUN{ɇƀ9%;Z:3K?l]ڀ;~_yoB-'}MK04x{,4+sk[]ۙWWN`'M9gJ[>3`cyn5cA)yL0x䦵):IPipGH+5 ̾x~~)-oEN>`xxrsu{gK,, ϯ&f6x#q`\sߦW^$ψǗ/+v[mOM\6Y<4OMl p4xn Nܚ2ɗ7ߗΕr+I ^ W<@.w5eS~b5`6~D qw-r|f>F0yqw'c>aω?8Մd!p].-|v+~xF͞ :i۔x>gmG8CGJ%_O}NAdT3MKA$ς}NDz`>?\oI{NU/NE׹No'NOy-'AG]^|<a*\}1_5:sqc|F~~UWL?? p^[ NH2 yn;Nbɷ=kliٴ4p2 ~|l0o?j@'0~{ٝ;;x y6A=;ׅ;'#'gwNWNy92b0s:MpRb:sٝϛٝٝG~'gwN?ߘzyy޴'"?gw<fwE#Wgw9U`vt{#Wgw9fw>GN\LWgwN'?'gwN>fwN?'gw<|9r0ٝ?fwUNMeprvٝs9i?7;mruvkٝOy999ruvt+#Wgw~9[u`v瑓;\y#Wgw9(Iyp,I9ٝGٝo;`vc·ٝٝo;ׄ;\rrvٝ/'gwN?֜N~σٚ?%'';+9ٝ;|prv瑫;gN|969]݀ٝGNNNmUsvٝG~>,ٝ˧<9sys0w;;o;;;('gwN??[Moٝד;g> 89slͫEN^)Wgw>KN\9#prvٝGN^\ y_1ψٟ;Wg99s`v瑓ٝ/'gwA0[rr2fkpr2]%0IrrvٝW;g~N-rrv築ٝ?o'gw/ٚ)''? {99-~nc~n#?? > fw~9;gN|\y/99sz30sC;yfw~9`vtprvOٝϓ;Lu99s-~nٝϛ-ėԷ;Ըb<ַXbwoaw.}hooawN?쯱9a0s:އTCtDM(q{0s:yv`vlZ~)W߰;Zvtj=_`bօ9|7ovQF5-ٟ_ fwN'л9"`vt e؝u fwN?_[LԷ;+vl]*ٝ?suM<֜N5yfNCS?ٺ;`ew.]/yԴ.f[v~1[o nfwN?_z)|ZvlZ7ְ;g~jZ؝? e/H;_[Lbf5-d珤c2}t'|(9<;$sl{dyfr ݷjZ|9@ٺJ-&jZ;gӲ9aw|9ߵ3[o}ɭso1oawG} [s>?1wg.ٝoR˿li!ofwy}-fvt`[H-&ַXbZٝ^j؝?fw_l؝G [s6-&.֥Fo1t ̾9>7ϰ;ߦօ9tb-&[؝o|va`v`wN?9ݷ$9|3X5-ٟo1GԺ;[ s--lٟK-&[؝WTyfw-`vϿ[}a9s.Σe sk/0.lJ7j]ؚGMKl]ؚ?[LԷ;GM sٟz.0sK;օݹ/FMˣz`v'B0s磿ϝdw|(5-ٟ;/9`vQrHKoqߨoawN?? fw|Io1Qy& s{2ٟ-{°;օ9{vj]ؚGMK+ٟϨsȰ;g.ݷ}v5k؝?fw/wvmպ;vbP݇`>C]tpsv|~#}b.vv>M(>1sy6ܜ9|ytG\?}DqfwN'?7ML;oţ`8 ܜ9]20sUtt ٝKٝ+ٝCMtNn;nBNjtq>? P8|9|x1.N'o7gwNWofwN?o7gwMtq=tty_0s:ZdR0 ewN?/fw#ܜ9|8.N?o7gwN?fw%9V9ps::*`vpsvM>4Y-sM݄ڙdtps2[A`vϯ;J`vtpsvtPS\7dٝɟ;g ܇>L?_t`8? 7gwNWo?Oٝ+ٚ#;g~nNGWٝYz0s:ya9~59ܜ9g 9s>?N߇uJfwN'_ 7gwNW_oOt~Lg~ܜ9]9? 7s`vtP,T>\5P7ψٝ߃;;g^n~~#9oū&^Motp "fwN'ςM߇ ekN?798?h݄GV94ܜL??MDΟ;'Iٝ?}h}hCuCϯO߇&PvnB_K߇z?ٟ7gwVtq:AO`8psvV.N?ǛPs0]yE9~^6}d2:}Cٝ?nNG+&vٟ݊;|pvvϏٝ?ߑu}hٝ?Oٝ?ofwK9s>? fwnB;ߪP::`8|p>;9=9].^E7>9npsvcu+Jglj9t8~psvGCoGh9st;29ٟ ?? 7gwD>EZb6hc.}Ev祴[\N>f_u}00[:J=`,>4}Ev~%1[i?;Sedq0s:mg$Mz_DqfwN?ٺ ;/ْ[r0h_;O`,|~~-ۖ;oz  fB'?1sgٵTҾ"s} W c̖Nmk|3x - S;֢~ ̖NZ;j?"uB|~q|sb UNZSw{-ܾͺa" Fw-i16χ?r*\Ki=Z[˘+%ى2){p?މk/r$YC["@5 UYl''@B8=_O5ړ< )*![65&?~FÈFQq1>>?FC;%Z8w<-ǒe4X)?dCEBٛ[Ђp@Aw`0I2ksLY}\!tiW fu`o?@awrjĔ?PBZhU-W }Evk ظKٝ?_g [5`vlZ)[Iׂٲ?:;g ,|QlYI\ز?~ [lYI73ϟeP0s>3_up/׃ٲwrk1֥- |mZLuYWLFN+&Od2I:9ٺ[;Zí$`,|~ޕZL? fo[IlYش ypYK0[>?Rn-ٹꏂٲiYW4Ѿ"[:_skѰ?ߓW43fٲK?rkѰu) f¦e=fMv ؝ٝɟi:#`wOٝyjvl]Zٲ9 [&9|uOvt;g2 N^k҄9[`,t[^ϭElz_??׾sv.lY؟_46`we&- k8[K0[>?O;Oen74`wN?fB'/W4Ѿ"[:KskѰufwN'n-.lY'֢~^̖Nު^wn-zW7`vtvl]L+39skyK0[:pkJ0ss&h}Ev|f>LlY7=WePl z_GnZ8- fw+qarUz_19}Eni! fwN?:\90sy_Vv`v֢q`Ѿ"~5/_$AWL?r\nCf^֜ifEz_1bˏM$Εb`,ge؝?fwgWpkwq 0s翦saB'?ƶE|̖y s;$Sl\[lY3j֢9W ظ_;g>_ZL? fwΦ%LT0[}>ͭ$w;g^oIn-&}fwN'?˲;gybyA0sy<;g~р9{pk10[b`,t}EWtѾ"s~0sqaM{Ey睻v;grͶZL?lY؟[#`w|Cz_8+;g⿷l\؟fw|Ss.klY؟OY[Icٟl+sy"牘'b~<`ks?6χ7$14G~ L*NWGN^lWǜΈq]9&}fse./$'/wC/z)0srs_χ~nNt<8)v?O;y*r.ɏ.Uoɋz;z5Lsε*?orDYF$O'?2>Ob|=8穘ϯ^^.?/<\NsD^\疮sK?+*W(sퟻy'9y,]]ݹ-\6rrމ\^!'!60\ݹmWﴑ|m6r[#('(\6rؑr$oם4Vkյn#'h"'hkFN^(z0s[ڶs2sۘ']F>9yE?Oe#W'GN޴^wzcp[9mkN0\66r|ܖ9ׁϿͮm7=Sڲ;m#'6*J%Φ*#?iyTy#?|Kԗ]5GKm .)?]\~|R~>7ǂe|vO(_$|"Ns\ݹs;:=kɵ?wε?w5`v7qq0\玬s9qw'"W?fwsGWH~ǖdcvpjLD>L'ewsK'ews\%:NsKWkܲ;]$??+^ k[I[v?εn?εn?turb~<8->kܲ;ewsKWk6W;kNNs\;Gպt;-;εs\;ε~if"εs\.ַ\;εsퟻXb>a}h\A>C sv?7пqMy~Cn"MCkl0@-M聇D}p>nB{^ ut+  us5372݊N;cwsnBz-MhԳS{t}I{B|gs퟇ε;y\!s퟇Аݹ}h\!s\c|OQ5k;u܊ε;ε4}h0se3s퟇АݹCv?ٝkӦ9mZTxG@[ε؝kml*E\n?l*&E\nv_m2.&f6ݔ֢MۦEW:d]̦3EMg wjk 87fws2g6֢M߻sεb.h_qȃol*1@rX <2膊O}Ŋ~Wi_8hh_)hwgj_1+վbE+^M־GR㴯x+6bо"y߮h_\!s퟇ε;y\!s퟇ε;y\!s\s퟇εӛb\!s\V+~T RŀݹCv?ٝkD'o;eUdڧ2w%*kgIdmmϭ0.U˼]Ei?I䖉D7KeU؝k-DyG2*rC~8hcϭ]y޴G'εnٝkvɼͼ(xItZ]EN\AN<󮢀ݹσz?h|O3穘k~":y rpNDݹs퟇e&`v?ٝk~^y\]Ea;Bv?ٝk5;ػz'pmwε;yX?N̻Mwk3* c' GM[퟇#'gwݹCv?ٝk1[v?ٝkܷ??ؚGMKl]ؚ?[\Է;y\lZٺ8퟇ε;9ݹ}w5-ٝkCM>hiܝW;cws\ݹ-sVi7Nu?εnٝk7VvxB>FU3εnCm>Fl͵yz<\Mi<\瞵Tt\)v?筨wq;v?MhE>49CC>4C?݇;9oEC>4T10]\ݹ]\O`s;v?Mhsފ?}hs}(s{Gεs{εs\5}hٝkw?ݹ}wsߝk;}ws?wtqퟛ5Ps\ܹ?~Eݯ',<9нܹ?7,?ܹ?ܹ?E?NE?E?ܹ?W\C\GC\C+z~Eȝs/d\Dr} s]~~ܹ?~E~~ZcE{!"ϡS/QsTOدЩ^ȝs/E9t-E9t*E9t-E9t*E9t-E9+~E[/+د_/Qs/E9t-E9t*E9t-E9t*E9t-E9t*Er:}}}?NE?iȹ@ECעOCo~E?NE?E?NE?E?NE?B\{!w.Ͻ;^ȝs/E9t*D9t-D9+HO{!w.Ͻ;^ȝs/Er s>]>}:} s>]>>ܹ?NE?B\CO4\ "ϡk'Ͻ;еЩеЩе^ȝs/E9t*|W iȝsZsTsZs/Er}_g+B\{ mr Ye,?O?NE?O~#\!wn+BECW-ϡ_+ϓ }kȝdȝdȝ;; w.ϡk1YݯZ?O-1"}E?NE?G-ϡS/ϡk/ϡS/};>ȝc.5E9+E,=OTO~)Zw|pʯ 䎵#/7ϭ]Os2zxSM?yWJr *fre5?9w`IW *g+V?yͮE?ک܊)?y)ʥ?)Jg?);?S<9S'<,SG=LS9{<rkLR)')͏y ')z MR*ɍo')y 7?y$sON>IYsc':Ic'/k\1:I3=O ~DRY'*y _'*QΟIO>U15LT]eLT2O~{j[R ''*}[ LT'&*Cy dlG'_Զhu:zb_xxUTΕ=B9{}WzmyUZh:epy[QݳGu/mDὝn6QWFDt:̚j=P͗j=7SӡhP|; zc;zFqfŨ=~?2_'GOf̱2=mb:U=_d&תcsQ_]gG16s=L I {~Ao_ڞ\=KE{P cn*ƭ{M*nT-x G\\?Qn;{8~Mk^EA={z3a?X>o`ƕ{O #=Z[zjz? G/εGM{ֽOZ=>*O z z]y_DQwID`d=ڍ LޣlW)'AѮR=F\lsʵ{%Lj 5Sn@y5K7'.W}> w{ zbe. zFǂ}*Acx_AQ8Aj8ߊ Am|82m2Y]|7NF/59=z.-=Ԙ z7_y/ɹ%A[k{{O|᭸5=lc{~~wZŠ~8;|{$Lmcf)KAmTASwKՠݣGcU{Yw{L{XH{蛶$M!s}A16OGH{Zޣ^ƪ= ?m4xG.糢Xr8zsWGc fazNj E1MWsD5PL1Y#|3w=XixMf<{7 9xtYxND{7/a{<\qczh=zYU< z2XkBНjsN*/CzMcYQDQ0ukǩaYXBW͚V>zjY+V5DÀ*{gǹYu(RuUǑt5ޣ|] GrDyc=,fza3ػ:Փsz{_Ui=]ev\{0%{55œ%7_cE2s{L76ǭƣsz[+míJ= 4}ɑ=eG̾L=_X: ޣŋ_=::`d|N5Hs z1ѫ%=z3z~FQ#]1b9 1clDcG|ccQ=tuCRi#Tg^1>kcF{ِ@dtF) 0kyw{\mPZ@10zq;ћh~U sV- O#+=4< ǘ"z_uFѩNc@i=V̬t ޣLg<+U{|ݫ9tu~ߩ=ozo(>(^Gm;/jWFQw>T=?m6z9-sߥ6=}jNǦz^z_~hEC1rv+}=gI3 ǎ֘s4%NN[ؽJ /<։4eM+Mnck= ǨYi'k=kNi=nbsAѸ+xG ֤5ZƫxM㬡i=ufᄂTfVޣO'i=x[G2{hEY%xSX[5+5DXD2Z`(4SQlGﱷD^kA=bhM;-z/k(;/{ܺ._ %0͏cP*=掟mz#1T^V{yI-۩p׬f.U1}JYqT=6,@}Y6sR=~a:c쒿5G(yq wߍڣ6CQmz#\"~{0h znM6&YRvoX#_{ [.3nJ㗕 -1#z]ӫAqp㟹oW6ǡw;= 4pUuـޣˎ(=._izs^ֺ񁽽\Mlj? GS"C3vq3{WSOA1˃&gH{ ;:%5ߌks:&3ܟkK+;$hO{d^Yrc˳L~'ؼ D{Mݕc/bF"zٛ޶MDqy$hQa։=-kޣ͡96-{:"=-{V8=[h"zKrO2!׼ ͉=f-gLDqr%DW_HsArT oAѲ7ӂޣdfނӂc%SBF'׶ MTf4x& =b|y=ol䑨{/@ cH =bv^=^:eQK=갴h-^}GP( j[EQVjWA c@ͪ{Z5x.}=fCQ4GGjY&=1QǦqd=LD ]X=rG>{ *-jM{4F chfPxX5xܨ{5xGQZ>hm j~]GAOƣq9G=6oGчJ{zKQr{ܝ5xj|?=޼Q͏ǜPx9jGC ޣٱ){G,PxtByNPؓP5x*kq=G #{ c{djq7ҋ'PX[ʏG{jMAsPXK=:Px}M hGuQp;?C2MD HW5x1IP8S4{)GeA cq,jF c>=V jVA #mՕ{ajN/G @֠Qڽ 5xQ}=5 5xw5Fnp=ǑuѨ{txxǨ{45xj[a =P;5xEg=5x귟'׶(&us݇>sN|{qh_.Þ{o`sCO&ܣW%=os=cs{#zFzӞ{,ڐ˴_0oʘܣjMi=2es~[Ǣߚ#6ǑS7δ?lsfcƥM{ѠJӞ{8δ#ܣAi=Umso=Ӟ{ԙqܴNܣҒc=hi=gs,Ӟ{LQwv=x`i=2gsg'Z1ִcw7Gdf=PQ5G%M{V>Ӟ{޴<2GC[a=\isf\1=Ͼ5G柪ܣR=x}4a=M#[{@{4̵=)>4(9>4xŵ=x%>4x >4=I J{d{T{=Bso{%3{'$eO= ,K=,O=H=.L==n8؜#>ǹǷ?=W8qǹGsYџ?yxb=Ga=ʯby ;aL8gy ӛvޣ{,Xcyӿ1j/δK0vc߿v@ݭ40ǭ L;ﱩ){Vvޣؾi=>ۙƲI?G9-;sPe=4(jy^,;h{Zvޣjմ5-;Zv#Ge=ddy_켇e=Z^oymC,;1t{i= ly|Uvhc4/fvޣo8{eyvޣb{4DžL;QH{ϻkycuvcvua=.Űo5% ;@{815 ;~{ ;°͋0GbðC{ y-NǙp8WDz;mP{0`=Vf- ~ISSS-{D=vޣ;Q1)ؼ<,}B(jPsg(?"X=d<~@ 퍱ǒMͱ-GoGG `<ʪ˥ K { {}I%ssia{.Ri>sFs)i˦GL{űilo{.ڴ\Ok{.Y,{%\-{%Hs}e﹜{TŲ\^j{.4=-[Kᄈ=n{X˩Xvoee~ܲ\"Y=sc{.,{%lYs!2jО˴YB{.L si'6/K\hϥBОK)q=#C{.2Ň\2d sQć\RŇ\V̌s9ͽ#,!bBBhel\BhϥOBBhϥwbBheԤО˅ =/B{._%\ =$|sѶjz_;jޣOWq?nBU_g/{ W^:#F3Í=yq'z:NDQ?o/DQsס7϶z-8ό;ct>*zA9GjKξ?(}䬳־ a}l=d;,t3z95@at,$z{}cg͝9k}qu=Z,;R{|uWޣ7;C DvoήF(ܝX)#;oLD1w&xbsՊ)='|i*zf9#OI+{\7YUZakIե*zW#ʠ8i^ G(8aև{$J.:z 0D7h7[C*-/G&ro z {:[@#{OsGޛ9s3\b9ɷ?+ޣarLla|E~#A&W?{T)EzknDqchVQ 09Ӱa=t.W-7唳=QmOn^c=M'wjGr= GQbPQ9m=bɂ㗵e*]=PA^G_*= @1|KK3?C&t G1bAQyv0Ȭd{ ϖ zc*hZ{hZ{EjZ{EjZ{:hZ{EjZ{EjZ{EjZ{EjZ{EjZ{EjZ{ {EjZ{B{EjZ{EjZ{NEjZ{s+=P~Ԣ@-=P~Ԣ@-=P~Ԣ@-=P~Ԣ@-=P~@-=P~Ԣ@-=P~ԢZ{1gHXEjZ{EjZ{Ej-=P~Ԣ@-=P~Ԣ@-=P~Ԣ@-=P~Ԣ@-=P~Ԣ@-=P~Ԣ=> 5UIJzM5k^SjT#5HFzM5k^SjT':5INzMuk^ST':5INzMuk^ST':5INzMuk^ST':5INzMuk^SjT#5HFzM5k^SjT#5HFzMUk^ST%*5UIJzMUk^ST%*5UIJzMUk^S*T! 5UHBzMk^S5^S5!14Ɛ^kCzMcHi 5!14IIIIIIIIHHHH~^{. 碒{.*碒{.*碑{.碑{.碑{.碑{.碑{.碑{.碑{.碑{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.:碓{.碑{.碑{.碑{.碑{.碑{.碑{.碑{.*碒{.*碒{.*碒{.*碒{.*碒{.*碒{.*碒{.*碒{.*碒{. 碐{. 碐{. 碐{. 碐{. 碐{.rCx=CĐ{.1䞋sq{.nrM=7&\䞋sq{.nrM=7&\䞋sq{.nrM=7&\\䞋sq{..rE="\\'Ic; c;*c;*c;*c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;c;*c;*c;*c;*c;*c;*c;*c; c; c; c; c; c; c; c; c;rCz[c!wl=m cCغ[7c&wl䎭ܱu;nrMغ[7c&wl䎭ܱu;.rEغ[c"wl]䎭ܱu;.rEغ[c"wl]䎭ܱu;m4cMF;\>MC!%#F"V!N#^JA9@9d fI23s,YqLJE91+.0anlI{s.E91'~\sIss-D9;b^yC8#_:Xs(b8p?#\P:Xs!œ K'p."B!FĢJgeβt1st)]@,ƹt8%KHKr.)]A,Źt452H8GI7r.+Xs9&by[8Wn#~K/Ċ+Jw+q$E̹t *}hDg-=B##*D*=A8kSD.=Cʹj ꜫK/kp!XsMb-ε׈9ז \GzXs]b=9ח> 6܀ؐsC1FI篤4 1RZ؄s)lʹ6L~)lιBR[qn%ee9`ml -Rv؎s;)lϹ~[)wRn؁s)ȹvI;s,g]8w 0J n ;RA؃sɹTK*{s-E0>H_0JEd؏s?)_r2H@ pAR 8`$yT,M`G8bQG8x1)|\J`'8&2?8!%2OJI S$xii2<4|Vq>'Mc93 /H3E K 2,xi64^|Ms.c78ߐ3?9)-`79ߔ2[oI?2ۜoK_3;H?1JK= >2i9|>HZ>XWSi5|>\Z_p~!c/939+m`862ל_Ko -;i+|Jlގ83pNüi9e>t1?bzY bX1#@933s,8Rpv"f圕B v#f㜍A9;ۋs1'l?b.ιܜsy8a#圗B9;s~v(b8pv sΟ9d' q.@,̹0;Xsv 1s;/Ģ2gC#:9;b9gKp..#\]A,ŹXsiv 2:b(v,Or˱9g+pn#~ɹ7pq> `_}YQg~,؟st<s<w?;\- g\;MLdIK@@;,lamC iPxߞ y_^?93:sV'm9yS6݀nbӍƨmEP~~jӯЯk6݄na樑6&jMEm-薨glMۢt;=jMw;t'3jMw&t7;jM{&t/7jMCbt/jM@t5æуQ3m#c6=eӟПf0z8jM6X-bEb1K,w%NN{xzX-i/BKhi{x7z}@,ˢeb9xz}HAch}DCb<og1M$&'hyWZMVOJ)2Z]VO)h}FVϊj9:Z>/@kĚhMX e_kbXk)CWh}m`[6DGCmdۊ6FJ&hQ)֊6Cٮ涧h +miB[F{{hE[ Am3)mggV=΢}}vVE;lvD;vs(lT ΥhW[nh7;@{y) eW7.h]PѾh_~vaE"@E):dW~~w* }%}}.##viE}}.ccvYEG)}OO1>>ec}}ڎSt(:ԎW4M+: eWPt4:ڮ33v%EE++:cWQt,:NQt:ήxt]M щv E'욊NF'۵Nk+:jQt:ͮssv=E@g δ*ubjhPh4Z} f@3ŌhF ͤ>3'b4T̊fUls1;]ms9F1'S}!Bs/hnͣ@Pļh^ẎS߈[Z@m VZHm vZDENZLnZBDT{ŻлwbI^,Rhi_[ˠebY:(C˩{{!1Q?!4h:"ơqƫcb~D&b2NWZA&VD+b%:%VF+*huZLAS*ZU9:Z]k5&ZS]k%6Z[]ub]SSWh}uUl6PC UChchrmCcUSCǩW:;t":Qp$tdUˡS)CSUNC}}Nstt 3љCGW: ;t6:[5qtjT3;%%¡sѹCT+G{]Z;t!Pq"tjbΡK%CK}].S]::tBurJtU*šժCנkT7;á} }Mr몷CעkU:MMϡoo}}[ p;;jCEUߡ]tztzȡihzءG!ЏЏԣX=OOT=ԓ\= 5ġэi~~:KKЯЯ0~~;tIpftoo(~~F;t E=ЭVCnG݁Pݩ;tKMpnt=5ɡ{ѽjCCSS=}>5͡9@ApA=Ra5ǡG#Ez =^rjCAQz=;zB-pjCCSz=;zJ-qjCO2AϨ=U+z=V:M˜.G;5]p:i]ttjtU5//;5}}NOM_C_szi:[ӵZoo8}5}}[[NMFvh3PwwAqe,zY9Ryg jM/5^B/9/kz켢Ϋ鼦WѫZM-7(4J)ڨۢ:QZ+=>ubzhPh4Z f@3ŌhF ͤ?3'b4T̊f՟ls1;]os9F1'S!Bs/hnͣ@Лļh^Ẏ߈[Z@o VZHo vZDENZLnZBD{ŻлwbI^,hi_[ˠebY>(C{{!1?!4h>"ơqcbD&b2OWZA&VD+b%>%VF+*h}ZLAS*ZU9:Z]k5&ZS_k%6Z[_ub]SWh}}Ul6ЖK uKhc\m iS)~L.m6מK[-ҖhKJދޫ]m3 Fgti[vh;٥:KCY]#Qgwi'hgӥ].:K]unvC<.vwCuiO^h/ߥ޺K}tAEB.Ӆ]t:@u@t.A ]ܥuG\Н\];tJwqjt5ͥ//.}}Ep諺K_C_ӽ\:ҵZǥoo.}}Ss[[KF\ww wC]]riv~~##K?F?֏K?E?O33K?G?OtAqFt~ڥ__.R++=̥__.݄n#\ݬG=ʥߢ.݂nϸt+U?m6=ƥzKw;8Dw.݅\ݭ'tGOr^t~~tOOs~t~ΥzK@3\z=gGGK,g0zXq~GѣEC\3__<G.= \+^"DO.=K\;^i̥g3zKϢg C.=׫\zW"zQq%~٥_u5^A]z׺rFo6jo Uۢ:;F袮衞裾N ]/Ըib4~ f@3ьGb&4~"fAYѬgb64ns9܍bN4 ~)Fs_y<&1/,C߈bE,tB60Z.A;ĢhQwX -b uĵ;hg7G]\vus{hw@{y=h/ߣnA=h?[أn@E=: t[ܣ%<{GDtCCnI>>##niFw{QQGCszqqG@pnGBrCqc=4ѡP7ޣha07ѣnGG#dDG=: Vht[ѣϠϸ<,[٣c1nEǺ)szt<:ޭ G'Nrkzt2:٭)GS:Nsz99Gpxt&:mFr{t6:m9G_@_pyEEG_B_r[xt.:myu:AG׻y4 Ms#яЏG=1G?A?q }ңOytэFi~~nGBrykkwG7݌nvGzwGEuG{t }ƣ[ѭ݆nsxt;wGw;݅r'xt7۝=hvo9́69ќb.4}%Ax_wwxļh^o}#G{ߊ Z*B yhaoX-Eb1K,v%NNoxzX-}/BKyhiox7zw@,~ˢeb9xzwHAchwDC㼣b<g1M~$︘&{'hyWZMVNJ)2Z]VN)hwFVΊj9:Z;/@kxĚhMX ]kbX)CyWh}mY>m6|m>m6OM<ǧMѦi3~4h iK3>׋ikm6^FEz|mei{ŧyY}eiGݧN^vF;{9}iWۧn^vG{wӞhO/O{> +Ӿh_O>t:+Ӂ@O>+;} wOBJaaOAJt0:ػۧze|W֧{|wODb|tӧѧ8Ez>MESCy>|:%t$:+Q(OG>}}ƫgg>t,:K8tWէ^5N@'x}:$t7 nD7zO oODR}7̧__{} ft7ҧߠx|-7ڧ[-3>݊n6t7ƧX@wx|.t7DAx|Mww~~M>t7ͧs>=oO>{ާC,a7ǧG# >=^1OFoOǽ>=WWoOC$z[S)oOG4z[3oOϢg>=V^^eO@^k>^^U֧7(4SQKT5wEuDEubzѠOh1P̈f?3hf1 T̊f?hvos9/\h.K17J̃@7yѼf1F̏ -bAU,򷉅vZ!E;bh1X-K%=^..;$Z^,~nnX- Erh9G?!4cXGx4?&& b""&Iq1MObX+SbeXSXsbu^/5!~l <t(:ԏh*'t:O pt?9#ё~BG:W 33~>>Wt_%cѱ~J@ǡt:ЉDF@'Nkt :ůЩTN@}}ίt~@g3yyQ@gt:of}}oЗЗ[t:o|ހ.@] "t6~.A]e2C@];t%U*K@W]ee{@_A_{UUg@_C_{uuw@עk>}}77~} }зѷ}}wwA}}Ͽ?t0CMCH@?D?##р~~?OO)D@?C? S݀nt#:__C%ЯЯaM&D@7oo݂n Vtl@1ݎntНN|@w ݍ'tǟн^r@C{{j@iݏ ?=??3z= =g''v@9=_Qb@3?7z= ('ѓ„BOK;4Az=92^@/z a&?hb&d498!G obEbpRV NbJpZLAS3bUjpVV ΉyZ# DkZhX\u?ĺhOZ/"GWh2!02( m6M&chSi m6 \Ch hH[-Vhz/zomhku6h mѶA&Cۡ̆GY /jhCЎh NAC;vA v r 1;=h =ўA>C{F{ 2/(lhP耠сA1Cޏ0NCD 2! }}$(m`tppe } },(kA9C@1I ЧЧC!AOOqE񆦢AaAA#A#ёAyCG FG }}&dAeCǠc*E)CU :T7t":1a$tRP䠖S)AmCS:NCu }}.gttzP茠3љACCG: 46t6:;hbtNf47%sѹAKCVG]6t!0hc"tQ⠝K%A{CK ]. :]t4t"dJteU誠AWCנGx=h1X??s %gqx0` -XdIdS`K =z=,7,z6Xa9\` jC/5^B//zbfJWѫZC-7(4ʼ)ڨmۢ:Qڼ+k=3>ubfhPch4| f@3ŌhF d>3'b4T̊f5ls1;ls9F1'|!Bs/hnc@0ļh^Ẏ3߈[Zl VZl vZENZnZD4{ŻлwbI^,2hi_ˠebY9(C˙{{!11?!4dh9"ơqƛcb`~D󋘄&b2lNWZ&VD+b%9%VF+*hsZLAS*Z՜9:Zݜk5&Z\k%6Z\ub]S3Wh}sUl60V4m64QѴѴ1بhmbhmjt4m63n4m67^4m0~4m4A4mۏދkikM۠mLhmk2Evh;9Gۛ,>>5v@;lѴ#dN&G4v69iM]Mh }DYQ֋ƶKKFYt.:83ڢƵt,]h|.BXt D[t)d2thrɢ+&EW+MBW]6,]c[eeâ}}kk&E_G_7y,]k&ED4,oѷѷMc Z]]SȢ}}:t)jzS̢ih)nL ~~hGG.~~lJZSʢ mMn@7݈n4,Ǣ__~~eBZtYt3[`ooME[LE[MELynG ݁0-i*YtTntb=bѽ^SբߡߙjT>ta~SӢE@0-z=hXGGSעCEB2-z=lXz4Qidc1آ??&4qif ܢ ʹIieS)sEG7-z=mX zƴYigs9ޢ>^@/^4-z d:Y2ztED4]-zbY*ztݲ{X4 iQ{YT*EԉcQuQ7E=ԋoQX4@5dh4:~f@3D?`ьh- E3h4K#͊fllhG-Es9hN4gͅ~ҢOY4j[7m?%n1^Ԕ|]?"}߰~J~2oou-)S8/2[mf|v5<ԕ}ȿaf Y!,|A~; V$~&}%jlɿ? QYoߵ`aW/$s1#m㯽FquS[~kzהǭsr.aG^'-(Jֳ>\y UqpO^߻::::E:E::oZg_Q|GO|\ 㳈bϋVXOeaϜXſA][T{ƟX?ýdijb|(xn88`^Z7x.wm _RS2nמs S~OGudaF_<29K=ݠ.r_ OkIp0 `6<}E~|$%m/' ښ*|kv0S~D/;_AᗹNez\s9:?q?r鍿c?7\C^Քcu-^Uhبlb\P MZP81&>_5ָUj5:nޮ:lتQjvR|l(1\LL|W׼V-۔m4hp.֨ܰV¡qII %n.&/(SpPXޤeZͯ{&iܸIZMp\LBLP9I1h(&`r+Ň2<+Ɖb(&bymCmr!:$[dlCuHceXyX6VMH_l+[ֱul'[qul''ɶqex:^ex:^e6!:ANd:ANdD:Q9QMm(['։ul(['Iul$['#'ɶImRRd$:YNed:YNedyd6Y-uyٺl]^./[eSZ+0/1QLEZYHY($[, , , qq2B2B2B2B2B2B2B2B̲̲̲g',$,$,$,$,$,$,$,'[, , , ŧ?B2B2B2B2B2B2B2B2B ̲̲̲PB#$,$,$,$,$,$L.KPNedd!g!g!g!g!g!g!g!g$ZfYHfY(9¹ǚ>3og^~<:12.fKld{NcLrd?1ɑG oyf=c1׌띾Xҟ#V 1.:DbxYrxq ޏ #M GG(!6>XqB#g/oqʧoS9G(L^.Xrx߱1G %Ϙy,|mȻ/}?|G?G^זG)} ^גãPd>54!})+vbx?;8EB<q?bX +Vx?Çxm>5?>1< ]76ѵ=1x(kk{1=qFttCzsu{O{heWjJ–ɔW2k#ёgyd7ƿo,>-,/UoO1ɩ δbV>ʔ8^R!)_WVR@S#|^}'>pIMӶe|S"S|%|Jz߹i^-;޹7}qd͟ϗx>&lM˒IY2/KeԿ,%KݛPô08:0sD-NcWq6uDOSbڿ]?4Mox_t rdGpEYpߵw_Ʃr=>~oS ȤQ' 6qo0^Z?WyDžȸĨ\7/O~Zص.nnb~YƷ2EƷxG{1pMN߬zD*pMϲ<|,Y,g9,|,y3ǩ,s><1eƘrsX|m9,|6qx>_c8<1eƘ׊|m9,|6c kcauͯq?Mo\oq~R?o|>S?o|S?oz޸M qpsvy|K獛_7n~?F~޸y{獛7nD~޸k{,!9|nf<^߬wُϞmooWnOh+[>+pc*%8vuN<2tu0Nn7U|hc)oPP pg2n5Z"cpʑuM_K"\rd}>ȹ ?g9/?gu 8Fw~R^t[7KE1LjuE ٶeomMX 94#Ώy~F94{46}<-sq>ʑǪy,<79?|nG^cnT ̙ʑ91IJp97|~d9P928:gu33|278e9rdpu8982"pp9?ǜ9s1 3Ǒׅr|v"?ys>>Fω̍>2+!|d_4.12oec χ4΁{?>24\J _gdu3|"ל5-#MJkZW…Z|gFyXsїj~t \ ge˳4\NX3p T믲ʠ+*]W.%p)\.K` .Op>:.ws> hNmv'al=[a'?vއw:n8[c]`o,e!sa_5`/F-9{ {W?nO{ aqw+ǨvKx7c <;宅h8ơ!= ,>;Ð!{-Z,F,@{ڡ=` lawy`<VMUօ n)˫zVeg5 @Xc͆nn5E`sr`l;Іxmh5BX+w6£Ǩ ym^}іք--[ P{h+_Ua+wWsLU-J"F-`f̊67MMaF4;`F+0G +PH"mpu+[WrEignlށ[nrjp]\iu %1*^aX - A^%n KE`ȹ; =RULzN}=!oLöp }>Űu!|Sn<}lɌ "jǫSu6Upɉ+O>4wy7w~qׂkN\s(jq-0sb߉{Ug¨  3 kĵrſe '5X/+^L qF~)m3;,} ̎bw/>cp's ,3 K\d*ﲀߧ?GWcZsap;}Q6quQ.wl}:vmFqK'npӟ?}[Ƒێ a93^AP׷mb_[Vښ땐'm .t g sTFyAf6`X  mlc0› @ J%zJJUVfr*+<:+ؕ;_~} \>D:JgxfrWBgwY&~"'Mt?9/?<4jWR˾]I߯(-W  [d_Ź"}rIW??xM5}k>O2;礐Yޕʱ\XͬS9s3RLc97S7XY9s3˹sTܕcX>r,5}L*Rʱ̅r,6sS|dyoK~Z 6` ؟u7`}{;`?  Z_~(`]{ {cKꀽ ;5呂wYT;G<0d~6/k^?+D-폿{~<+'k%,ϛG:%qЭ4,<e~VTFQ_veP4iѕD4/Q^[kZyeF'ϔϖkd]>aY\/{=K^YR䝯5=zggޓ͛5u 9kf/i{^,A"H礢2ZH'ZssI\Mg{JOArI"{l>+{&e3Ys%D7{II*]O/,05O|k2ҋ͙&ܿܿF/6=rS5rf3#0Һ^~Nf~#=G?7z9=Ƌ/=>1}:_TbQϨGKke({VJ`|W\D:#uyk?̾"ξ)v s_|k6sZM?Gz}/xoI{);vzt.^D&,z-rK,sKPD. .G%[>G̡{ĕd^pwd Ļd6-K d^vw[Plw;WPɼv;;Pu׈Q *|۹4S *Aq*n8:x &q8*Qn &*7DtT2s$ ׊'6ipѭVT2:t#q3*5]K\JfC[Pu*b*EQvM!b-*n!؄Jf$.Dc{͞Ou?z]@`*2Aq4\΃rf;Lv7,3̈́wA.}&t靉̀03h:[K\3qi34ܤDW-Lg*=^g;q) f~ uzY?sUA*|l4Md'w8o,4_;Fqɑ[8H<ST#qxk^сӞgqaP!d2's)>|2O'Y$dTM+ ;g2eR!G '慚uE+nWj82$?lp&SQhPUQQQc/AqNd`t&PDT5%* :t&t6t6QajмPMj`fb4=,yj樸s4sQQUՠOAgJT.&Q0BQӔ K|St-ML慺jf&ByE.2F]l{Du)Q eeD.$&PDF˪P 9J|>a /PЕߠUߡ@5PZ:!t=tt#j 5nBX[jnnn@mvmP{N uq:C]P7;t zC}֡{~Ph 4BE?P14 == = C#ǡ( Ih44z C$h24 MC@B3,9h6<4 ̓^C "h1Z  -^^^^Co@+GނކށVBB{Їh-Zm>>>6BBAЗ+h+5 - vBЏh/  f=]]_1qAt=/w@,Yro싖:ทfLOUpo[Z]iRM5Q2vSGÉ|, ҇$9B*q|}dhm¯x~8(sߝؙiosw4W0^NoD͏D5'$:ՐX:Ё]1W7JF; KTPt}@bp%4OU_Fu̒Z|3HqJw9̓Im`5EkͭSvH eci 8bW;Wei+M^ޜW]7.v67O,Dh{#kW^֢hlFOD41TM(ٝfjDD33J5$y^1(ukP-(7C["ZQyǘD2j.&6PeTkrd3Tt#w9B̭>BDn֘HD[(+:]d"R]3Cw+sPDn>mS;R1Q &7Bqy '^TĎfU(",zy(3*ʌ7ոZ8^mhu2|O,u67鍲PDt5'N+?ąOi'C L;R^05{B`9bu|ԨY2PU,ԘKaD*WKvL4cHnBqo*c >sd*rCԋg6ѽ5*C9ps(_5k@^'`uްN,=h>n.2PD 4PhL$bPF7GEf.Fp%PdzsPYQ*" SZL?UcX>z5ܶč1" y2LqphPA$dBha5O:bxynԪSۆ3*w(OumCs AcLמs DT%fx3/kzc/u++mPq/hD͏m{cB}毞,yl- 37B fQ~0HYSƘ8meE$/V*Zhi^i1hŻ~jUWeWkľd¹Ypc bvTT^K%:yԋ{=Ըj\.Wd7 2VDHP7:=v '"2LufodoQ↩*Mf&k6Q"bvy}lRƪPDo> >HDYkfU("֤l92u;Y1BVبwƺUx`6V"#s[E}ʇO&PDlL%2Y٧T("m>YVaXh̦ xMl6U"ss,0ԋ"e_MTؒJd7̑PDlͫPde#Yh}m6]Tk7fSU("5^ԶTLը&~g6Q"b{*Zv#SisZGvMu*T}ng`;e7?MTؓJdf7T("'̦yMl E~sEj_&PDH%2:4GBu~&Ocm t O5 xf xEs_ M DTB@QBS & HP((6@,{AEQE%Qow{w{wP44J V‡uiw̍ ]/)FI3m/O9 b~.&M&F $u)p `cU CK|sn仿7uujokXkS.M:|j- 9kJ]7ct.($ù;܍sD;խC.ܺ.$o^n]3CaaJnZ _%5hv3H,9yx)Qא-T5ds5;APz[Tg[B$P6l:[_I)9UT+QZ_:4$P='鲧2{0M;G갧*{Ng/:u'{`TY)1܀֝DT,6BP3H6@ڮ (70hF:plS=@Q0=ՑSU<8@QZa5Vlkp;3XF(K 9eBc9)4n|m*ZW;Cv9h*EciA9:'O[J5i (7J:{BWR#HN7^=T^_тnUgvcC؎Db]]JjH]H'JhΞN(#tdtʈIe Ϙ+P^յ领ϓYR;d|d}I<Kq zɯw[1)L~@_#i*xO@8ʼ몷goZΊ( y QoK-o9+nO 0`w5@ޞm: 2枇g{':R] @σ``< `+gDy@t=54 8w%rFcp,x?y<_W x!N?v=:`f0d8`><+NE`NxB|`1g|t; LCVX1ZOȧkX| /G~\p!.B p1^dKQ^r*W\05r +x8Jp0&gm[ 9Wp @ȷp-/ Έ݁N+ `#"wpn#p${x8|8<|yx>p^q87$IqN(N`6(7-NSnXyKp:W_8 g|o|]8|w\p? p ^cKx%rW j`)[ _W5o}7o}x ☾rp}i@{rݞ]_S9u5r#8[H6CT&D7NFX09`#Uc3R4MmYh*4 MF?Yz)cOؠV5uxUtoؼY|.,4N-^'i=p*JCO5lNrs愈I,kuX-݅t3ẍ,*Xv:RnPawaY@Up3{r }r n NGK=a.a'j`Θ5[7>{)A{"O{6aT?l [nư)tF&O썧 Uugec :ipxk3Sk#zwty{p}v!\õ+W^)Sj72.+GzpMU^Y4r\!\:%S ;~RVVF~M!7 uY|[rѱФM 1+K.x}Tcg㩹#@HzVY$&I3ܴ1 '<4g3g EԳDu"HسOoړ, 撌[>,v~#,g#̽FhSp Mʣ1re| yP'e@i"n8FVH1DH5÷\ GҞ)r)CLSfx}P}[z3U%]][QFPe?,8f1!% m{WsE}Dj3 1/ >4(xA} mol~sp9S 93Z/-88MHPF/~IwS_yǽPDzY {wGvBjutN`cFճ*)Ljwɧ$n`6^f] ^t:LJgv:xy+rï)>m{j U ðt<#>h"b%-N JKsȤ՟9kQN^/ۙ>Ju4; J:(8]>޹:#7}zƍAr֬Zf#7}||Rem@\ĴvԗxC+y  ZKp͐mg§p G$LtAG0khphB%VG3ƒLjX "F8#Gff?Ҝ.ffƸ/m5|?Fs]22ܹ]]Ǫ'SNz+ O(8(T&UdwKkbU+`c \=΢Pǻ(T_ xUzBE\B=Ol?:"|u_KWT'CDw{OPD23&ZZȥ0~Dk"Z Ԛ[]@t[ْi}V/g++.1Dolg#ýc9AOlD5`H#7̅9m)E <^^K!x.XklkXp"iuƱ:STa^s9R52Pc3gKW%꽲 ];'"y2AGR$O&"R/fu8 JtQkc&LU8IPR"u!Kl?«p5`|% sljo*M~D4# Ѓ$6OG TC Op&x/`wzM #65kg. _n -Wy`AxXųMΌ Gz _( 5iQu !](|!aǝ8{UEP K7`&ʀtl::龠tcZy=f2ӡb>zw:g) ~Qt:w4\2se=Td|NKc2|g_cb98Ngl*X,[W?8nsQopɃQKh>O:[Zg䵗.(12]ڤQ:Q)T3l-Uf^tdW㭢gDתMzS]ZO04:5qcae:o|=&KNO':Ǹ dQK8'Sf烶qMnsoo1<]qt@n1y)UB8'Uj|1nӵ:F'|oۭ/^x> S{T\*҅ KDуO>wG/1?"p"bs(wOkiO#.6Ђ2r1ʹ9Rah)drLho*c" \SiiKUVNioE*NWq6\a<|m(a#0nV5i!skC*" U"i؋N{Ĕ7%q=5wYy-R$Ǝ-e jgzm[k9Jglt7塄m*p՝*gtSIsbd{~qQ[Xcu2>GzIyoG-\ϡ= :KLS-a'̨PGaѪ8|hjvGѳ |#˂uo\)jw1;NYE[5{ܧGFܹ7f;^1}2Ye>j`dTsCFc#l2𰟐FedO9VHHdOkt]D.Im崺:JsAuI # l(SR lJH߬#k˝y:eDu7wFRi=zb=cJX[Iȹ5%2rmʋ 6O|8q":;4ZŽ=4q|p:/) zk@p|>N>3`\e˒s#+&n{\[V&0i[V f~9_Μbkʧ)g`/2x8ҍQY>k!vD/D|O>9{T| Gx~̗D&-K-e9Z96۠:֧Ǜ<9G9RյSZdcjq;׏Fj\dFkwѵz58us0B [mʤW 6zo\%: R[r+oќ!tmPXH7%z7ѵ6ϖK""/ b~FTb^N`b="RO^^ ֽ~|Eoy,XJ?E'/hWޣB;T1Gy%Eau㚎?oQD}&u)tA^I]ѪS"[wIj.ZHs~U]rCg-2jkrnE7bhF'>XM_uƔY3]c3tj}3Ld&M}o{V>&ZW99wݪXZAH\,z!﵆s=!&}=%q1*~A;__??kZd 껀3j&љΒpiGYz4Mst#"j6Ko|qCnxi5!_?fROD}2b~?(s0V ޸cf^JH3=dCs;@< `bH%7ZSH I6^ _mzU rxOaa?HG1jA+oe昮#z23_E԰FnXuϜw;iu?hsPvs}}+6FNT5۞T JߪJ? OXR 9>ˁ6wɉm@xm]BȔB*%&sN ~Q '\*3?>?2`m&ڟV)zx6ǑS!4! AQ'qz"Kid] _ߏz_V GzƇE"{ׯdУp \ˣ7H;< tzѵΦ3H$NyN. *eK]b+שej] uYXӺ, X R\[Oz0߆> O ;NAank<|7XoK7AGYO YpFB8a'|a9sBBӨ)M,T5cyzJcSoSo3ni3]?`j#aShƢА ?ɇSʞNv5 s,P?Άt4{}4ʟ F8f8 }%@eS_̈%>_Ym;[!g`W|-?f楡V$9mwnb_z ^tx =[ҕM8ʬ**=(GLGGx<*k_ï)>= gg q43xfyv^:sj ()D$(@.}t4_4'~Xi5a$]86!{7qR?Q U@J4G$J\k[PwOP@{FI3֡J7mAh1K|R[ oNwIDӔwq=xJ n&0p~[ǹgPUІ. S 8&v ؕZ%X)5ܒ;t;dak )85` ڥPNx@]]߯sbZiJK,ʿڳ5p^_C)<1 o4.77'É77NȞ8J'ߖċxkBF yHD2w_̨-#bϨ/~0DV`=#3<1&Ȧ>ڻʈZTb 13-ގx/4~vGA"x_[٦ʷZ9JSn]Q極] H~V8Y&dHg!$#+ڵCU=~12oxXKQV¥j` ˿E;-Ⱥ"JkV;wOa.řvkS X#^^8kbvTaKǝ1G>a#@Lo,?b /-}#I Bi@L;l}Xϔ[M2s@%#ZK9}XϔżIjCvdD5Ai@B7䛞_Y0J~W)im-ޫ-⭹ٖa0X# WC\ :vfnAfû͞~g*-\rHx}P"tu:ݎ$c3nF1|9IlS껍Uc՚z e1$[mҵp2”B* ( Jv&u3Roo|gPZa#5Y>P<л I#y:zcߢrm>h&mRpISn%|jgWVte䘢1-0w|:WjMʸ[\q\⊸>޵<1xYyeLXs\~L7E/O E^Dyz3~w̮k9:L.O9.0tahYVš-o7H똓RG6`V*HŠ~qq`UK %T!>ywbmJlzV65u5`|֗T5U5p]{ (%59Bp:^CU׀:hKbNu߮;\x6y:Pk+*dߩK:1fN;D \Ht? !gG@ßH .DD`=d9bw*P^ &m``cho/so^qiH}K4xbg2Wš4\BuFÐݘ) 59Dǝg>9ᄽ C^ٟOYidgVB];j{|{oKoԨg"-5=9 ol7_ Ϣg,K`QvlUgUkg_l}֪6YNjg̎![uWL& uxvb坜jXϹh,z"u(gĩ}Gl$MZty 1>f <^lVT~A]I/ИQD%t?(g_z(O~(jGc_ƽ\m_㈕+o5j%zEcaŭ]^QX/i,}7jW3% Nuc|6SoV<-8o _ܺJuT% ?Q{ U'Ϗ@e}e뿩3]swsUGm&wu%K1~]맯W'KU AUM?⫪#d5ڏpۿ~@doڃ DOѢ;UJ}Gr2:xMҪ?:+b.0֟T7T~o 7dy&LZ?u\xym,SwM͘#`n,ԏ|i,?l2>aItzgjwv !H4t L,l\<|B"bR2r JHdd5d d-dd=d$     9999 99 999ANB! !g g! ! ! !W W! !7 7! !w {Gǐ'gWא7wDG'gHDv m t @̂2YF6.$+j J52d T7 n38.+3f7R"Data generated by Autodesk Revit! CzFEl-Qqt  UYe iE_ӬLψˈ# 2*(,  *6l: ., " =H]^[2#{*VVVUf2]3ŕLi9%3~Z2Շ.> YW^!;Rf2+ЅlsKU1h}j%B.Dt<5 sTh?%t:CGoзw18=t:  ~NCBAgPi RTU*A*PUTUj@5ZPmtŞ.N31@c݊;bc~*\<{al!y*8,YmZ9\'yK\ s9:ʽNdaf>$Q#tW?-CCn+*unag7Cض]Eb9l55:Q1/A 2 fw! 6 5#;c 9nfTȖ!lc@bpFm&֩ZkPY\FuN`s[;bd@Qn!uis!GLDys yUF"vTf8<92wSV9jEٌR xȌR5 "6TWw"Q](ؓnPD8Au78maFqcӌjIDpv 0 axxN@oG:((@1b q̩Eb31MQDVeIx)"}z9tgb 1}P"LHD&D恜LzzQ&^2B102rOY62n+3qj^ۈl2<[{\\7gE"b9q ֘HмɆ>7r82> l`Z8o*//(5&1)F}o" my]n 1"Ї#5*Ѡ>Š~}bP}؇Sz v՘Zuxi) Wgj֢\uMdif4 fzdIz&obDo[VS^-Z: d8|v.Lk2} M\s??#%qhNU*WYX5f'ԫu5!n$ܼLǓ grՈʄ3* 0=&ʶ rjՙ 7:yՙZuJ4SwۼO:;Swۼ Lxzרs=YKWJ.]/P|eSA;%:gl!.2ōU("H1!MDXio#G#ޱw-LPZo![iS-[-52u/4fr fBYiƄ_[R2n+_kV/*wCթ(_nxM|l EĚT"oQgL"bm^n|o|nqD^ Diuuq}6#?$PWɈm"{ky_w&/mԜM0"n`6'kueaږSx0ED5YUѶDIp;ۻj. ,~9[ّf 4>-D|٥7R1R8cR/TSvq.N>>j'fC;CU8b>Kt5z@1-D1Lsfod'(QT/&^^w^MTo22]j?~i6kWfcU("/CS1QV#xl EġT"6GBq$~'+Fjǵb^cUzQߥb5DD&x# EP'*,)M#0^SOMUNzQ?b5g*RLF92ӉL%}NV6U~_(sMuUT3>w:0ԋ:WXj6Q"卌"SZ_>'JaU}lPԊfSU("*%BE ^TTL޼&V1BQ5d:od̑PD'fS0BQCZ(&zMm6Q"N*ց$"sd*T`7 03n+cm t V5 xf =|E@CISG ME5C1 bԠ!v5Sn/ flWU/-]=#^ T1C:թ/!2)Bf[Q_VR 0?k`1 ;dnꪤ&Rne.G.A\'F&O?l=peH_Y˹@:[ C@54q* z;=qE/Z(E\}dӊqSۘFSl81%⍩u J"9w~Z8:" 1GQ=u U<q"Gv)$cK{ml9F>QT(6?{nnnf7w{{335 KvTC܀xԘܵOdOnHz12#HBBd>Dxa_D#ֆ 'AƓR2dlRBƐp4xΓSL%C elADVL1>S*ǘL3ROA:۹o):x׭u5r>E|sRG 5OZ!D5#שNY0-ߘS_U뫓Q_K}IM8A=]tU=ٗ갧*{s7_r|D}hCl . ٭W ܥSelRt )!>o[zXN-nZ^Z˘rGө|D3~OOUӹ;8wb ùE.x;wC7խCܺ'>XnfxC'hȠJ:â!{xA4#i2ˉ졪!jv8iY[S=jnG@xkju꫗n}V/LTu꫷j}!6N/4 S랢Þt]Qfܕ2[=}Tٓ/h1>cz%qz`T]-1܀pN$* H1( $ah:C 40<󯀾y)uk8 &?܂r Df h(@%- 8_, ~ wKX p'Xp"NXp2N + p*^ w*^ /p7x=Z7"J`Mc 0-X0m`}6x]`Lx/p0}m|Ā !@V'%k4Usn sG7$q*0(&SMKl:LHUC!Te;Fx>Mf,l&QìP;'lXyɝ_C:`*F7lYk!b æ4G=ΥhtOv"J;OWz:=g3%HLbY+d"hmGDo4ځnjbn$/Zγ>³.W{?G L-T 6|.fo<ݖ[=c|C&/˂nIgOא@șva,'sFy\_ Sϲeugc<&ԋ3b[1Ž 71Nc*bw#jilNhq$Rb KST ~W9SpP%Yo˟٠FSFq"|c]Ǹp@q5>%p} f\ϫ[XY=Ա՝j_VY%*k)\,\;drek3\[pz)v~w_~!yPo0Ѓŷ2 epBaǻLl>3w CH*ja;MYp?TМ̀eP}Q qbO"}}ӚW(f?x6d4᷃fr32e-/1WUy+@ȫgz>w,-Jq1by"HW *r1fK{ȧXMgC0қJ, 3:"(;}/EPf 1ԍRЪG-Wd\AMf 7bO3 ^zthɸx}L/Hlt^Ы4"SBP8lHn:ǽc٬e6EYW]=R.n=ψO7ZXI/HD`]KsFxÜtaNy,Zۙ>Ju4;J:(8s:#7jzƍ~g 9͙sE /Gn2||_#7=|:34{V[`)gFAb ϣC<ޏ!`㰆.w?j{c\A/Z1M8law$>Ƒ16 d8p^wEstgqg9=SӇI.^,qԥ}62A q ,;&V}8sN6.p6A~_L2WG>EId3Bn3 r͹ȫS\G;µ.\kZ7}5r}^h5͍8ĄT᪖g_^ղGes_o!eklze ^l>ozمe_W6.MY|FcU>߯l\JTvj$ǩ=R(7 *.IY_o"R'Ż"IM~#q=P+_^n g§p G<׹G:* x]C{-L ݀X:|QG$K6a)M㌨bn$[nft133`棋ԛզqtU;ȌcwDudw|WI‚! ڕߤ&V~@nf )V`]]+F'B߰'Y6ru:EUNS(IoTWWPQG%W<҅ǧJUOx._Q_NvknqG~egB2"kiZRk%6]ʅZpqNa}lɴ>ޮWҍ`ǕK77{*+:1Ė:\  sgpxsK-+~) |~mM .SXw2M8vX|n3E 1 G*^͜7w:yDWvĝ3L͡<^CsOdGDs)*q?XT.*5TUU3(uӒ2ԝsm߾5`|% sljnx:ܟ4qC`KIQ@p8߅7 ­7, H]0P(30|5^ gj w̦CRMGgоZaL+At^b8in2XϦ-9l!ſcAVяp}3NNO&[zGBcaIxT&okvLL$ q~Mey1҈Z>JtoYzma]"3/:<}ǿ{h3"k&r&/qO}ȸ12g%c(e8مEEkkjcw~vth/%~4=OW9>z?~^cm`b*5@tN+g'"vkOx5?'= aBoөƀKߐ̅eX[c4 OViH DKTy.<㦤":~>7Eqכ{^ޡQLW?Ymb]:ըTܹ< "W=]3X#3iB̾lto<>j++u^_F)Z)/yuyGIgbi)c dRuz_ʣ(,ZZh7Qȱ`1WqʆjڝGNY a Ƃ| QQ4w ﶤ{TGLmyؽ8ܺ:?GP>Q`o {.*<-QٓoS//$Ord\+Jo[4}so q^[҆XH?UgLfJ(skhbIHM42:^q9 u{Q۩8f7NQZ+oi +cQ6R"kG&~3pr'_ &]rrơ mViQ_1Q(-Nz@ @3s@Ų~7._ڣv1"=Nz*Loy9tWS1&ӭz(T䑑 x[zl!y0,m~mK}sVK̓߭-oi^<;Zۺ"RlkzPvAT>\7;%SLz}}Yћv@~(#EO_NR[1a:w[c剬jL~tV`k>v08)z9PuU}GoL:Xw/Ơ0Wo>L?UyFpB1b@WV2~1vv2ܜ6ؠ"#ePutʛWP:Z}N;b1WBeS>خJmVtznֶU@ O~ s`* /o*UwYdO{!u{QX+.Pf՘|6\RjoYh{W뛆8Cػ4Lm"^_a]9w=Ƭ8?}y]ۅ>Vj+txzۧOE_mpl wMsx[Ͼ2Sݵj9৫eRs֛5dS6kIm{TnawT!%>*'Ց&U. %l߳~LNI3("%~-w] JbIտz*McYNn'!(ʯCsȵ*/22z>ĉPE{mDrCu^ Sր }D}fmF/_%FNTl IM`(z+Lnsr9E:OS_d~@5p~eN}B _j剌:|7sV0wݩ"x/GLZD *u[rrFmAuO7չ!-yrjskVqGowȹϛɌRkkpZ05lͶ)n\2轱srENC0HV%l:ʭiDr~?F3e۠nK8Ón"kl-~>%D6ߣ_(V=S͍qϥ=zEl@{EWެ3y,XJ?E'/"hWޣB;{0Gjy%Eau㚎?oQʈ}d_{hBՃÁQu.hU2 xԤ~p`0-9UOs j}3dbα^QckXޟJ'-5Pƻd$GAaz~:Fϑs&GYs"r'N㣶JU*9lRdc=VN ڄ#۽?W+8Vd#,d} ܤPiL5?sх?V>C7;#"YC&R_ԗWoU*muuȡ }Xe+Ų^k,=wb"Ox׳\ghwjY 5s#߽%O௾ H>S&y,v?G#o-4G6 Ҭf7J}ϏQcv.um!7,"{%)+s2g jڮ3:`<\cGN.*E/os9Һ|@,6HpO}ٓ,dB6gd߮Jm~dφ_0zsW lh|xeޅWU3lFp)S(RW@oCnӋu.mIdQMuy?A-uyK]b˗坪uyPĚ]k{u}n=b@o'^;NAank<|w7˾[WQ5a 8"t.#Cuc}v9SBӨ ֯M"ؠ5#ww׶^+}A9|1oߡ ׈ߦ(4VЎWGcﱡ 퉏'ߤPG쉓{"=)Q11ޚQ88b=O@HշeD50eF\ lhdW`CbÜ'T}ZB\^{[\ Ry!sw(P$y#3˃x+TQֻ\k> z Ù-A%>ɦXpa'Pq-htw0:m{5~Psnk^' $ۦ;\*d HMh?iG}_ >pv-utb5׾-S[(mCNgw(#*~yj0߻wV"_c~w@[X }߯Gi?E[i!Sh,K샺C*bmt;~AO@p75JK$OwcUm/( ncGI1껍HW}ϟѕfPa@!m8ؗ A$E=={BPzb >=cgI})x]D u2hV-Wާb96Јr46)v)b|x׬scRgǴHV޽G磋׆"n˱Ş1-u..V1@94VWt^yB䒚#|Z,TvJ[h{mu2+"r8WM>"N/"~^u2~/F|_=&J(gif*c2]h,e uEؽ]pd?e(N~rXH.~26V 8joQk 9sd)7<@!i]Lb%Y9H"=\U3GRypru (|`PBBз$SGq qՃ R1E\hXRB[{ 5yO]lXy]RIװʿz ]z _ܢf^j^ѵ׀rvǩ֨m5Q^`U<E篺;9G篪u BC;eٯ钽օl3^Jk~62y*_dg?Ǘ$@!7:L逺Ր9!-؝ ? ; eW>/x8 us˃I`O*n ad38<ڸO̬N_8x$ttVpw'x\\~_:tSGhwQޝx\fÃv(OŎj2<:= <O 殽<,77ةu_jګ #s X<2lZ%Tf<~:6=y[Lw_&8&4' .74d\,x^{Tu?_1wk~=fJn_>}ȸG~".d٬pLvbJmj|^ojv2~O-5Ziczմd\>2p4TSCtp4 ~QHRp3ˣmSlۇeJΎDړ4t P 7ؔXV=[N™s^ >qm&FQeaǘL3RѱӜr6PwJCq@9=O@uo>UB$PkdH>V/L!-aN}}Z_I?ZmÞOtٳQ=򸎛aFU|/h=s`'1Y?Fz`T]-1|m&j!2JR;Y-PoE0=Փy?dYTgC*vl:ɿ*>HgA)v9jd|*Qغdlmd#ͺr?+'H'myI* ȇFSf>ş-2Ə> ȟ5mӯxnnnYaicrNkg?Zjҥv0贿>RJW;_@7r55:cޭ&RΘ+6#⮘LŽxmBasʫH)#KEcmwXmkKAcI'$Qn%h>:~+fQ-NP׺<ƅ_rc!b<ʯQGQlZւ; e?=$LޥTԁ=‚wQGLP%TW+A\;=eHrSU~JWu#PY7I:.uy 1݆<^u#6%& .]{U'*D$x;)#y?AE^Mb#1܏9?x[Ps k=ZBd-K{ӥԷ!UQ_'PW'%5W\4 ,梑FGS7TEC?sֿ4V'3ArR}܅lO}*ه gI m V5t g [AP1y|?@0QBnA;QPq9`,<.{ߙw)iYQQ/)  xCj@jBjAjC@BAC@BA| Ɛ&fV֐6?H;H{HHGH'Hg? +;'$22222     LC&BB 4YRb {DKӚlwܿr;R ' yoNOLB!a)pT4t L,lH$2222 YYY YY dn>MvujǪ:z7GouJ-ۯhQ93/kZ%ӚLr<}wxS~'x0!9u-Q̭JDƕ,c wqQ\W33ldh_tE)F"RSNe{QaT!REU>s.񋦆TܵH>ڑꌛ_C#au.,jm0^QYe!ɵC09|gOX.'C0 deWO%3j,5܏kZȨ迬0e|8ČF❍Z:zF&fV6H,d;dd'dd7dd/dd? 0$9 I$BN@NBNANC@B ! ! !W W! !7 7! !w w! ! ! !O O! !/ /! !o o! ! !ɐOϐ/W7wOH*7$ Ջ bX * b v;$$?RRRR"w:m t @D>հVp+8F<-avQG<( f `PZ:o,J Oql?"Data generated by Autodesk Revit! $FE]N5FIt %{e ϝEsɘ+54I(IDHQs  4WiE)rg}uʽw]k߻V2H$v)[IN[g&8WW- Ձs<}3}6[",}_$蟟ZxLdVPy"L5=m' @qp7VK*O5P[SK*/ml[O巖E @PTȠqe8}B>jkAM5B~P)? :jnEKmKmMmu0n:  u5hX8xtt"tt2t t*t΀zAgBgAgC@҅΃@},AM#2jt4 ]] ] ..Bàˡ+h$t%t4  ] BCk MDht34    MA@ӡL!aQ1qh$4 ,<4zͅ^^^^AACo@oB󡷠wwBhZ->>>>A@C?@?B?A?C@+_*7wh5Z 6@A6BC@(Q ʇ BU@;@U$T UC5]]ݠݡ==пZPmTՅJz>оP}j5@MfPsj@BmvP{A5w Q[ʛ^V+[HoO M~G8 ybvIA 5Z[oQ6Mf>tV{c޵`2Ic{́[9*4(KPҼ ;QMQFǂj,A'fQ%; 2ΣM)*4zG]Ũ\&jYScȣ~L0-=D>cvx9Fd"̀o.Bb`^`g"!=!/ zva,#,1np,=3/ .#ha|8#I^KhYhx:ʪCԕB"ĥb XK҂AEaxƋ삞]L"bT9/^2D W^ uE(BLL=ny7R2&26w9y)'-'m#R_?{5id"(un62XKq%b5x x'ƍ \L-(nƍ! 5>pUGDԥF^PAݐ]+ "!nL b=ZBqw|sp#̄֟g&HٛDa(CoZ5jTDqߧ8X5I]mdd"/BbOn$F[z)diR8E]lwo"nUs؈P]]lnwx[L-uYE ޙ^.}[S^%j,%-N*_'~,2XPHP\d"}l##aWWeSU^I 1MDz ep$A|@hHpcMT܃ U~Ǽ4CRLfFmLI<"PJ=6c`M+uEtkǑ0zL*1W^͒xʫz&? IWOJzJUzZQyU7^=YWϩ*1y߁Wϫz^ *BЫjfKzQUmz5''ΰ0٫9a6= m}1XM"IIZbK0 ;?[ Cu HP8xgKԞPXgZгOԞPT>jg#i <Ҿ=<'fyPK<[$њoD/^m1{/%^}|%||-,ScI0ߨ1H0Թ_H_­o-!ԷbϪczijrx11bs%jr 4;YfgFRs?H0ފ0-CyЕIO^׵w+LYGP%'o h" 6 Ex=[L"m+[Ju.Uw+DVT"u}MDB! g@Y^SALZ O5O fN]8Ax#NhS@)+l~{gҷ _cّ=1:Ù(7bgt{^ba\#gi'F}f5sGO~o7onLߖiO~_ȔڼQRf׻I }Iv46nM95i|lZ_<+mչۢ/o߲ԹúׯNGlչJ":{:[`:@Dzm[͜vOpvu(V bkx ë2[ñ+g8xKʹ^PJ^i^>b+ 0p[JΆ't>d8QdKISGHLTU7UM;9B*z鸲w4ycORvꕏ>sfѷ|"芧RalI#dEc2*c4&d/8G],;6e*YQRMqދL6d-/)EV.WZg]_I1Υ%yP-<<|<*^m3$$}`T=KSMDgƇ3SZݔa ۆphhG0 Ӯ{jtF.^sE R\ X_`3qqގjMxyg$2k˄6և_)dV\r밙wgG; BԈAҾmS7+A yM_\i.PcZH0-_ekAY`exQCek8B|d9WީX{XN o]}jzd"́9|Ik+֖6LhK gc ![:JpcN$QԹ$8$ &,m\YIX*sNtS^%/10wR]m t Gf `v/ .I@B G D:!$*M@Џ`A~ AES+  (b{SvgwngHb&}33͛7ewhm_u}sm!h %g_ڈAc ~ iabQ8CY`?b0}mHv7ĄI ~iZejt-[4u2 5~ Os- ɏ^Fo>k8Ze8pp=-d>Sc `-!?H8ҋc̜/`hi &!I1w(3[MP.ß8ě%i^PyhƦkwp=նb|zІGʂQ갉&ĥS۪;HC]85f")sk.1;Z7-h8NJ.*dP ŒuM_Ǚ^¯߳âp~\n26t-?5;1 5tFC$.hXo T-eW19R^HRR ,f`;cGg26 jXXx&t!pm,PLWo0K>c푕 )a+oJm΋WC_Iq&^'֘z*FL5kR V=$S*{~y IOe[/`jr1Jsm%$]yZ1 *H^NңmҍiX6ݏ 9]izbL-:v*CMo"rNW̡TWphDgqRe1j?{@}CUit(CG c4Py4\_Jj|i њJB ԚgNk]bEkCr[%Щ$X|@|2p:8 mc:RWJZjt7`G8GQX 8Ψ ;LX`/q{` iׁv{5) 0`*W! }zNUp @(?|8~ cO* Qp8".8 .8rSn8 pm|tq83n)Wp@l/\/  "||\=< p!cb.p)eWWuWa;p=7`;lW`%kVEoBx3'[P? 0:0[\{]=Ex 7^܄z~#(Q?nA` >0s>p6m|\q>p'^p;B=NK> p)gP/>z pP>Qzp@Qze +H7~ P/z5 A|Ox[?G(/\<vGx ?E| @O`: swx k;~~?<Go O| ^ƈhMC_e'@+ w/_g@y41< z c{p0$,pH`Y,p3@ѷ,q1=v<gVXmhU J#::#k>}9>$S.}IXڗҾ$> bi0 bipI,ҾX74}CB,>Y,.}BX'}BXo}hSD[~ֱV6VX[cnu1VX[cn]KuK,-o,խG,կ[Ni0 0` F1|،Ai=C@ '3Gx*gPQPQPP'EbaчC[MZ#y1oVo@ZLȃ˛Tj,3DY XVnVnVnVnѲN]6.0(x~ԏ\w:/e 1S=`HZ"@1]wҷeF-ks1dFO‡w݉a^ʊxvusEre#Z/Oʠ L_<ō U2;saƋlǁ:?FbY>ʸ,)؟xLb1=*$L /'yT~Iz#M~\QY w3}40#qy(ĞL+; % 3$SRCX_ރ~#ߧ;bT^ucWofF^~&oy'$)Ny w~Gw ~Db~"[SNi[l!/}P!f6^eӕ_ W!A& tr=#vbW-v.:EnJ>%{*fN$B5Dke*oKck9d<#cC鰺td2C鈽tC+%`6g1 - x~GZU1Z  6!OS4y0OA XtOCq2Zrߍ-M!k jkZ-7O':cΉOeXOF3GdP2iICgcLwq-;qw8߸w}o;q7F7>Q+IY#1˒c9r&CX+HMЏG>xFC4berBUɱ9^Dɱ9#Y9&:8Z3FX!&~ POG~nH8-;+@n V9S3*^L8rOcCӈ_BRrlBRySrތ_FΛؒ VL$ZP xpD#`%_*,*,_ pHi*JN K$#A`*-*..*//*00jjjjwvO!8D"zVl?cTOuwYrk/.ʓrkI1b—VzS827),m6~g~m&<ޠ )tz ~zy$'ٳ> |xR,QxOP׾<Ź+Q ;`?{FTlEؚ81mdnCڒc;rlg]܁$u$NY|Z|9IB^rg>#fFcrgFdN!Iȱ793O1fKcrgFSo*y ID1U.|IBCq; #$p4G(=s1ht%9!DZzH1U$_8뙣1c=,SfXxaXPe M, TP'0$|U*94KdbL|a\M'b8QˉY&j;aTǀQ a9UXG S*cyp13cB,\7"a7zx\B<)\_ŗ#Y|⣄,_ŗY|_ŗc4@_Aϒ+jY>c<7xn3+ V⹥"_ Y|5!H熤B !7B,1{} qvs!cs¹^rBT.?@gP_Lbyb~M~Gx_?IzW?s~9V|_R=(V|W\ߟzg7sǷx5ON}b:/[{×zex4޷U4f7=/Qe^ᚧ;}LGͧ|Zįyob:|6 e|&Iת)v99jr[ '%O+\|Ӆk<=?Orӯ`d$},ALrv]{kt<=$s!=N`H)v~Ӌu> 9 /1?O5O9}~As9JҹzJi.>B?ݽ7u ?k_LIs9` :PؠCg6'ٔM lҗ,I⛱|bz{߂Aq\|FGg?SՅƯ/>+fcВ;h)כXDWt~5E/f}tX|}O% Wmn I s4}h{7ڶggҝ><1Lg]ᬃ㚋?ZmzoqZb(I.1I#r9L ;?sB~1]'.1]Bˡh/b:vR_Q.w{gޑbt]bz3yz.ELo]Uբyu}tX} <1L]ʡӟ7ꦣX?Ig\ےYLܽ#rhG]ᨃ2ʥiO,OOWrr9%ݙ]rᅶKeHPȳ?m}"AL I ȁy)s+kJ_+\|u/$6ݔ3N7fVEyI}Nݠ]{kt<= $\;}Z|uwt%>to1~Opӝ>IyzrנtCSEj=׷ xw+%񇝒#hӲI' >74wfM՛m8ݴYrs~x$=ggZKI-6)=~ZcFq9JMF us%i᰿n|FF nZwS MZRj VE7u;Սڗ0;]P7o@&]s%ֺ 6}a"sX~+>;BUޡ\Rp'5j=lq/3ϰ»|Y5Mj7Ykoxr{kD.{iq_M=+1\KaM%^yOx4Ivy}@,wJ+hCOY"OK1 Rr$snKws +ػ5z^'מ/󒯶w+:.+/խ/ߪB{)U,mN7{ݜtQOMPNz'GgY+ClQUhX ~itw ώZs.ljd vn:^7Mpom )2?o8m8Y-4&DLcI؀R%c \K 4I Ib yC<1L#1tqʘK0ӼcŦ[fuSܠ{Li/)MR7TMi)E=)N[y-Jx ]ER*Naٯ׆ϻ@R WR:^a /Y5yH]h`1>Ő5*ANo?}(~YsJ06U|%wFެni?r#r )F^k0gdWpUy o1 #>7Ms4B '9R]߅O>jm9䶺P~c8Zލtff̙.##muud4/ԧkhbe2h?7~|#|/fHg^QkjWV +*^hf,+7Ƃ^lF,蘀,Gg1˙\&enAǨZ+m-+ [^h:{Լ""F*0g6G'׿Tu4Mc~yEp+W;b? mv8~b7}L8vځ9ōvjx[CF;_/?#EÕ^ "Dُ'BqhO l# 8; ;,bV&A7mZAInJ' @֛!os]S[KΈڮk]5t1򭯷FB=/:yC1,V4n/OZjvBXTYiJMu.|Fw~;2'|\:}"GK%6Nd}=:d>lQgY'a;!9N曼?:@p7'H?IRs?TAIb;Oz:q6S0JEo:HJ#YقuMX2g*ʱƁ㎒h39ׇ4HhVރ~x tfnăwq۠39l6C{@)4:߁Un5,;k>7RK-\y$kd}Ž?Tk ':$Zl"s w<}Ӊ>Lse۠&}oi?[Rxe}O OXEpyP 5$9ƾ;&d=#OzfxƒMꞅ7I{ӵ~`y1XL6y1DKB-tYX>-۱ 4;k{/ʫĿH3E4'+2Ci?J}1^2yםvɨ酟}zOUGwrQNҺh{3 4a^xϽ&MLX|Ϭ݈1U^u ׂԲ O`ncm,]lc6߯ѱKǬ=c5(η {:zҍiPɘnWh|Yxe [ 8oq AEu{w{ȓ ;6U32ΊGY1BQ꼌Hڊ;GaFݼ? Ls DֺMzڻ"qzdkL321(JNaw2䟩*:ʣSA&*q??nW#'J K,p(W{tBy/X}:iaCd; i;zӪO*IAzԭ$uIS]9.z-jTh>g:Sŵߺ35l{\Y)5u/RJUFhƞW%e3M޺'6[#;l`.ښ\e#>cg6oap0"cYD|;)yeĹh- ~ʗtlKh-M#)ٚݪKpX=Z23 s\XYZ.Y_qgcI668jT] c"nE켖`lA< 7j7Ë#JsK n3n6jPXwP>EOGh(/0QO_<${3XcT '߾t NJng\8|{|ǐ<*\]}jVyj n?0 s/8ofGhf~6p*\_%](o=}'&yJ%;=S/BxWv}}yzd.zڠS49}Qˑ]m!ܯֺ5SDb~;Zktkw3穟y.~{3R>R6(+!AM Ȟ,u1䚩nؓʞL5p||Z n!7hh3O i7j6ea7U7DZkz戈hW|CL {_3[C+,FHء01pטjdXf8#[a{UOڭNdϕKS'{*sTmd-eկ{ֲm5dsig7',0w+7Hg»1 ք_/fq d<ׄqbXⴽr3AL\ %Oj1b,rAQ935 ߴ7W`jf_gYΞFQ~<>a#H|i7ZV^* smsny]*Ҙ-&yainس-{+s~|`,We2=Q8P("ӽ퇼t[g?}64Yd$ҋޫΓକ."dblSos7s3;V4f\c4`۵ƬT՘l55f]pg1F uW՗@:_X:h0U--Tc. C: 2I "_W}u3LRA2%LUaݠ*Ejh;|-N<3!z*UZp,FҹŪy@o ֊}a{<菧G^5MZd2kAdf9ࡓx:Z(MmnXtֺExs;7b$wh&2ަfq>n;IC mθ3%4noW59~Uq#R7v2w@WVݠw76 a |o9<.ҒCD9ի5"j1 ]yU iN 0K% ;tEz]d3 s<]npf(m$JM!!wC;Gο 1!t[н)h. ^4"LgZ{?;.e,)X,3Yt["vBK:CSt#dO6.#nX;R9+"' ?6Yn7e.#2jn7d7A:=NSMk1"%jq ~v2Z8T"~[u`qfC͡[[gq\n~2[BÓ4d'dટV]}nQok4_Ym"/Ip#(c@b1dlN@:":Z 2$ yqk4f91' vvdxKkO㰺Z%έ+˫=M+ǣ\Շ@dJ^>kiq-Gpmp5N6|ǀ<onئƉF 7P'\*wÉG818pfqXcpm3Wc՗!U%J7grÜ 8伦 pq5 qQ=WH#Oqd(P:(NGC!#\#OBαr:ȓjB#MqXv}w+pZ!@gs *OCgem]Oa +'Po]\g ;U0Un=V> DKY]sYUۓv(}1p/k(o{x.Ν]>gƽc+CDh3BgxEHSWp}\>A;|#,PH49/w?mJ=LY \2H#=mq$åa+ڷ7v%ɋ(cnfg:|.fy|DM~wn}d ^KfFYbd "ώ7yH:7dn&4F}nչatnٝ\ڣNmhT><Qs?ٴjusau*ܒloPc:/2\}捚, vn./"f}ўU q|j BcV(vA2EH%8)t^eܹi{ M#UV$7o 5eD՞ERK&i@JݳRHsq{_ZRTN;Ľx/. K}>ݾd;}543uIx~ZTyn:ٯ%lRu|B8Fc.H iȖ8px9t> C`' (M&h7ܕ՛[rѷ pK+צ6Y7CdĻ0zTߖ#I|>?:هݒlڬݭdJaٜ(]E>|d|t:%= eB uS%]'iA_8j4K;7x,H~//IObi8,Cȷ3~[}GjE 5ˏ;AHk)16íּ>v'j,IOboO';? o&5{2*Je;`D9E}7+#u-R|ǻC;]$oaEB5ӒWU"X"@gcPUwP1(۝8]!C ODU`xaideu8Euq6OkGg&*W$bמdk`ijq\› XKg6k}%ka.5Rkqc- >:lF+1I='huJx= Gߪm'f5߹%{ *auW%;'U2\ݧ8SunǓG%'X͖W65jȽgii.32 ב ^{ 8i:s$4p查6X\H ,5;Lɀs Q8(ίO7;ut4ל7;ӗ]nYy#ki`G(Z>8*ą3I[YP/Ƭ?1Rc0(gBjYgͅ+"KLAuŠfѯa7-vAMT*ahD! g9Wveńe"7Ih6N9Mu4 !CX!gSpc ϪC+=HŃ` }2ch %~}GXPLB)4*ٜ=/OA\:CzX`4,>nL_j&f#:ބN4~=6 Ld=60(X-U&c^bm.18ʀf̉^1 {L1UH)X 5g#\Q2ŰW"^{Ű·2 Nm^1aQ˱W"r e}oԇML,uV0徲v?m&)7&~ϣ n4ߗyѵ/@Тce,)v/, (z2J(i~/c{&! /oK$r9𻫻1!LYfZ=vkBo}c, (z&D<{e Uߍ9OFɄKFpҒ5ՙhW3U4vE>Sʛn+7汼ys?xJGqퟎ;{Z=k8WcRWlI4nSͣ;njVyT2GȠͣL.yZ+rfBf{~'bIW0!{_~ڇ%ڄT/5!nBtJ"*lB"B6!zloZ=2MMÊuaUwXc!E;ءL]WE{* wE(n/S+* 4KbRTy,MUI;%7fRk_Z⁋.Y麊{;c %фplڒ"lBdbU/$)@!gd%n; xuݘj&$Q(GYw~3!GmHO)D.&D&vY|5!ȁ? ބKFфT?yՍ fBdB%DLHXMo{u?!Eτ0Cn{ #SPYy8O{MEPkݘLl"xJ&DLg^muE߄< ÅY ),Ș`MLބT R= Z/ZdB#G3!{]- (z&D&vY|Q8꼿LcŠDd,0_1!5ܭȈBvcBXxZPL#h/2+2{!2! ٽἻ ;c𛐚j&dY}k_rӍXmsov|:ظ@D!/ 1V;]xRB;Q8bqDTW-;C&YI Z-G7fYY u=s͈EmQѬ.)fEd@3+B (* Fi\|%ioV,,1+]{⌌"YY Ho#Ok{skڛ\0Ž p/.bl\m Gt 'RYf  pTY_T> || b)GUYMen#-Q@RlqZ,`IMqTXGKH[;ҩQK=wݽyAݓw{w\mcY cL,Al*¿!xjIMjY+k` AC4{X kdE7CJn~|pzNC'Á^2v1/heբ1N:DK4I|F&9Ɇ:3 sM/]茮g{JGb/pᄃ|>پyһa{c@<ת ¨jmzN+McRpDJBY4"A bqEQR0ߗz]ֺbYMs}qIySWpڼ5MݭXsK&kJ:窫ipZ<̀ZΖi5^ xjwV<*1U{֦oMa/v9\5^mnt5>v{LJL2UOm6Jmx'oc?=ft0X-N 2bH{͈# _.6J$* ,ZK\@&*D.pv;jrd4̏ѽ=F L }ad*dVXt)7$Q;;fOqBSgaa $<6,t{qL>'Y*[ضngV jf^젿Cu;<*mvcv- ærmZ\&WiJ/?RMe5)YEHNMy*B9#L3x,g~R3Nl@2^2:!ᵟ}xP"eJuXΑ`Rպ$^TGs}xJ#ߐgSv Yr.XYRvcg>}{/?yN宧ŹMN`àb#$W2|I}j'[3Ia}C 7Czx]QYuVu=D7JLj۹o,Kb/.۳ti&U'͈b .] =^\y#[_ү~Z] g\b0qqz^td$3dL hdĀFȸdf`WEޑ}5DtE h;M)'P%G<gfkbmƠTT=?;1i5A!6+E'L:A?)$szBn ΛJʝ$BMrYrՐƾءF}`N퐎rXOKs2x,[ÆJC:)1&Q#!(xNT\֙ELa,Ӷ]M2dѡɯյ<ӽI~7t`,~z["^ `'0*x=]CV,Z^>%e;&̣?B8U)5%-«F>f gcotpZp$(_?vF$1LAt?er鍠 ļ{fsyl̯89QMT97 }x'Lj"A?:Fn' ~*<)'" i aLCzY<ꙟͤsfÝj^G7i | ؒނ6?B:ONBz iѲw7A6A*w+!Aڷ; _B;NB:=HC"¾4<\s%;w޽qq}^k[z=\[Qd/Ž okZ:L=3:^ <"@U 3A;rnl*TV"pK=P|l _j ˔UD۹ <[MT:hZ>;l} Լ^<MP_z幹O@NLz0n{+]m:wIhLJw/ +&29QZCG9Y r&19 -=|saޓuh¼_t'¼uwA0|{9-x񜅉xD<'W4D<,)@b"3ϙLsDIdF)6(ixNܟ97YJ@Mx=Fڋ^zTsƣ_8Bsc$3xR7$ B5Hĺ;+$j ! g6HXdLGʚV.Bd a% ea+ n@|W霸 b Xo&;3@B Wfۜ WP,.!;*.[*؈zMP.+Ï1l~l["0BlKxh|9z髫$e+w6ÙlPmj Ҫj<2OA%BfϗT7);ܭW߶DbDsG"2*yi@7+lCQ3ya?O-Zwo{uI }DIq/*ᑔIzh$ڿq8Pvi܌Qj|2A)`av`\ʸP2(~8lޅP[gסTGkQ)C?8L:T2FٕC'VoEEW aʶ _1; ~N-x$IµOBUpJ|=zwB>eg03Ohu;Pg*䮞Z6a(vHnx<6Y5/C̡%CT @;ck7,H!|11p7Mlt=7z堹 }OH;Li;ŕjmDUgyd]qG8SFvGMBKU-AV1ʲ!yPnxTWO^& *h|@y_?33_S4Gʖ,43_ӌԨ.a󅏉mOnF=Uf3ݰz3^fF=Ӎʼ9sŠP~Vd̽&5q$ <`WN򆣧{]=3j3¥?aZ;<Ԇ=*WYh*Ϊ/31C* gl`ᖁæܺތe8ZƌAMhP~lѤP.4o^ml9iGWѭ[m t %2*g yXeMA@LQ]Ҵ,5K;4 3;R ;2J5KS.;*3hޙyay3<Ͼ~~μ0Rn pMӦD$i 9  I$CZAZCR m 4]zvwO|G~xr?ޙy`66g&5у_:=#3 +$ dBN 9rt3!}!gAΆ9r|,@ `ȅ! CBA.\ r9d8d H(ȕѐ1q I !WC!S S!@\rd$r#&͐[ !Bf@n̄r'.,ݐِ{ B@BȦ,YYY y $a#G! AC<yi3g!AY yde+W!!y C!o@ބyd-d]{!@ !B6@>| )d#dd33/ [! _BCv@vB| -; !?B~ r+7BoR|ds3қvdZς|ЬC~qE_+Ynv^ا|W9GKi׌]:cJ=cqGOӌp11bqң)ΌSvU#OÐ# Cxxڎgۦg侚'yD|i<{7g-:mZԢԨti6*ŒZ|+=j9d/~ wCh J:܈q3pa;8+ճ'/2cx>;R},Gjo=1Vci[s\mu~svGO=I6cpc89:cttQMHZÌ[81Fb+ӣ:|sf>b1FWOg?&'@BA"!QhH $RR  9KZjÍG  YM&HDNC{Tb}8Cp2tS2bStC[˞[=-7XG-.>L|,_[:7`c@ ޸zqЯ7*nl'i`#I6;llVζI$-{.:a}ʌ:?sǘe/[jcE}{'ͯE+e*wѕ]t.Z4VEXEC}W.l=UE˞w]t+}B.E ?Su|K~=vNˠ]tkEö{ 3AR!itH;H{HHGH'HgHHWH;$Ʉ{W<4_Uh<m 2t @'`u:'8 %Og66-Y?m^bTT'dU鳓xP{q"Data generated by Autodesk Revit! `qKOrԸ&t a"e ̝ VS< !9N9<1L2U<2GP*AѨRi i0R* ﻳy~zg[u_Ygg{f2we2+2^),;e:l\̘\UuEޗnSrQ&Sÿ͗_'RP.`7&bqҹ\wdj%vdq>fC|Xz%VL-V.u7CSea鵐oh~L,ZAqk7 8.F/7z C h0&4 C#[(h44z C@$h2.4zz M o:4YA 'AG0/B3s h%588@Ker[;{G'hZ~@k_uzh;' !p`CPҎ TUj@BA5ZPS J*t5t t-tt=jnnnZA7C@BACw@wBwAwC@{6P[Z}}}-C?@BPM**@JPe T ՇN@ SSӠFЙY9йyЅE%ХPc tt9 j] ]] ]]5Z@-V-ЭmН]=Pk^>~ j==:@AC@BACO@'N3гPg9y ^ހބ@Caph4z @oCcqxh Z6{^v,s.ݫdʙp:+, 'uOz(;аNY~ pemy ǫ:vFvbωo.߮,5czQܾ ycK_ j к h*єSkVQfv&"o(N}8b=r1Z.ZRW{!\ESNQXz53.g"uuW3*kh2sی^Y5W{)X`8bNͬٙxS]8bԬu:4: :}@ZujV>DpuS^F:}K]fLDRH):5qqIN:m/ӷujv :#3.d٭pkJqʵӲqQUQKPb;zvQg`]SURP ߻qz6cz k5\ŨE7ѳI[lȣtmSfjFД*4X@|z\kM9xgT(-(,$us2vꙬnN8bYfpq]نZL\n9v};,˛}O]fk:"3U4̙}lsxIԴB^Zh1{-fSܙ̠fJ,]EW͵lBan'Ďlsbf&j}48eD|Bo*Q$1+Qx48&le[DQ舘Bo\MŨyY[6~1ԮD48kaοqT{*{3*ٴ_ A-TJFc">ͬ a^sݪ҃!Lv3󅺷XzQ_DsįNZmXbbe"߈QDDȆ׉KNXsOK;j_6.:LN݁- LD|#!e?H1G1.m91lIuY۸>$Q+RqGJu7gy2%ZVG}k*sVD/8ҜZ&Gqk~ea۸uf.pgv֍P^BYefl`~ 8ig氫3IQ lfuFoU_ # #|ccXhy?:6(\vݕ,AFM1(ZqL r=8ﵮ@gA:~bʩcؘg֕W[gP:>!9"ã2"*Qoo[!2T%,ИDktt tt0tt(tt8tt$tt4t t,tt^j+{~K\mJv`:Q-^ E~sZV_s473amY,͝h7]l[qZҙnɆs=Y+baӞDTIȺ[dQ["N*:TD1zPyˑPI{]m38*N*)ά̞x-3Q{#kIQDF]"VDA>jhT b_5J4%txiBEr2> /_?Ģbpo5 g":p}180%'XPthI~wK!j'9'Qu%)\ ?ZnDmtLl3sS8R]wIHwt jNٟྂhA}g"uPDãzQǥDuj'PDNKfvȸs4:koyPXyBT/Thv7N;2 5όܐygEnLI3"7%AR#lH$țȉW#o7|%0-p&"nUwlE֐ݡhs1o݇H4o{ |RISK-w3sW"\aDs;:H9eSqwo*֙xqbw!;nڈVGm\[8T#_٭ܿ9>ɜUCGGǠǡ'ГSP'iY3<" uC=+P/7z C h0&4 C#[(h44z C@$h2.4zz M>C3ЇG,h64 } }} ̓~[hDP!TCA%P.;T  zC}Wk`)+8< .AŢױΒ>\ 8isYmta{Hm A?uY=Qzg"6kᣢzl9?󚾒b_w:"3SqX)o(>D38YHgj%|)v E;5@>;jjvXd*'%)5#8GnIm38*튲s3Q[fO=E(":Qa(Qh%xA DF,DtIU dnBD75)IKWLS<.T =Dӟ|ΫΙ{YHg"PD'n}gf"g"E("^Ua^TThNN|MD~ꉜh9y8@DEb3y.2fʞsOUqpFbD ՠd,:qad#~CF"o;A'1(zUwу;D2oZ=D3P fXq+ Ԋ1R"uWibJ'51 6#'50=˜p&b)Vi׵U wD}83SLB"CoH )Ȅ%$?aVݗ)ʬݗ[X٩i|3=E4'"ukHyi?vQgX}HGLj%'t۴3L}Ι',rV"G]Nhg> / ǢD@bBdT$D^щv{wy\w y3 f˘&3A{b7"%X)+o"ۅ,<$H %k-= $i_Ny/t2Hz<:1_z F"D'(ӉdJGTn a?FACyLP~O뾁@Ker[;{G'hZ~@k_uzh;zwnfa{}AlmrDܒTl4guY=تq&-^ Pѹb+ oՖ;eqb)(Q}% ~"~Lvަy5?QK%틈:`cWg"n:m3:LD("VnĉDV՝qdt,t&~Qםt&b֨N"bVKHį y3N]w6ҙY; UD"8; \V͇Wc~`68.Q%߾v)uTPmt;g ?Ekծ̨FA.v!Ho Kr2]]\,<޻)OUIII6ҙ[E?PqM'9Y,pޱ6| |?fMwlte|i^X8~UAE)( UXB{$ jܢWAWI]% *Lf{g%aREƢ(ƪHXU5SM&h{0oDV9պ6ҙ:'ZW"bD7dW89᪷¼5$ᱭܢLn5m%m j; <3}'jJ"ppKpRՒvPu8EQ;1;I0;1;K0՘/b`vL\7 FLD}IOJHg"0JzRB"(*)]$N$8'<\LX-ĢTP%Tyfr?SOՑD`pu%S.=\=q[O{1{J0{1{I0{1q/^#2)df[h fPұkWqOb*ĪjK:@eA~Xuڪ%Vn$V`U'U:Tba*JD&pUK:BenA~Xuڪ#%V8OQNd֝ic a6^oՖ9F989,N@' ny\0}->^Ro,8!*ֱC8Wi(qbCE("NL2^$e'-8Y܃?YҴO aA`N`NU iY4ut#I4RE^8W9S3N8+x%L"P>41MI>W>8W9OHqC(^IH\  SWHbEjD(".N2^e-4Ծ>mnǴK%Xi4`.Sc.`.a>`N\.4UcJ0W1WH0W1WJ0W1WI0Ԙfj5j5̵j̵ujujLs5Bi!TcZJ0717H0717J0717I0ԘVj-j-̭j̭mjmjj̝j̝]j]!L=j=Lk5sx+2}!~?2 /U"D A/Mʺoe,g˫} 8b$1o[)]l} Ncv P`,jd>(AEIbTqF1w;;H!5! a5a 5 Q5Q bK m]'yfAR{W*^ =񏋭VcqO$D?(scG(<<)<s&Ca) S&1c&4,zXxG!2_Xu3>KyFtSmtWS8Յ{NQ"D_ EuKʼnJw(B#x%L"gNw?1( {_i{%ǩqNѽ$NT.q.މPqs EIʼnʫ'vEDT,U^X2~wȰEkż^?4_=q^POD("$N$uB1Kr0yBD^ͼ$9 yK0o뇱h̚]*"o*:C Caph$4J2;D ~ Mؿ S7:Sq$2BbوT)ƍL:^- TFql/F18^eL9b nIԘT*vlA Ere-iwc-oYf걒a2XNYhz |/[CΙWPłײieWL[!䶩S k;aV_bZxh4Mޅ@ACSith4͆@sOOy|h Z} }} -@Ker[;{G'hZ~CfhNܻ8Pc(wfivC0.!ocL`%eG&߲cgS%nRN_7ةrrh2qV+g"]6kᔜ0qVLD/,n8N"b%H"Q Dݴ5o&b5YҾ |DLuHg"CuPD|'1K]wf‰ '$ $u7[]w;ORwsԃ~qP2U[h#~tҙDm=Z݉PDSDI|5JD,P&$͚jI"3u(o#/a"BH]wIHėPW! /%(.%RY}_1_K0AoIzNKԣƏzBpz67DreNײoEwj("^?ŒfMďjI"'u(K:q+o#0Y]w?IH*hUj0Z2xwy5ԭ "iybU姢қ(f7H7MyB ť E[3Ժ6>5ɛ>і+M߻:Eǫ˃,g+KDˉdͳh$KDLKBlAr  tm "t Jf \A`EcL5SHP4DcKb `[,`7!EL{;w{{w6MoʛN]ԙ8\;':]4Ƙ-Z݃|tG<+F.sq'*KN;Z麛ZMjs\7 ¸X.G|mP+n0 Mc.^pZS%M)08>.*ov$]! g[-jʧ$) WG#pgdZ6@6;+ձ#H.6JkBH6{/\'Is0osBQ$m_(#}RGb0'·hop8:U}R_{>fnƲ)vJkLg5~8K35V8 {.U.mU^ ང!2RnyʕkgGl|l)+ '3[Ϸrp=F &Urs[}/-P|^:j(z^r箅KyVԉQl :jI{?e ϯ CQ|< P pR\//-<%+c _zl;ߵS]],[^G{n5]8z-Vz}g{oXTI=S:] ?wL=ڶӭF( 3NRh٧7'< 5yDIނy,N Xp_-\K"Ί 4o[  ނ ęɭˁ,zX\V7`pX VV: kAj|2vԙ#3a7+1C3?>;r5 HaNp.'\ q0 < ]W 2Hr$0WPG0 Am0Fw{`x&1q ]` pX,ƀ`,X+`Ep8X V?#AOpXLѠ?xlU,xԁ@ۂ`Wxw pDPNɠ3)~T , NKAwpX<6  6s@$<6Oxl_σ/`.2xl ^_K , z֠:XԂޠ 6`m-lnۃ:\x l vہ`g0| v{oC0!c`{_{_}`_p.8| 0 `2.CE` 0L#4p).`p8\ W`:c`׃ p#8<q&8G88?/c<"o ||C|.EKYW<Euwu.55<%&Kɾ d#W6CQȅRTڧlxJ Eg& !JfUТy4&Ƙ.R$iSj1lJO$_X[kl[dSx6'\锤5Sx>w{Gq#v3lk\,~+7Grc}d?A9ݥB{٤BEKu+T6:{aDCG?79gf/26z TA\/P8SB,i%6G E7ډPl]"`rzmYzSXtt=fHI=01ŷ.^Rpt^+d)=3਌,%)6 p `,)Rڪn܌sIvSL"KɸjJwاRO5^csSi?W:4^5ݫw5MPx)ojMjqJ%tri<C94ǮvmyF?fVLCCxO3?}5xh<2ymn^㥩\J47pwQ])zƒY3#K<͚ƣ_v>5^Fy:~[ǣy ?:f))O£"S_-g]1'veBvUut-cT3b)>ڢYm=, }pŕP]9Ψ~j;ԍC<nrvӛ]rC8ԍ^!kL^W7+Ym+%nuW7+[9-!ꆬ ZM}f5izәODݬ~v 5ͯօUvOAY\